Human AHCY(Adenosylhomocysteinase) ELISA Kit

Human AHCY(Adenosylhomocysteinase) ELISA Kit

To Order Contact us below: 

Human Adenosylhomocysteinase (AHCY) ELISA Kit

RDR-AHCY-Hu-48Tests 48 Tests
EUR 544

Human Adenosylhomocysteinase (AHCY) ELISA Kit

RDR-AHCY-Hu-96Tests 96 Tests
EUR 756

Human AHCY/ Adenosylhomocysteinase ELISA Kit

E0090Hu 1 Kit
EUR 605

Human Adenosylhomocysteinase (AHCY) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human AHCY(Adenosylhomocysteinase) ELISA Kit

EH1440 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P23526
  • Alias: AHCY(Adenosylhomocysteinase)/AdoHcyase/SAHH/S-adenosylhomocysteine hydrolase/S-adenosyl-L-homocysteine hydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Adenosylhomocysteinase, AHCY ELISA KIT

ELI-04169h 96 Tests
EUR 824

Human Adenosylhomocysteinase (AHCY) ELISA Kit

abx571390-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Adenosylhomocysteinase(AHCY)ELISA Kit

QY-E00880 96T
EUR 361

Human Adenosylhomocysteinase ELISA Kit (AHCY)

RK00850 96 Tests
EUR 521

Human Adenosylhomocysteinase (AHCY) ELISA Kit

SEG465Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenosylhomocysteinase (AHCY) ELISA Kit

SEG465Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenosylhomocysteinase (AHCY) ELISA Kit

SEG465Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenosylhomocysteinase (AHCY) ELISA Kit

SEG465Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenosylhomocysteinase (AHCY) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenosylhomocysteinase (AHCY) in Tissue homogenates, cell lysates and other biological fluids.

Human Adenosylhomocysteinase (AHCY) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adenosylhomocysteinase elisa. Alternative names of the recognized antigen: SAHH
  • AdoHcyase
  • S-Adenosylhomocysteine Hydrolase
  • S-adenosyl-L-homocysteine hydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenosylhomocysteinase (AHCY) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Adenosylhomocysteinase (AHCY)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 63.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Adenosylhomocysteinase(AHCY) expressed in E.coli

Rat Ahcy/ Adenosylhomocysteinase ELISA Kit

E0043Ra 1 Kit
EUR 646

Mouse Ahcy/ Adenosylhomocysteinase ELISA Kit

E0060Mo 1 Kit
EUR 632

Mouse Adenosylhomocysteinase (AHCY) ELISA Kit

abx254911-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Adenosylhomocysteinase, Ahcy ELISA KIT

ELI-04170m 96 Tests
EUR 865

Porcine Adenosylhomocysteinase, AHCY ELISA KIT

ELI-04172p 96 Tests
EUR 928

Bovine Adenosylhomocysteinase, AHCY ELISA KIT

ELI-04173b 96 Tests
EUR 928

Cow Adenosylhomocysteinase (AHCY) ELISA Kit

abx516092-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Adenosylhomocysteinase (AHCY) ELISA Kit

abx516095-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Adenosylhomocysteinase (AHCY) ELISA Kit

abx516096-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Ahcy(Adenosylhomocysteinase) ELISA Kit

EM0560 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P50247
  • Alias: Ahcy/AHCY(Adenosylhomocysteinase)/AdoHcyase/SAHH/S-adenosylhomocysteine hydrolase/S-adenosyl-L-homocysteine hydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

ELISA kit for Human AHCY (Adenosylhomocysteinase)

ELK4149 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adenosylhomocysteinase (AHCY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Aden
  • Show more
Description: A sandwich ELISA kit for detection of Adenosylhomocysteinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Adenosylhomocysteinase (AHCY)

KTE60972-48T 48T
EUR 332
  • S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adenosylhomocysteinase (AHCY)

KTE60972-5platesof96wells 5 plates of 96 wells
EUR 2115
  • S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adenosylhomocysteinase (AHCY)

KTE60972-96T 96T
EUR 539
  • S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomoc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenosylhomocysteinase (AHCY) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Active Adenosylhomocysteinase (AHCY)

  • EUR 825.76
  • EUR 324.00
  • EUR 2821.60
  • EUR 1007.20
  • EUR 1914.40
  • EUR 616.00
  • EUR 6904.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23526
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.3kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Adenosylhomocysteinase expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Adenosylhomocysteinase (AHCY) Antibody

abx026146-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody

abx026146-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody

abx037199-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adenosylhomocysteinase (AHCY) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adenosylhomocysteinase (AHCY) Antibody

abx230226-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Adenosylhomocysteinase (AHCY) Antibody

abx230227-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Recombinant Adenosylhomocysteinase (AHCY)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P23526
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Adenosylhomocysteinase expressed in: E.coli

Human Adenosylhomocysteinase (AHCY) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Adenosylhomocysteinase (AHCY) Antibody

35689-05111 150 ug
EUR 261

Human Adenosylhomocysteinase (AHCY) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ahcy ELISA Kit| Rat Adenosylhomocysteinase ELISA Kit

EF018288 96 Tests
EUR 689

AHCY ELISA Kit| Bovine Adenosylhomocysteinase ELISA Kit

EF011089 96 Tests
EUR 689

Ahcy ELISA Kit| Mouse Adenosylhomocysteinase ELISA Kit

EF013186 96 Tests
EUR 689

Adenosylhomocysteinase (AHCY) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosylhomocysteinase (AHCY) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Adenosylhomocysteinase (AHCY) Protein (Active)

  • EUR 1135.00
  • EUR 411.00
  • EUR 3780.00
  • EUR 1372.00
  • EUR 773.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY)

AHCY Adenosylhomocysteinase Human Recombinant Protein

PROTP23526 Regular: 20ug
EUR 317
Description: AHCY Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 452 amino acids (1-432 a.a.) and having a molecular mass of 49.8 kDa. The AHCY is fused to a 20 amino acids His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Adenosylhomocysteinase (AHCY) Activity Fluorometric Assay Kit

EUR 865

Human Adenosylhomocysteinase (AHCY) Antibody (Biotin Conjugate)

35689-05121 150 ug
EUR 369

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with APC.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with Biotin.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with Cy3.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with FITC.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with HRP.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with PE.

AHCY Human, Adenosylhomocysteinase Human Recombinant Protein, Sf9

PROTP23526-1 Regular: 5ug
EUR 317
Description: AHCY Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 441 amino acids (1-432 a.a.) and having a molecular mass of 48.8kDa (Migrates at 40-57kDa on SDS-PAGE under reducing conditions). AHCY is fused to a 6 amino acids His-Tag at C-terminus and purified by proprietary chromatographic techniques.

Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (FITC Conjugate)

35689-05141 150 ug
EUR 428

Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (RPE Conjugate)

35689-05151 150 ug
EUR 428

Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (APC Conjugate)

35689-05161 150 ug
EUR 428

Human Adenosylhomocysteinase (AHCY) AssayLite Antibody (PerCP Conjugate)

35689-05171 150 ug
EUR 471

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with APC-Cy7.

Ahcy/ Rat Ahcy ELISA Kit

ELI-04171r 96 Tests
EUR 886


ELA-E12634h 96 Tests
EUR 824


EF004894 96 Tests
EUR 689

ELISA kit for Human Adenosylhomocysteinase

EK3086 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenosylhomocysteinase in samples from serum, plasma, tissue homogenates and other biological fluids.

AHCY ELISA Kit (Human) (OKAN05428)

OKAN05428 96 Wells
EUR 792
Description: Description of target: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

AHCY ELISA Kit (Human) (OKCD08938)

OKCD08938 96 Wells
EUR 975
Description: Description of target: S-adenosylhomocysteine hydrolase catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family.S-adenosylhomocysteine hydrolase catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

Human AHCYL1/ Adenosylhomocysteinase 2 ELISA Kit

E0091Hu 1 Kit
EUR 605

ELISA kit for Mouse Adenosylhomocysteinase

EK3085 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Adenosylhomocysteinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Adenosylhomocysteinase

7-02407 5µg Ask for price

Recombinant Human Adenosylhomocysteinase

7-02408 20µg Ask for price

Recombinant Human Adenosylhomocysteinase

7-02409 1mg Ask for price

Human Adenosyl homocysteinase(AHCY) ELISA kit

E01A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenosyl homocysteinase(AHCY) ELISA kit

E01A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenosyl homocysteinase(AHCY) ELISA kit

E01A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Putative adenosylhomocysteinase 2

EK3087 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Putative adenosylhomocysteinase 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Putative adenosylhomocysteinase 2, AHCYL1 ELISA KIT

ELI-13501h 96 Tests
EUR 824

Human Putative adenosylhomocysteinase 3, AHCYL2 ELISA KIT

ELI-45449h 96 Tests
EUR 824

Human Adenosylhomocysteinase Like 2 (AHCYL2) ELISA Kit

abx384549-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Adenosylhomocysteinase Like 1 (AHCYL1) ELISA Kit

abx555866-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

AHCY ELISA Kit (Rat) (OKEH06195)

OKEH06195 96 Wells
EUR 779
Description: Description of target: Adenosylhomocysteine is a competitive inhibitor of S-adenosyl-L-methionine-dependent methyl transferase reactions; therefore adenosylhomocysteinase may play a key role in the control of methylations via regulation of the intracellular concentration of adenosylhomocysteine. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

AHCY ELISA Kit (Bovine) (OKEH07864)

OKEH07864 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

AHCY ELISA Kit (Pig) (OKEH07865)

OKEH07865 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

AHCY ELISA Kit (Mouse) (OKEH03618)

OKEH03618 96 Wells
EUR 779
Description: Description of target: Adenosylhomocysteine is a competitive inhibitor of S-adenosyl-L-methionine-dependent methyl transferase reactions; therefore adenosylhomocysteinase may play a key role in the control of methylations via regulation of the intracellular concentration of adenosylhomocysteine.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Ahcyl1 ELISA Kit| Mouse Adenosylhomocysteinase 2 ELISA Kit

EF014144 96 Tests
EUR 689

Ahcyl2 ELISA Kit| Mouse Adenosylhomocysteinase 3 ELISA Kit

EF014145 96 Tests
EUR 689

AHCY ELISA Kit (Human) : 96 Wells (OKEH02255)

OKEH02255 96 Wells
EUR 662
Description: Description of target: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Mouse Putative adenosylhomocysteinase 3, Ahcyl2 ELISA KIT

ELI-20135m 96 Tests
EUR 865

Mouse Putative adenosylhomocysteinase 2, Ahcyl1 ELISA KIT

ELI-29740m 96 Tests
EUR 865

Mouse Adenosylhomocysteinase Like 1 (AHCYL1) ELISA Kit

abx556051-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Adenosylhomocysteinase Like 2 (AHCYL2) ELISA Kit

abx388520-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Adenosyl homocysteinase(AHCY) ELISA kit

E02A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenosyl homocysteinase(AHCY) ELISA kit

E02A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenosyl homocysteinase(AHCY) ELISA kit

E02A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosyl homocysteinase(AHCY) ELISA kit

E06A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosyl homocysteinase(AHCY) ELISA kit

E06A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenosyl homocysteinase(AHCY) ELISA kit

E06A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosyl homocysteinase(AHCY) ELISA kit

E03A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosyl homocysteinase(AHCY) ELISA kit

E03A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenosyl homocysteinase(AHCY) ELISA kit

E03A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenosyl homocysteinase(AHCY) ELISA kit

E04A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenosyl homocysteinase(AHCY) ELISA kit

E04A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenosyl homocysteinase(AHCY) ELISA kit

E04A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosyl homocysteinase(AHCY) ELISA kit

E07A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosyl homocysteinase(AHCY) ELISA kit

E07A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenosyl homocysteinase(AHCY) ELISA kit

E07A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosyl homocysteinase(AHCY) ELISA kit

E08A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosyl homocysteinase(AHCY) ELISA kit

E08A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenosyl homocysteinase(AHCY) ELISA kit

E08A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosyl homocysteinase(AHCY) ELISA kit

E09A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosyl homocysteinase(AHCY) ELISA kit

E09A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenosyl homocysteinase(AHCY) ELISA kit

E09A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AHCY antibody

70R-2721 50 ug
EUR 467
Description: Rabbit polyclonal AHCY antibody raised against the N terminal of AHCY

AHCY antibody

70R-15635 50 ul
EUR 435
Description: Rabbit polyclonal AHCY antibody

AHCY Antibody

32754-100ul 100ul
EUR 252

AHCY Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

AHCY Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AHCY Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHCY. Recognizes AHCY from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

AHCY Antibody

DF7260 200ul
EUR 304
Description: AHCY Antibody detects endogenous levels of total AHCY.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AHCY Antibody

ABD7260 100 ug
EUR 438

Active AHCY, human recombinant

EUR 262

Active AHCY, human recombinant

EUR 5482

Active AHCY, human recombinant

EUR 479

Human AHCY shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AHCY Recombinant Protein (Human)

RP000802 100 ug Ask for price

AHCY Recombinant Protein (Human)

RP036520 100 ug Ask for price

Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit

E05A1332-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit

E05A1332-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenosyl homocysteinase(AHCY) ELISA kit

E05A1332-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenosyl homocysteinase(AHCY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AHCY Inhibitor Screening Kit (Fluorometric)

EUR 1001

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Saccharomyces cerevisiae Adenosylhomocysteinase (SAH1)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Saccharomyces cerevisiae Adenosylhomocysteinase(SAH1) expressed in E.coli

SAHH/AHCY Antibody

EUR 316

SAHH/AHCY Antibody

EUR 146

AHCY Rabbit pAb

A14182-100ul 100 ul
EUR 308

AHCY Rabbit pAb

A14182-200ul 200 ul
EUR 459

AHCY Rabbit pAb

A14182-20ul 20 ul
EUR 183

AHCY Rabbit pAb

A14182-50ul 50 ul
EUR 223

AHCY Blocking Peptide

33R-8359 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AHCY antibody, catalog no. 70R-2721

AHCY Blocking Peptide

DF7260-BP 1mg
EUR 195

AHCY Enzyme (Recombinant)

  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

AHCY Conjugated Antibody

C32754 100ul
EUR 397

AHCY cloning plasmid

CSB-CL001474HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1299
  • Sequence: atgtctgacaaactgccctacaaagtcgccgacatcggcctggctgcctggggacgcaaggccctggacattgctgagaacgagatgccgggcctgatgcgtatgcgggagcggtactcggcctccaagccactgaagggcgcccgcatcgctggctgcctgcacatgaccgtgg
  • Show more
Description: A cloning plasmid for the AHCY gene.

AHCY cloning plasmid

CSB-CL001474HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 921
  • Show more
Description: A cloning plasmid for the AHCY gene.

AHCY Rabbit pAb

A5300-100ul 100 ul
EUR 308

AHCY Rabbit pAb

A5300-200ul 200 ul
EUR 459

AHCY Rabbit pAb

A5300-20ul 20 ul
EUR 183

AHCY Rabbit pAb

A5300-50ul 50 ul
EUR 223

AHCY Polyclonal Antibody

A54380 100 µg
EUR 570.55
Description: fast delivery possible

AHCY Polyclonal Antibody

A54894 100 µg
EUR 570.55
Description: reagents widely cited

anti- AHCY antibody

FNab00226 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: S-adenosylhomocysteine hydrolase
  • Uniprot ID: P23526
  • Gene ID: 191
  • Research Area: Metabolism
Description: Antibody raised against AHCY

anti- AHCY antibody

FNab00227 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: S-adenosylhomocysteine hydrolase
  • Uniprot ID: P23526
  • Gene ID: 191
  • Research Area: Metabolism
Description: Antibody raised against AHCY

Anti-AHCY antibody

PAab00226 100 ug
EUR 386

Anti-AHCY antibody

STJ27253 100 µl
EUR 277
Description: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-AHCY antibody

STJ116115 100 µl
EUR 277
Description: S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-AHCY (M2)

YF-MA20271 200 ul
EUR 363
Description: Mouse monoclonal to AHCY

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

AHCY ORF Vector (Human) (pORF)

ORF000268 1.0 ug DNA
EUR 95

AHCY ORF Vector (Human) (pORF)

ORF012174 1.0 ug DNA
EUR 354

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Adenosylhomocysteinase Like 1 (AHCYL1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosylhomocysteinase Like 1 (AHCYL1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosylhomocysteinase Like 2 (AHCYL2) Antibody

abx037789-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Adenosylhomocysteinase Like 1 (AHCYL1) Antibody

abx037861-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Adenosylhomocysteinase Like 1 (AHCYL1) Antibody

abx037862-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Human AHCY(Adenosylhomocysteinase) ELISA Kit