Human AHCY(Adenosylhomocysteinase) ELISA Kit

Human AHCY(Adenosylhomocysteinase) ELISA Kit

To Order Contact us below: 

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    RDR-AHCY-Hu-48Tests 48 Tests
    EUR 544

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    RDR-AHCY-Hu-96Tests 96 Tests
    EUR 756

    Human AHCY/ Adenosylhomocysteinase ELISA Kit

    E0090Hu 1 Kit
    EUR 605

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human AHCY(Adenosylhomocysteinase) ELISA Kit

    EH1440 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P23526
    • Alias: AHCY(Adenosylhomocysteinase)/AdoHcyase/SAHH/S-adenosylhomocysteine hydrolase/S-adenosyl-L-homocysteine hydrolase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Adenosylhomocysteinase, AHCY ELISA KIT

    ELI-04169h 96 Tests
    EUR 824

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    abx571390-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Adenosylhomocysteinase(AHCY)ELISA Kit

    QY-E00880 96T
    EUR 361

    Human Adenosylhomocysteinase ELISA Kit (AHCY)

    RK00850 96 Tests
    EUR 521

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    SEG465Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    SEG465Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    SEG465Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    SEG465Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

    Human Adenosylhomocysteinase (AHCY) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Adenosylhomocysteinase elisa. Alternative names of the recognized antigen: SAHH
    • AdoHcyase
    • S-Adenosylhomocysteine Hydrolase
    • S-adenosyl-L-homocysteine hydrolase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenosylhomocysteinase (AHCY) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Adenosylhomocysteinase (AHCY)

    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 63.6 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Adenosylhomocysteinase(AHCY) expressed in E.coli

    Rat Ahcy/ Adenosylhomocysteinase ELISA Kit

    E0043Ra 1 Kit
    EUR 646

    Mouse Ahcy/ Adenosylhomocysteinase ELISA Kit

    E0060Mo 1 Kit
    EUR 632

    Mouse Adenosylhomocysteinase (AHCY) ELISA Kit

    abx254911-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Mouse Adenosylhomocysteinase, Ahcy ELISA KIT

    ELI-04170m 96 Tests
    EUR 865

    Porcine Adenosylhomocysteinase, AHCY ELISA KIT

    ELI-04172p 96 Tests
    EUR 928

    Bovine Adenosylhomocysteinase, AHCY ELISA KIT

    ELI-04173b 96 Tests
    EUR 928

    Cow Adenosylhomocysteinase (AHCY) ELISA Kit

    abx516092-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Pig Adenosylhomocysteinase (AHCY) ELISA Kit

    abx516095-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Adenosylhomocysteinase (AHCY) ELISA Kit

    abx516096-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Mouse Ahcy(Adenosylhomocysteinase) ELISA Kit

    EM0560 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P50247
    • Alias: Ahcy/AHCY(Adenosylhomocysteinase)/AdoHcyase/SAHH/S-adenosylhomocysteine hydrolase/S-adenosyl-L-homocysteine hydrolase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

    ELISA kit for Human AHCY (Adenosylhomocysteinase)

    ELK4149 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adenosylhomocysteinase (AHCY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Aden
    • Show more
    Description: A sandwich ELISA kit for detection of Adenosylhomocysteinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Adenosylhomocysteinase (AHCY)

    KTE60972-48T 48T
    EUR 332
    • S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Adenosylhomocysteinase (AHCY)

    KTE60972-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Adenosylhomocysteinase (AHCY)

    KTE60972-96T 96T
    EUR 539
    • S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Active Adenosylhomocysteinase (AHCY)

    • EUR 825.76
    • EUR 324.00
    • EUR 2821.60
    • EUR 1007.20
    • EUR 1914.40
    • EUR 616.00
    • EUR 6904.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P23526
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 51.3kDa
    • Isoelectric Point: 5.9
    Description: Recombinant Human Adenosylhomocysteinase expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

    Adenosylhomocysteinase (AHCY) Antibody

    abx026146-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    abx026146-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    abx037199-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Adenosylhomocysteinase (AHCY) Antibody

    abx230226-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Adenosylhomocysteinase (AHCY) Antibody

    abx230227-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Recombinant Adenosylhomocysteinase (AHCY)

    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P23526
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 51.3kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Adenosylhomocysteinase expressed in: E.coli

    Human Adenosylhomocysteinase (AHCY) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Adenosylhomocysteinase (AHCY) Antibody

    35689-05111 150 ug
    EUR 261

    Human Adenosylhomocysteinase (AHCY) Protein

    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Ahcy ELISA Kit| Rat Adenosylhomocysteinase ELISA Kit

    EF018288 96 Tests
    EUR 689

    AHCY ELISA Kit| Bovine Adenosylhomocysteinase ELISA Kit

    EF011089 96 Tests
    EUR 689

    Ahcy ELISA Kit| Mouse Adenosylhomocysteinase ELISA Kit

    EF013186 96 Tests
    EUR 689

    Adenosylhomocysteinase (AHCY) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase (AHCY) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Human Adenosylhomocysteinase (AHCY) Protein (Active)

    • EUR 1135.00
    • EUR 411.00
    • EUR 3780.00
    • EUR 1372.00
    • EUR 773.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human)

    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: AHCY (Ser2~Tyr432)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY)

    AHCY Adenosylhomocysteinase Human Recombinant Protein

    PROTP23526 Regular: 20ug
    EUR 317
    Description: AHCY Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 452 amino acids (1-432 a.a.) and having a molecular mass of 49.8 kDa. The AHCY is fused to a 20 amino acids His-Tag at N-terminus and purified by proprietary chromatographic techniques.

    Adenosylhomocysteinase (AHCY) Activity Fluorometric Assay Kit

    EUR 865

    Human Adenosylhomocysteinase (AHCY) Antibody (Biotin Conjugate)

    35689-05121 150 ug
    EUR 369

    Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), APC

    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: AHCY (Ser2~Tyr432)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with APC.

    Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), Biotinylated

    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: AHCY (Ser2~Tyr432)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with Biotin.

    Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), Cy3

    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: AHCY (Ser2~Tyr432)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with Cy3.

    Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), FITC

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: AHCY (Ser2~Tyr432)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with FITC.

    Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), HRP

    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: AHCY (Ser2~Tyr432)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with HRP.

    Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), PE

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: AHCY (Ser2~Tyr432)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with PE.

    AHCY Human, Adenosylhomocysteinase Human Recombinant Protein, Sf9

    PROTP23526-1 Regular: 5ug
    EUR 317
    Description: AHCY Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 441 amino acids (1-432 a.a.) and having a molecular mass of 48.8kDa (Migrates at 40-57kDa on SDS-PAGE under reducing conditions). AHCY is fused to a 6 amino acids His-Tag at C-terminus and purified by proprietary chromatographic techniques.

    Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (FITC Conjugate)

    35689-05141 150 ug
    EUR 428

    Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (RPE Conjugate)

    35689-05151 150 ug
    EUR 428

    Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (APC Conjugate)

    35689-05161 150 ug
    EUR 428

    Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (PerCP Conjugate)

    35689-05171 150 ug
    EUR 471

    Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), APC-Cy7

    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: AHCY (Ser2~Tyr432)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with APC-Cy7.

    Ahcy/ Rat Ahcy ELISA Kit

    ELI-04171r 96 Tests
    EUR 886

    Human AHCY ELISA Kit

    ELA-E12634h 96 Tests
    EUR 824


    EF004894 96 Tests
    EUR 689

    ELISA kit for Human Adenosylhomocysteinase

    EK3086 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosylhomocysteinase in samples from serum, plasma, tissue homogenates and other biological fluids.

    AHCY ELISA Kit (Human) (OKAN05428)

    OKAN05428 96 Wells
    EUR 792
    Description: Description of target: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

    AHCY ELISA Kit (Human) (OKCD08938)

    OKCD08938 96 Wells
    EUR 975
    Description: Description of target: S-adenosylhomocysteine hydrolase catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family.S-adenosylhomocysteine hydrolase catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

    Human AHCYL1/ Adenosylhomocysteinase 2 ELISA Kit

    E0091Hu 1 Kit
    EUR 605

    ELISA kit for Mouse Adenosylhomocysteinase

    EK3085 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Adenosylhomocysteinase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Recombinant Human Adenosylhomocysteinase

    7-02407 5µg Ask for price

    Recombinant Human Adenosylhomocysteinase

    7-02408 20µg Ask for price

    Recombinant Human Adenosylhomocysteinase

    7-02409 1mg Ask for price

    Human Adenosyl homocysteinase(AHCY) ELISA kit

    E01A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Adenosyl homocysteinase(AHCY) ELISA kit

    E01A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Adenosyl homocysteinase(AHCY) ELISA kit

    E01A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Human Putative adenosylhomocysteinase 2

    EK3087 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Putative adenosylhomocysteinase 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human Putative adenosylhomocysteinase 2, AHCYL1 ELISA KIT

    ELI-13501h 96 Tests
    EUR 824

    Human Putative adenosylhomocysteinase 3, AHCYL2 ELISA KIT

    ELI-45449h 96 Tests
    EUR 824

    Human Adenosylhomocysteinase Like 2 (AHCYL2) ELISA Kit

    abx384549-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Adenosylhomocysteinase Like 1 (AHCYL1) ELISA Kit

    abx555866-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    AHCY ELISA Kit (Rat) (OKEH06195)

    OKEH06195 96 Wells
    EUR 779
    Description: Description of target: Adenosylhomocysteine is a competitive inhibitor of S-adenosyl-L-methionine-dependent methyl transferase reactions; therefore adenosylhomocysteinase may play a key role in the control of methylations via regulation of the intracellular concentration of adenosylhomocysteine. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

    AHCY ELISA Kit (Bovine) (OKEH07864)

    OKEH07864 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    AHCY ELISA Kit (Pig) (OKEH07865)

    OKEH07865 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    AHCY ELISA Kit (Mouse) (OKEH03618)

    OKEH03618 96 Wells
    EUR 779
    Description: Description of target: Adenosylhomocysteine is a competitive inhibitor of S-adenosyl-L-methionine-dependent methyl transferase reactions; therefore adenosylhomocysteinase may play a key role in the control of methylations via regulation of the intracellular concentration of adenosylhomocysteine.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Ahcyl1 ELISA Kit| Mouse Adenosylhomocysteinase 2 ELISA Kit

    EF014144 96 Tests
    EUR 689

    Ahcyl2 ELISA Kit| Mouse Adenosylhomocysteinase 3 ELISA Kit

    EF014145 96 Tests
    EUR 689

    AHCY ELISA Kit (Human) : 96 Wells (OKEH02255)

    OKEH02255 96 Wells
    EUR 662
    Description: Description of target: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

    Mouse Putative adenosylhomocysteinase 3, Ahcyl2 ELISA KIT

    ELI-20135m 96 Tests
    EUR 865

    Mouse Putative adenosylhomocysteinase 2, Ahcyl1 ELISA KIT

    ELI-29740m 96 Tests
    EUR 865

    Mouse Adenosylhomocysteinase Like 1 (AHCYL1) ELISA Kit

    abx556051-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Adenosylhomocysteinase Like 2 (AHCYL2) ELISA Kit

    abx388520-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Adenosyl homocysteinase(AHCY) ELISA kit

    E02A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Adenosyl homocysteinase(AHCY) ELISA kit

    E02A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Adenosyl homocysteinase(AHCY) ELISA kit

    E02A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Adenosyl homocysteinase(AHCY) ELISA kit

    E06A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Adenosyl homocysteinase(AHCY) ELISA kit

    E06A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Adenosyl homocysteinase(AHCY) ELISA kit

    E06A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Adenosyl homocysteinase(AHCY) ELISA kit

    E03A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Adenosyl homocysteinase(AHCY) ELISA kit

    E03A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Adenosyl homocysteinase(AHCY) ELISA kit

    E03A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Adenosyl homocysteinase(AHCY) ELISA kit

    E04A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Adenosyl homocysteinase(AHCY) ELISA kit

    E04A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Adenosyl homocysteinase(AHCY) ELISA kit

    E04A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Adenosyl homocysteinase(AHCY) ELISA kit

    E07A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Adenosyl homocysteinase(AHCY) ELISA kit

    E07A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Adenosyl homocysteinase(AHCY) ELISA kit

    E07A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Adenosyl homocysteinase(AHCY) ELISA kit

    E08A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Adenosyl homocysteinase(AHCY) ELISA kit

    E08A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Adenosyl homocysteinase(AHCY) ELISA kit

    E08A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Adenosyl homocysteinase(AHCY) ELISA kit

    E09A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Adenosyl homocysteinase(AHCY) ELISA kit

    E09A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Adenosyl homocysteinase(AHCY) ELISA kit

    E09A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    AHCY antibody

    70R-2721 50 ug
    EUR 467
    Description: Rabbit polyclonal AHCY antibody raised against the N terminal of AHCY

    AHCY antibody

    70R-15635 50 ul
    EUR 435
    Description: Rabbit polyclonal AHCY antibody

    AHCY Antibody

    32754-100ul 100ul
    EUR 252

    AHCY Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    AHCY Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

    AHCY Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    AHCY Antibody

    DF7260 200ul
    EUR 304
    Description: AHCY Antibody detects endogenous levels of total AHCY.

    AHCY siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    AHCY siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    AHCY siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    AHCY Antibody

    ABD7260 100 ug
    EUR 438

    Active AHCY, human recombinant

    EUR 262

    Active AHCY, human recombinant

    EUR 5482

    Active AHCY, human recombinant

    EUR 479

    Human AHCY shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    AHCY Recombinant Protein (Human)

    RP000802 100 ug Ask for price

    AHCY Recombinant Protein (Human)

    RP036520 100 ug Ask for price

    Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit

    E05A1332-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit

    E05A1332-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit

    E05A1332-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    AHCY Inhibitor Screening Kit (Fluorometric)

    EUR 1001

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Saccharomyces cerevisiae Adenosylhomocysteinase (SAH1)

    • EUR 611.00
    • EUR 309.00
    • EUR 1827.00
    • EUR 939.00
    • EUR 1218.00
    • EUR 397.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 53 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Saccharomyces cerevisiae Adenosylhomocysteinase(SAH1) expressed in E.coli

    SAHH/AHCY Antibody

    EUR 316

    SAHH/AHCY Antibody

    EUR 146

    AHCY Rabbit pAb

    A14182-100ul 100 ul
    EUR 308

    AHCY Rabbit pAb

    A14182-200ul 200 ul
    EUR 459

    AHCY Rabbit pAb

    A14182-20ul 20 ul
    EUR 183

    AHCY Rabbit pAb

    A14182-50ul 50 ul
    EUR 223

    AHCY Blocking Peptide

    33R-8359 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AHCY antibody, catalog no. 70R-2721

    AHCY Blocking Peptide

    DF7260-BP 1mg
    EUR 195

    AHCY Enzyme (Recombinant)

    • EUR 2861.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    AHCY Conjugated Antibody

    C32754 100ul
    EUR 397

    AHCY cloning plasmid

    CSB-CL001474HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1299
    • Sequence: atgtctgacaaactgccctacaaagtcgccgacatcggcctggctgcctggggacgcaaggccctggacattgctgagaacgagatgccgggcctgatgcgtatgcgggagcggtactcggcctccaagccactgaagggcgcccgcatcgctggctgcctgcacatgaccgtgg
    • Show more
    Description: A cloning plasmid for the AHCY gene.

    AHCY cloning plasmid

    CSB-CL001474HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 921
    • Show more
    Description: A cloning plasmid for the AHCY gene.

    AHCY Rabbit pAb

    A5300-100ul 100 ul
    EUR 308

    AHCY Rabbit pAb

    A5300-200ul 200 ul
    EUR 459

    AHCY Rabbit pAb

    A5300-20ul 20 ul
    EUR 183

    AHCY Rabbit pAb

    A5300-50ul 50 ul
    EUR 223

    AHCY Polyclonal Antibody

    A54380 100 µg
    EUR 570.55
    Description: fast delivery possible

    AHCY Polyclonal Antibody

    A54894 100 µg
    EUR 570.55
    Description: reagents widely cited

    anti- AHCY antibody

    FNab00226 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:5000
    • IHC: 1:20-1:200
    • Immunogen: S-adenosylhomocysteine hydrolase
    • Uniprot ID: P23526
    • Gene ID: 191
    • Research Area: Metabolism
    Description: Antibody raised against AHCY

    anti- AHCY antibody

    FNab00227 100µg
    EUR 585
    • Recommended dilution: WB: 1:500-1:5000
    • IHC: 1:20-1:200
    • IF: 1:10-1:100
    • Immunogen: S-adenosylhomocysteine hydrolase
    • Uniprot ID: P23526
    • Gene ID: 191
    • Research Area: Metabolism
    Description: Antibody raised against AHCY

    Anti-AHCY antibody

    PAab00226 100 ug
    EUR 386

    Anti-AHCY antibody

    STJ27253 100 µl
    EUR 277
    Description: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

    Anti-AHCY antibody

    STJ116115 100 µl
    EUR 277
    Description: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

    Anti-AHCY (M2)

    YF-MA20271 200 ul
    EUR 363
    Description: Mouse monoclonal to AHCY

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    AHCY ORF Vector (Human) (pORF)

    ORF000268 1.0 ug DNA
    EUR 95

    AHCY ORF Vector (Human) (pORF)

    ORF012174 1.0 ug DNA
    EUR 354

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    Adenosylhomocysteinase Like 1 (AHCYL1) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase Like 1 (AHCYL1) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase Like 2 (AHCYL2) Antibody

    abx037789-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase Like 1 (AHCYL1) Antibody

    abx037861-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Adenosylhomocysteinase Like 1 (AHCYL1) Antibody

    abx037862-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Human AHCY(Adenosylhomocysteinase) ELISA Kit