Human AHCY(Adenosylhomocysteinase) ELISA Kit

Human AHCY(Adenosylhomocysteinase) ELISA Kit

To Order Contact us below: 

Human Adenosylhomocysteinase (AHCY) ELISA Kit
RDR-AHCY-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Adenosylhomocysteinase (AHCY) ELISA Kit
RDR-AHCY-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human AHCY/ Adenosylhomocysteinase ELISA Kit
E0090Hu	Sunlong	1 Kit	EUR 605

Human Adenosylhomocysteinase (AHCY) ELISA Kit
20-abx150594	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human AHCY(Adenosylhomocysteinase) ELISA Kit
EH1440	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P23526 Alias: AHCY(Adenosylhomocysteinase)/AdoHcyase/SAHH/S-adenosylhomocysteine hydrolase/S-adenosyl-L-homocysteine hydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Adenosylhomocysteinase, AHCY ELISA KIT
ELI-04169h	Lifescience Market	96 Tests	EUR 824

Human Adenosylhomocysteinase (AHCY) ELISA Kit
abx571390-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Adenosylhomocysteinase(AHCY)ELISA Kit
QY-E00880	Qayee Biotechnology	96T	EUR 361

Human Adenosylhomocysteinase ELISA Kit (AHCY)
RK00850	Abclonal	96 Tests	EUR 521

Human Adenosylhomocysteinase (AHCY) ELISA Kit
SEG465Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenosylhomocysteinase (AHCY) ELISA Kit
SEG465Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenosylhomocysteinase (AHCY) ELISA Kit
SEG465Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenosylhomocysteinase (AHCY) ELISA Kit
SEG465Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenosylhomocysteinase (AHCY) ELISA Kit
4-SEG465Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Adenosylhomocysteinase elisa. Alternative names of the recognized antigen: SAHH AdoHcyase S-Adenosylhomocysteine Hydrolase S-adenosyl-L-homocysteine hydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenosylhomocysteinase (AHCY) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Adenosylhomocysteinase (AHCY)
1-CSB-EP001474HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 63.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Adenosylhomocysteinase(AHCY) expressed in E.coli

Rat Ahcy/ Adenosylhomocysteinase ELISA Kit
E0043Ra	Sunlong	1 Kit	EUR 646

Mouse Ahcy/ Adenosylhomocysteinase ELISA Kit
E0060Mo	Sunlong	1 Kit	EUR 632

Mouse Adenosylhomocysteinase (AHCY) ELISA Kit
abx254911-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Adenosylhomocysteinase, Ahcy ELISA KIT
ELI-04170m	Lifescience Market	96 Tests	EUR 865

Porcine Adenosylhomocysteinase, AHCY ELISA KIT
ELI-04172p	Lifescience Market	96 Tests	EUR 928

Bovine Adenosylhomocysteinase, AHCY ELISA KIT
ELI-04173b	Lifescience Market	96 Tests	EUR 928

Cow Adenosylhomocysteinase (AHCY) ELISA Kit
abx516092-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pig Adenosylhomocysteinase (AHCY) ELISA Kit
abx516095-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Adenosylhomocysteinase (AHCY) ELISA Kit
abx516096-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Ahcy(Adenosylhomocysteinase) ELISA Kit
EM0560	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P50247 Alias: Ahcy/AHCY(Adenosylhomocysteinase)/AdoHcyase/SAHH/S-adenosylhomocysteine hydrolase/S-adenosyl-L-homocysteine hydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

ELISA kit for Human AHCY (Adenosylhomocysteinase)
ELK4149	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adenosylhomocysteinase (AHCY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Aden Show more
Description: A sandwich ELISA kit for detection of Adenosylhomocysteinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Adenosylhomocysteinase (AHCY)
KTE60972-48T	Abbkine	48T	EUR 332
S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adenosylhomocysteinase (AHCY)
KTE60972-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adenosylhomocysteinase (AHCY)
KTE60972-96T	Abbkine	96T	EUR 539
S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Active Adenosylhomocysteinase (AHCY)
4-APG465Hu01	Cloud-Clone	EUR 825.76 EUR 324.00 EUR 2821.60 EUR 1007.20 EUR 1914.40 EUR 616.00 EUR 6904.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P23526 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.3kDa Isoelectric Point: 5.9
Description: Recombinant Human Adenosylhomocysteinase expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Adenosylhomocysteinase (AHCY) Antibody
abx026146-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody
abx026146-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody
20-abx004050	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody
20-abx115369	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody
abx037199-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody
20-abx129121	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Adenosylhomocysteinase (AHCY) Antibody
20-abx109497	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody
20-abx109498	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody
20-abx171083	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Adenosylhomocysteinase (AHCY) Antibody
abx230226-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Adenosylhomocysteinase (AHCY) Antibody
abx230227-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Recombinant Adenosylhomocysteinase (AHCY)
4-RPG465Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P23526 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Adenosylhomocysteinase expressed in: E.coli

Human Adenosylhomocysteinase (AHCY) CLIA Kit
20-abx495207	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Adenosylhomocysteinase (AHCY) Antibody
35689-05111	AssayPro	150 ug	EUR 261

Human Adenosylhomocysteinase (AHCY) Protein
20-abx167096	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ahcy ELISA Kit| Rat Adenosylhomocysteinase ELISA Kit
EF018288	Lifescience Market	96 Tests	EUR 689

AHCY ELISA Kit| Bovine Adenosylhomocysteinase ELISA Kit
EF011089	Lifescience Market	96 Tests	EUR 689

Ahcy ELISA Kit| Mouse Adenosylhomocysteinase ELISA Kit
EF013186	Lifescience Market	96 Tests	EUR 689

Adenosylhomocysteinase (AHCY) Antibody (Biotin)
20-abx105098	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (Biotin)
20-abx105099	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (FITC)
20-abx106515	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (FITC)
20-abx106516	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (HRP)
20-abx107932	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (HRP)
20-abx107933	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Adenosylhomocysteinase (AHCY) Protein (Active)
20-abx655555	Abbexa	EUR 1135.00 EUR 411.00 EUR 3780.00 EUR 1372.00 EUR 773.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human)
4-PAG465Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHCY (Ser2~Tyr432) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY)

AHCY Adenosylhomocysteinase Human Recombinant Protein
PROTP23526	BosterBio	Regular: 20ug	EUR 317
Description: AHCY Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 452 amino acids (1-432 a.a.) and having a molecular mass of 49.8 kDa. The AHCY is fused to a 20 amino acids His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Adenosylhomocysteinase (AHCY) Activity Fluorometric Assay Kit
K807-100	Biovision		EUR 865

Human Adenosylhomocysteinase (AHCY) Antibody (Biotin Conjugate)
35689-05121	AssayPro	150 ug	EUR 369

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), APC
4-PAG465Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHCY (Ser2~Tyr432) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with APC.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), Biotinylated
4-PAG465Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHCY (Ser2~Tyr432) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with Biotin.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), Cy3
4-PAG465Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHCY (Ser2~Tyr432) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with Cy3.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), FITC
4-PAG465Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHCY (Ser2~Tyr432) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with FITC.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), HRP
4-PAG465Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHCY (Ser2~Tyr432) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with HRP.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), PE
4-PAG465Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHCY (Ser2~Tyr432) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with PE.

AHCY Human, Adenosylhomocysteinase Human Recombinant Protein, Sf9
PROTP23526-1	BosterBio	Regular: 5ug	EUR 317
Description: AHCY Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 441 amino acids (1-432 a.a.) and having a molecular mass of 48.8kDa (Migrates at 40-57kDa on SDS-PAGE under reducing conditions). AHCY is fused to a 6 amino acids His-Tag at C-terminus and purified by proprietary chromatographic techniques.

Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (FITC Conjugate)
35689-05141	AssayPro	150 ug	EUR 428

Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (RPE Conjugate)
35689-05151	AssayPro	150 ug	EUR 428

Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (APC Conjugate)
35689-05161	AssayPro	150 ug	EUR 428

Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (PerCP Conjugate)
35689-05171	AssayPro	150 ug	EUR 471

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), APC-Cy7
4-PAG465Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHCY (Ser2~Tyr432) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with APC-Cy7.

Ahcy/ Rat Ahcy ELISA Kit
ELI-04171r	Lifescience Market	96 Tests	EUR 886

Human AHCY ELISA Kit
ELA-E12634h	Lifescience Market	96 Tests	EUR 824

AHCY ELISA KIT|Human
EF004894	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Adenosylhomocysteinase
EK3086	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosylhomocysteinase in samples from serum, plasma, tissue homogenates and other biological fluids.

AHCY ELISA Kit (Human) (OKAN05428)
OKAN05428	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

AHCY ELISA Kit (Human) (OKCD08938)
OKCD08938	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: S-adenosylhomocysteine hydrolase catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family.S-adenosylhomocysteine hydrolase catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

Human AHCYL1/ Adenosylhomocysteinase 2 ELISA Kit
E0091Hu	Sunlong	1 Kit	EUR 605

ELISA kit for Mouse Adenosylhomocysteinase
EK3085	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Adenosylhomocysteinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Adenosylhomocysteinase
7-02407	CHI Scientific	5µg	Ask for price

Recombinant Human Adenosylhomocysteinase
7-02408	CHI Scientific	20µg	Ask for price

Recombinant Human Adenosylhomocysteinase
7-02409	CHI Scientific	1mg	Ask for price

Human Adenosyl homocysteinase(AHCY) ELISA kit
E01A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenosyl homocysteinase(AHCY) ELISA kit
E01A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenosyl homocysteinase(AHCY) ELISA kit
E01A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Putative adenosylhomocysteinase 2
EK3087	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Putative adenosylhomocysteinase 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Putative adenosylhomocysteinase 2, AHCYL1 ELISA KIT
ELI-13501h	Lifescience Market	96 Tests	EUR 824

Human Putative adenosylhomocysteinase 3, AHCYL2 ELISA KIT
ELI-45449h	Lifescience Market	96 Tests	EUR 824

Human Adenosylhomocysteinase Like 2 (AHCYL2) ELISA Kit
abx384549-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Adenosylhomocysteinase Like 1 (AHCYL1) ELISA Kit
abx555866-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

AHCY ELISA Kit (Rat) (OKEH06195)
OKEH06195	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Adenosylhomocysteine is a competitive inhibitor of S-adenosyl-L-methionine-dependent methyl transferase reactions; therefore adenosylhomocysteinase may play a key role in the control of methylations via regulation of the intracellular concentration of adenosylhomocysteine. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

AHCY ELISA Kit (Bovine) (OKEH07864)
OKEH07864	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

AHCY ELISA Kit (Pig) (OKEH07865)
OKEH07865	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

AHCY ELISA Kit (Mouse) (OKEH03618)
OKEH03618	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Adenosylhomocysteine is a competitive inhibitor of S-adenosyl-L-methionine-dependent methyl transferase reactions; therefore adenosylhomocysteinase may play a key role in the control of methylations via regulation of the intracellular concentration of adenosylhomocysteine.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Ahcyl1 ELISA Kit| Mouse Adenosylhomocysteinase 2 ELISA Kit
EF014144	Lifescience Market	96 Tests	EUR 689

Ahcyl2 ELISA Kit| Mouse Adenosylhomocysteinase 3 ELISA Kit
EF014145	Lifescience Market	96 Tests	EUR 689

AHCY ELISA Kit (Human) : 96 Wells (OKEH02255)
OKEH02255	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Mouse Putative adenosylhomocysteinase 3, Ahcyl2 ELISA KIT
ELI-20135m	Lifescience Market	96 Tests	EUR 865

Mouse Putative adenosylhomocysteinase 2, Ahcyl1 ELISA KIT
ELI-29740m	Lifescience Market	96 Tests	EUR 865

Mouse Adenosylhomocysteinase Like 1 (AHCYL1) ELISA Kit
abx556051-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Adenosylhomocysteinase Like 2 (AHCYL2) ELISA Kit
abx388520-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Adenosyl homocysteinase(AHCY) ELISA kit
E02A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenosyl homocysteinase(AHCY) ELISA kit
E02A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenosyl homocysteinase(AHCY) ELISA kit
E02A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosyl homocysteinase(AHCY) ELISA kit
E06A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosyl homocysteinase(AHCY) ELISA kit
E06A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosyl homocysteinase(AHCY) ELISA kit
E06A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosyl homocysteinase(AHCY) ELISA kit
E03A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosyl homocysteinase(AHCY) ELISA kit
E03A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosyl homocysteinase(AHCY) ELISA kit
E03A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenosyl homocysteinase(AHCY) ELISA kit
E04A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenosyl homocysteinase(AHCY) ELISA kit
E04A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenosyl homocysteinase(AHCY) ELISA kit
E04A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosyl homocysteinase(AHCY) ELISA kit
E07A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosyl homocysteinase(AHCY) ELISA kit
E07A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosyl homocysteinase(AHCY) ELISA kit
E07A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosyl homocysteinase(AHCY) ELISA kit
E08A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosyl homocysteinase(AHCY) ELISA kit
E08A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosyl homocysteinase(AHCY) ELISA kit
E08A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosyl homocysteinase(AHCY) ELISA kit
E09A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosyl homocysteinase(AHCY) ELISA kit
E09A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosyl homocysteinase(AHCY) ELISA kit
E09A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AHCY antibody
70R-2721	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal AHCY antibody raised against the N terminal of AHCY

AHCY antibody
70R-15635	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal AHCY antibody

AHCY Antibody
32754-100ul	SAB	100ul	EUR 252

AHCY Antibody
1-CSB-PA001474GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

AHCY Antibody
1-CSB-PA001474HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AHCY Antibody
1-CSB-PA001474LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

AHCY Antibody
DF7260	Affbiotech	200ul	EUR 304
Description: AHCY Antibody detects endogenous levels of total AHCY.

AHCY siRNA
20-abx900231	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AHCY siRNA
20-abx907061	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AHCY siRNA
20-abx907062	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AHCY Antibody
ABD7260	Lifescience Market	100 ug	EUR 438

Active AHCY, human recombinant
7527-10	Biovision		EUR 262

Active AHCY, human recombinant
7527-1000	Biovision		EUR 5482

Active AHCY, human recombinant
7527-50	Biovision		EUR 479

Human AHCY shRNA Plasmid
20-abx950135	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

AHCY Recombinant Protein (Human)
RP000802	ABM	100 ug	Ask for price

AHCY Recombinant Protein (Human)
RP036520	ABM	100 ug	Ask for price

Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit
E05A1332-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit
E05A1332-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit
E05A1332-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AHCY Inhibitor Screening Kit (Fluorometric)
K326-100	Biovision		EUR 1001

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Saccharomyces cerevisiae Adenosylhomocysteinase (SAH1)
1-CSB-RP145174Ba	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 53 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Saccharomyces cerevisiae Adenosylhomocysteinase(SAH1) expressed in E.coli

SAHH/AHCY Antibody
6684-100	Biovision		EUR 316

SAHH/AHCY Antibody
6684-30T	Biovision		EUR 146

AHCY Rabbit pAb
A14182-100ul	Abclonal	100 ul	EUR 308

AHCY Rabbit pAb
A14182-200ul	Abclonal	200 ul	EUR 459

AHCY Rabbit pAb
A14182-20ul	Abclonal	20 ul	EUR 183

AHCY Rabbit pAb
A14182-50ul	Abclonal	50 ul	EUR 223

AHCY Blocking Peptide
33R-8359	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AHCY antibody, catalog no. 70R-2721

AHCY Blocking Peptide
DF7260-BP	Affbiotech	1mg	EUR 195

AHCY Enzyme (Recombinant)
20-abx073135	Abbexa	EUR 2861.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

AHCY Conjugated Antibody
C32754	SAB	100ul	EUR 397

AHCY cloning plasmid
CSB-CL001474HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1299 Sequence: atgtctgacaaactgccctacaaagtcgccgacatcggcctggctgcctggggacgcaaggccctggacattgctgagaacgagatgccgggcctgatgcgtatgcgggagcggtactcggcctccaagccactgaagggcgcccgcatcgctggctgcctgcacatgaccgtgg Show more
Description: A cloning plasmid for the AHCY gene.

AHCY cloning plasmid
CSB-CL001474HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 921 Sequence: ATGATTCTGGACGACGGGGGCGACCTCACCAACCTCATCCACACCAAGTACCCGCAGCTTCTGCCAGGCATCCGAGGCATCTCTGAGGAGACCACGACTGGGGTCCACAACCTCTACAAGATGATGGCCAATGGGATCCTCAAGGTGCCTGCCATCAATGTCAATGACTCCGTCAC Show more
Description: A cloning plasmid for the AHCY gene.

AHCY Rabbit pAb
A5300-100ul	Abclonal	100 ul	EUR 308

AHCY Rabbit pAb
A5300-200ul	Abclonal	200 ul	EUR 459

AHCY Rabbit pAb
A5300-20ul	Abclonal	20 ul	EUR 183

AHCY Rabbit pAb
A5300-50ul	Abclonal	50 ul	EUR 223

AHCY Polyclonal Antibody
A54380	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

AHCY Polyclonal Antibody
A54894	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

anti- AHCY antibody
FNab00226	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 Immunogen: S-adenosylhomocysteine hydrolase Uniprot ID: P23526 Gene ID: 191 Research Area: Metabolism
Description: Antibody raised against AHCY

anti- AHCY antibody
FNab00227	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: S-adenosylhomocysteine hydrolase Uniprot ID: P23526 Gene ID: 191 Research Area: Metabolism
Description: Antibody raised against AHCY

Anti-AHCY antibody
PAab00226	Lifescience Market	100 ug	EUR 386

Anti-AHCY antibody
STJ27253	St John's Laboratory	100 µl	EUR 277
Description: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-AHCY antibody
STJ116115	St John's Laboratory	100 µl	EUR 277
Description: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-AHCY (M2)
YF-MA20271	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to AHCY

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

AHCY ORF Vector (Human) (pORF)
ORF000268	ABM	1.0 ug DNA	EUR 95

AHCY ORF Vector (Human) (pORF)
ORF012174	ABM	1.0 ug DNA	EUR 354

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Adenosylhomocysteinase Like 1 (AHCYL1) Antibody
20-abx006676	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Adenosylhomocysteinase Like 1 (AHCYL1) Antibody
20-abx115370	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Adenosylhomocysteinase Like 2 (AHCYL2) Antibody
abx037789-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Adenosylhomocysteinase Like 1 (AHCYL1) Antibody
abx037861-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Adenosylhomocysteinase Like 1 (AHCYL1) Antibody
abx037862-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Human AHCY(Adenosylhomocysteinase) ELISA Kit