Human SYNC(Syncoilin) ELISA Kit

Human SYNC(Syncoilin) ELISA Kit

To Order Contact us below: 

    Human Syncoilin (SYNC) ELISA Kit
    RD-SYNC-Hu-96Tests 96 Tests
    EUR 723

    Human Syncoilin (SYNC) ELISA Kit
    RDR-SYNC-Hu-48Tests 48 Tests
    EUR 544

    Human Syncoilin (SYNC) ELISA Kit
    RDR-SYNC-Hu-96Tests 96 Tests
    EUR 756

    Human Syncoilin (SYNC) ELISA Kit
    20-abx153203
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Syncoilin, SYNC ELISA KIT
    ELI-53119h 96 Tests
    EUR 824

    Human Syncoilin(SYNC)ELISA Kit
    QY-E00204 96T
    EUR 361

    Human Syncoilin (SYNC) ELISA Kit
    SEF891Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

    Human Syncoilin (SYNC) ELISA Kit
    SEF891Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

    Human Syncoilin (SYNC) ELISA Kit
    SEF891Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

    Human Syncoilin (SYNC) ELISA Kit
    SEF891Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

    Human Syncoilin (SYNC) ELISA Kit
    4-SEF891Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Syncoilin elisa. Alternative names of the recognized antigen: Syncoilin-1
    • Intermediate Filament Protein
    • Syncoilin intermediate filament 1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syncoilin (SYNC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Syncoilin (SYNC) Antibody
    20-abx128347
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Syncoilin (SYNC) Antibody
    20-abx174693
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Syncoilin (SYNC) Antibody
    abx238433-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Syncoilin (SYNC) Antibody
    20-abx310668
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Recombinant Syncoilin (SYNC)
    4-RPF891Hu01
    • EUR 458.40
    • EUR 226.00
    • EUR 1444.00
    • EUR 548.00
    • EUR 996.00
    • EUR 370.00
    • EUR 3460.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9H7C4
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 64.6kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Syncoilin expressed in: E.coli

    Mouse Syncoilin, Sync ELISA KIT
    ELI-41064m 96 Tests
    EUR 865

    Human Syncoilin (SYNC) Protein
    20-abx166532
    • EUR 648.00
    • EUR 272.00
    • EUR 1943.00
    • EUR 759.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    ELISA kit for Human SYNC (Syncoilin)
    ELK3923 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syncoilin (SYNC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syncoilin (SYNC).
    • Show more
    Description: A sandwich ELISA kit for detection of Syncoilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Syncoilin (SYNC)
    KTE60412-48T 48T
    EUR 332
    • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Syncoilin (SYNC)
    KTE60412-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Syncoilin (SYNC)
    KTE60412-96T 96T
    EUR 539
    • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Human Syncoilin (SYNC) CLIA Kit
    20-abx495048
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Mouse Syncoilin (SYNC)
    KTE70284-48T 48T
    EUR 332
    • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Syncoilin (SYNC)
    KTE70284-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Syncoilin (SYNC)
    KTE70284-96T 96T
    EUR 539
    • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Syncoilin (SYNC) Antibody (HRP)
    20-abx310669
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Syncoilin (SYNC) Antibody (FITC)
    20-abx310670
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Syncoilin (SYNC) Antibody (Biotin)
    20-abx310671
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine)
    4-PAF891Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SYNC (Ile169~Pro458)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC)

    Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC
    4-PAF891Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SYNC (Ile169~Pro458)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC.

    Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Biotinylated
    4-PAF891Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SYNC (Ile169~Pro458)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Biotin.

    Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Cy3
    4-PAF891Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SYNC (Ile169~Pro458)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Cy3.

    Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), FITC
    4-PAF891Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SYNC (Ile169~Pro458)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with FITC.

    Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), HRP
    4-PAF891Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SYNC (Ile169~Pro458)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with HRP.

    Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), PE
    4-PAF891Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SYNC (Ile169~Pro458)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with PE.

    Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC-Cy7
    4-PAF891Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SYNC (Ile169~Pro458)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC-Cy7.

    SYNC ELISA KIT|Human
    EF003394 96 Tests
    EUR 689

    SYNC ELISA Kit (Human) (OKCD00987)
    OKCD00987 96 Wells
    EUR 831
    Description: Description of target: Atypical type III intermediate filament (IF) protein that may play a supportive role in the efficient coupling of mechanical stress between the myofibril and fiber exterior. May facilitate lateral force transmission during skeletal muscle contraction. Does not form homofilaments nor heterofilaments with other IF proteins.By similarity <p>Manually curated information which has been propagated from a related experimentally characterized protein.</p> <p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:Q9EPM5 (SYNCI_MOUSE) ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

    SYNC Antibody
    1-CSB-PA862034LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is Unconjugated. Tested in the following application: ELISA

    SYNC siRNA
    20-abx935788
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SYNC siRNA
    20-abx935789
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202

    Human SYNC shRNA Plasmid
    20-abx962976
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Sync Recombinant Protein (Human)
    RP043876 100 ug Ask for price

    SYNC cloning plasmid
    CSB-CL862034HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 456
    • Sequence: ATGGCAGAGAGCCGCCAGGACCTGGAGGAGGAGTATGAGCCTCAGTTCCTGCGGCTCCTAGAGAGGAAAGAAGCTGGGACCAAAGCTCTGCAGAGAACCCAGGCTGAGATCCAGGAAATGAAGGAGGCTCTGAGACCCCTGCAAGCAGAGGCCCGGCAGCTCCGCCTGCAAAACAG
    • Show more
    Description: A cloning plasmid for the SYNC gene.

    SYNC Polyclonal Antibody
    A67194 100 µg
    EUR 570.55
    Description: The best epigenetics products

    anti- SYNC antibody
    FNab08433 100µg
    EUR 548.75
    • Immunogen: syncoilin, intermediate filament protein
    • Uniprot ID: Q9H7C4
    • Research Area: Neuroscience
    Description: Antibody raised against SYNC

    Anti-SYNC antibody
    PAab08433 100 ug
    EUR 386

    SYNC ORF Vector (Human) (pORF)
    ORF014626 1.0 ug DNA
    EUR 354

    SYNC Antibody, HRP conjugated
    1-CSB-PA862034LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    SYNC Antibody, FITC conjugated
    1-CSB-PA862034LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    SYNC Antibody, Biotin conjugated
    1-CSB-PA862034LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Mouse SYNC shRNA Plasmid
    20-abx976752
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Sync Recombinant Protein (Rat)
    RP231893 100 ug Ask for price

    Sync Recombinant Protein (Mouse)
    RP176738 100 ug Ask for price

    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    SYNC sgRNA CRISPR Lentivector set (Human)
    K2320201 3 x 1.0 ug
    EUR 339

    Column Packing Kit
    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit
    M034-Kit Kit
    EUR 266

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    SYNC Polyclonal Antibody, HRP Conjugated
    A67195 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    SYNC Polyclonal Antibody, FITC Conjugated
    A67196 100 µg
    EUR 570.55
    Description: fast delivery possible

    SYNC Polyclonal Antibody, Biotin Conjugated
    A67197 100 µg
    EUR 570.55
    Description: reagents widely cited

    Sync ORF Vector (Rat) (pORF)
    ORF077299 1.0 ug DNA
    EUR 506

    Sync ORF Vector (Mouse) (pORF)
    ORF058914 1.0 ug DNA
    EUR 506

    SYNC sgRNA CRISPR Lentivector (Human) (Target 1)
    K2320202 1.0 ug DNA
    EUR 154

    SYNC sgRNA CRISPR Lentivector (Human) (Target 2)
    K2320203 1.0 ug DNA
    EUR 154

    SYNC sgRNA CRISPR Lentivector (Human) (Target 3)
    K2320204 1.0 ug DNA
    EUR 154

    Sync Protein Vector (Human) (pPB-C-His)
    PV058501 500 ng
    EUR 481

    Sync Protein Vector (Human) (pPB-N-His)
    PV058502 500 ng
    EUR 481

    Sync Protein Vector (Human) (pPM-C-HA)
    PV058503 500 ng
    EUR 481

    Sync Protein Vector (Human) (pPM-C-His)
    PV058504 500 ng
    EUR 481

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    Polyclonal SYNC antibody - N-terminal region
    AMM08057G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYNC - N-terminal region. This antibody is tested and proven to work in the following applications:

    Sync sgRNA CRISPR Lentivector set (Rat)
    K6600001 3 x 1.0 ug
    EUR 339

    Sync sgRNA CRISPR Lentivector set (Mouse)
    K4014401 3 x 1.0 ug
    EUR 339

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    vWF Acty. Kit
    ABP-ACT-KIT 12 x 8 microwells
    EUR 428

    vWF Ant. Kit
    ABP-TOT-KIT 12 x 8 microwells
    EUR 394

    Sync sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6600002 1.0 ug DNA
    EUR 154

    Sync sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6600003 1.0 ug DNA
    EUR 154

    Sync sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6600004 1.0 ug DNA
    EUR 154

    Sync sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4014402 1.0 ug DNA
    EUR 154

    Sync sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4014403 1.0 ug DNA
    EUR 154

    Sync sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4014404 1.0 ug DNA
    EUR 154

    Sync Protein Vector (Rat) (pPB-C-His)
    PV309194 500 ng
    EUR 603

    Sync Protein Vector (Rat) (pPB-N-His)
    PV309195 500 ng
    EUR 603

    Sync Protein Vector (Rat) (pPM-C-HA)
    PV309196 500 ng
    EUR 603

    Sync Protein Vector (Rat) (pPM-C-His)
    PV309197 500 ng
    EUR 603

    Sync Protein Vector (Mouse) (pPB-C-His)
    PV235654 500 ng
    EUR 603

    Sync Protein Vector (Mouse) (pPB-N-His)
    PV235655 500 ng
    EUR 603

    Sync Protein Vector (Mouse) (pPM-C-HA)
    PV235656 500 ng
    EUR 603

    Sync Protein Vector (Mouse) (pPM-C-His)
    PV235657 500 ng
    EUR 603

    Sync 3'UTR Luciferase Stable Cell Line
    TU120013 1.0 ml Ask for price

    Sync 3'UTR GFP Stable Cell Line
    TU170013 1.0 ml Ask for price

    Sync 3'UTR Luciferase Stable Cell Line
    TU221460 1.0 ml Ask for price

    SYNC 3'UTR GFP Stable Cell Line
    TU074997 1.0 ml
    EUR 1521

    Sync 3'UTR GFP Stable Cell Line
    TU271460 1.0 ml Ask for price

    SYNC 3'UTR Luciferase Stable Cell Line
    TU024997 1.0 ml
    EUR 1521

    hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
    CAS620A-KIT 1 kit
    EUR 2152
    • Category: Cas9
    Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PrecisionX Multiplex gRNA Cloning Kit
    CAS9-GRNA-KIT 10 rxn
    EUR 445
    • Category: Cas9

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)
    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
    K2320205 3 x 1.0 ug
    EUR 376

    SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
    K2320206 1.0 ug DNA
    EUR 167

    SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
    K2320207 1.0 ug DNA
    EUR 167

    SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
    K2320208 1.0 ug DNA
    EUR 167

    CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
    CASCL9-100A-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Sync sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
    K6600005 3 x 1.0 ug
    EUR 376

    Sync sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
    K4014405 3 x 1.0 ug
    EUR 376

    Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
    K6600006 1.0 ug DNA
    EUR 167

    Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
    K6600007 1.0 ug DNA
    EUR 167

    Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
    K6600008 1.0 ug DNA
    EUR 167

    Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
    K4014406 1.0 ug DNA
    EUR 167

    Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
    K4014407 1.0 ug DNA
    EUR 167

    Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
    K4014408 1.0 ug DNA
    EUR 167

    AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
    AP-STR-KIT-P 1/pk
    EUR 721
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Human Kit ELISA Kit
    ELA-E0121h 96 Tests
    EUR 824

    Human KIT/SCFR ELISA kit
    LF-EK50791 1×96T
    EUR 648

    KIT ELISA Kit (Human) (OKAN04574)
    OKAN04574 96 Wells
    EUR 792
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

    KIT ELISA Kit (Human) (OKCD06003)
    OKCD06003 96 Wells
    EUR 648
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

    Human Pentosidine ELISA Kit
    201-12-0005 96 tests
    EUR 440
    • This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Amylin ELISA Kit
    201-12-0017 96 tests
    EUR 440
    • This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human visfatin ELISA Kit
    201-12-0026 96 tests
    EUR 440
    • This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Secretin ELISA Kit
    201-12-0027 96 tests
    EUR 440
    • This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human omentin ELISA Kit
    201-12-0156 96 tests
    EUR 440
    • This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    human Resistin ELISA KIT
    201-12-0339 96 tests
    EUR 440
    • This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Collectin ELISA Kit
    201-12-0354 96 tests
    EUR 440
    • This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Agrin ELISA Kit
    201-12-0414 96 tests
    EUR 440
    • This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Thymosin ELISA Kit
    201-12-0416 96 tests
    EUR 440
    • This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human talin ELISA Kit
    201-12-0620 96 tests
    EUR 440
    • This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human ponticulin ELISA Kit
    201-12-0633 96 tests
    EUR 440
    • This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Slit2 ELISA Kit
    201-12-0662 96 tests
    EUR 440
    • This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human trypsin ELISA Kit
    201-12-0805 96 tests
    EUR 440
    • This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Elastase ELISA Kit
    201-12-0812 96 tests
    EUR 440
    • This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human ?-glucosidase ELISA Kit
    201-12-0854 96 tests
    EUR 440
    • This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human ?-lactamase ELISA Kit
    201-12-0856 96 tests
    EUR 440
    • This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Methylase ELISA Kit
    201-12-0927 96 tests
    EUR 440
    • This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Pancreastatin ELISA Kit
    201-12-0984 96 tests
    EUR 440
    • This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Cortisol ELISA Kit
    201-12-1004 96 tests
    EUR 440
    • This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Renin ELISA Kit
    201-12-1017 96 tests
    EUR 440
    • This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human podocin ELISA Kit
    201-12-1083 96 tests
    EUR 440
    • This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Nephrin ELISA Kit
    201-12-1092 96 tests
    EUR 440
    • This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human gelson ELISA Kit
    201-12-1204 96 tests
    EUR 440
    • This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Salusin ? ELISA Kit
    201-12-1269 96 tests
    EUR 440
    • This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Salusin-? ELISA Kit
    201-12-1273 96 tests
    EUR 440
    • This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human chemerin ELISA Kit
    201-12-1436 96 tests
    EUR 440
    • This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human dystrophin ELISA Kit
    201-12-1446 96 tests
    EUR 440
    • This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human preptin ELISA Kit
    201-12-1449 96 tests
    EUR 440
    • This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human p16 ELISA Kit
    201-12-1638 96 tests
    EUR 440
    • This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    human colicin ELISA Kit
    201-12-1747 96 tests
    EUR 440
    • This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Amebiasis ELISA Kit
    201-12-1748 96 tests
    EUR 440
    • This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    human schistosoma ELISA Kit
    201-12-1749 96 tests
    EUR 440
    • This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Enterovirus ELISA Kit
    201-12-1809 96 tests
    EUR 440
    • This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human flagellin ELISA Kit
    201-12-1815 96 tests
    EUR 440
    • This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Cotinine ELISA Kit
    201-12-2044 96 tests
    EUR 440
    • This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Myostatin ELISA Kit
    201-12-2092 96 tests
    EUR 440
    • This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Haponin ELISA Kit
    201-12-2740 96 tests
    EUR 440
    • This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human ANG ELISA Kit
    55R-1555 1 kit
    EUR 651
    Description: ELISA kit for detection of ANG in the research laboratory

    Human BDNF ELISA Kit
    55R-1556 1 kit
    EUR 428
    Description: ELISA kit for detection of BDNF in the research laboratory

    Human BMP5 ELISA Kit
    55R-1559 1 kit
    EUR 624
    Description: ELISA kit for detection of BMP-5 in the research laboratory

    Human BMP2 ELISA Kit
    55R-1560 1 kit
    EUR 624
    Description: ELISA kit for detection of BMP2 in the research laboratory

    Human BMP4 ELISA Kit
    55R-1563 1 kit
    EUR 651
    Description: ELISA Kit for detection of BMP4 in the research laboratory

    Human EGF ELISA Kit
    55R-1564 1 kit
    EUR 503
    Description: ELISA kit for detection of EGF in the research laboratory

    Human EGFR ELISA Kit
    55R-1566 1 kit
    EUR 503
    Description: ELISA kit for detection of EGFR in the research laboratory

    Human Eotaxin ELISA Kit
    55R-1567 1 kit
    EUR 530
    Description: ELISA kit for detection of Eotaxin in the research laboratory

    Human FAS ELISA Kit
    55R-1570 1 kit
    EUR 469
    Description: ELISA kit for detection of FAS in the research laboratory

    Human FASL ELISA Kit
    55R-1572 1 kit
    EUR 651
    Description: ELISA Kit for detection of FASL in the research laboratory

    Human FGF9 ELISA Kit
    55R-1573 1 kit
    EUR 671
    Description: ELISA kit for detection of FGF9 in the research laboratory

    Human Fibronectin ELISA kit
    55R-1574 1 kit
    EUR 368
    Description: ELISA kit for the detection of Fibronectin in the research laboratory

    Human CX3CL1 ELISA Kit
    55R-1577 1 kit
    EUR 617
    Description: ELISA Kit for detection of CX3CL1 in the research laboratory

    Human CX3CL1 ELISA Kit
    55R-1578 1 kit
    EUR 624
    Description: ELISA Kit for detection of CX3CL1 in the research laboratory

    Human GCSF ELISA kit
    55R-1579 1 kit
    EUR 415
    Description: ELISA kit for the detection of Human GCSF in the research laboratory

    Human GDNF ELISA Kit
    55R-1581 1 kit
    EUR 590
    Description: ELISA kit for detection of GDNF in the research laboratory

    Human GMCSF ELISA kit
    55R-1583 1 kit
    EUR 624
    Description: ELISA kit for the detection of GMCSF in the research laboratory

    Human HGF ELISA kit
    55R-1586 1 kit
    EUR 503
    Description: ELISA kit for the detection of Human HGF in the research laboratory

    Human ICAM1 ELISA Kit
    55R-1587 1 kit
    EUR 503
    Description: ELISA kit for detection of ICAM1 in the research laboratory

    Human IGFBP1 ELISA Kit
    55R-1598 1 kit
    EUR 550
    Description: ELISA kit for detection of IGFBP1 in the research laboratory

    Human IGFBP3 ELISA kit
    55R-1600 1 kit
    EUR 550
    Description: ELISA kit for the detection of IGFBP3 in the research laboratory

    Human IL2 ELISA kit
    55R-1608 1 kit
    EUR 496
    Description: ELISA kit for the detection of IL2 in the research laboratory

    Human IL3 ELISA Kit
    55R-1611 1 kit
    EUR 503
    Description: ELISA kit for detection of IL3 in the research laboratory

    Human IL4 ELISA Kit
    55R-1613 1 kit
    EUR 415
    Description: ELISA kit for detection of Human IL4 in the research laboratory

    Human IL5 ELISA kit
    55R-1616 1 kit
    EUR 530
    Description: ELISA kit for the detection of IL5 in the research laboratory

    Human IL6 ELISA Kit
    55R-1618 1 kit
    EUR 415
    Description: ELISA kit for detection of Human IL6 in the research laboratory

    Human IL8 ELISA Kit
    55R-1621 1 kit
    EUR 401
    Description: ELISA kit for detection of Human IL8 in the research laboratory

    Human IL10 ELISA Kit
    55R-1622 1 kit
    EUR 401
    Description: ELISA kit for detection of Human IL10 in the research laboratory

    Human IL15 ELISA Kit
    55R-1629 1 kit
    EUR 476
    Description: ELISA kit for detection of IL15 in the research laboratory

    Human IL17 ELISA Kit
    55R-1630 1 kit
    EUR 503
    Description: ELISA kit for detection of IL17 in the research laboratory

    Human Laminin ELISA Kit
    55R-1632 1 kit
    EUR 651
    Description: ELISA kit for detection of Laminin in the research laboratory

    Human Leptin ELISA kit
    55R-1635 1 kit
    EUR 476
    Description: ELISA kit for the detection of Human Leptin in the research laboratory

    Human MCP1 ELISA kit
    55R-1639 1 kit
    EUR 476
    Description: ELISA kit for the detection of MCP1 in the research laboratory

    Human MCSF ELISA Kit
    55R-1640 1 kit
    EUR 503
    Description: ELISA Kit for detection of MCSF in the research laboratory

    Human MDC ELISA Kit
    55R-1642 1 kit
    EUR 550
    Description: ELISA kit for detection of MDC in the research laboratory

    Human MMP1 ELISA Kit
    55R-1648 1 kit
    EUR 590
    Description: ELISA kit for detection of MMP1 in the research laboratory

    Human MMP2 ELISA Kit
    55R-1649 1 kit
    EUR 590
    Description: ELISA kit for detection of MMP2 in the research laboratory

    Human MMP3 ELISA Kit
    55R-1651 1 kit
    EUR 590
    Description: ELISA Kit for detection of MMP3 in the research laboratory

    Human MMP8 ELISA Kit
    55R-1654 1 kit
    EUR 671
    Description: ELISA kit for detection of MMP8 in the research laboratory

    Human MMP9 ELISA kit
    55R-1655 1 kit
    EUR 671
    Description: ELISA kit for the detection of MMP9 in the research laboratory

    Human MMP13 ELISA kit
    55R-1657 1 kit
    EUR 624
    Description: ELISA kit for the detection of MMP13 in the research laboratory

    Human NGFb ELISA Kit
    55R-1658 1 kit
    EUR 550
    Description: ELISA Kit for detection of NGFb in the research laboratory

    Human OPG ELISA kit
    55R-1664 1 kit
    EUR 503
    Description: ELISA kit for the detection of OPG in the research laboratory

    Human OPN ELISA Kit
    55R-1666 1 kit
    EUR 550
    Description: ELISA kit for detection of OPN in the research laboratory

    Human PDGFAB ELISA Kit
    55R-1668 1 kit
    EUR 476
    Description: ELISA Kit for detection of PDGFAB in the research laboratory

    Human Rantes ELISA Kit
    55R-1672 1 kit
    EUR 550
    Description: ELISA kit for detection of Rantes in the research laboratory

    Human TGFB1 ELISA Kit
    55R-1682 1 kit
    EUR 476
    Description: ELISA Kit for detection of TGFB1 in the research laboratory

    Human TIE2 ELISA Kit
    55R-1686 1 kit
    EUR 604
    Description: ELISA kit for detection of TIE2 in the research laboratory

    Human TIMP1 ELISA Kit
    55R-1687 1 kit
    EUR 550
    Description: ELISA kit for detection of TIMP1 in the research laboratory

    Human TIMP2 ELISA Kit
    55R-1688 1 kit
    EUR 590
    Description: ELISA kit for detection of TIMP2 in the research laboratory

    Human TIMP3 ELISA Kit
    55R-1689 1 kit
    EUR 624
    Description: ELISA kit for detection of TIMP3 in the research laboratory

    Human TNFR1 ELISA Kit
    55R-1693 1 kit
    EUR 624
    Description: ELISA Kit for detection of soluble TNFSR1 in the research laboratory

    Human TNFR2 ELISA Kit
    55R-1694 1 kit
    EUR 550
    Description: ELISA Kit for detection of TNFR2 in the research laboratory

    Human TRAIL ELISA kit
    55R-1695 1 kit
    EUR 624
    Description: ELISA kit for the detection of TRAIL in the research laboratory

    Human uPA ELISA Kit
    55R-1696 1 kit
    EUR 577
    Description: ELISA kit for detection of uPA in the research laboratory

    Human uPAR ELISA Kit
    55R-1697 1 kit
    EUR 577
    Description: ELISA kit for detection of uPAR in the research laboratory

    Human VCAM1 ELISA Kit
    55R-1698 1 kit
    EUR 476
    Description: ELISA kit for detection of VCAM1 in the research laboratory

    Human VEGF ELISA kit
    55R-1700 1 kit
    EUR 476
    Description: ELISA kit for the detection of Human VEGF in the research laboratory

    Human VEGFR1 ELISA kit
    55R-1703 1 kit
    EUR 577
    Description: ELISA kit for the detection of VEGFR1 in the research laboratory

    Human VEGFR2 ELISA Kit
    55R-1704 1 kit
    EUR 624
    Description: ELISA Kit for detection of VEGFR2 in the research laboratory

    Human ACE ELISA Kit
    55R-1705 1 kit
    EUR 698
    Description: ELISA kit for detection of ACE in the research laboratory

    Human CD40L ELISA Kit
    55R-1711 1 kit
    EUR 671
    Description: ELISA kit for detection of CD40 in the research laboratory

    Human EGVEGF ELISA Kit
    55R-1712 1 kit
    EUR 624
    Description: ELISA Kit for detection of EGVEGF in the research laboratory

    Human Resistin ELISA kit
    55R-1714 1 kit
    EUR 671
    Description: ELISA kit for the detection of Human Resistin in the research laboratory

    Human VEGFC ELISA kit
    55R-1718 1 kit
    EUR 671
    Description: ELISA kit for the detection of Human VEGFC in the research laboratory

    Human Adiponectin ELISA kit
    55R-1720 1 kit
    EUR 671
    Description: ELISA kit for the detection of Adiponectin in the research laboratory

    Human Survivin ELISA kit
    55R-1723 1 kit
    EUR 671
    Description: ELISA kit for the detection of Survivin in the research laboratory

    Human TSP2 ELISA Kit
    55R-1724 1 kit
    EUR 530
    Description: ELISA kit for detection of TSP2 in the research laboratory

    Human CD105 ELISA Kit
    55R-1725 1 kit
    EUR 624
    Description: ELISA kit for detection of CD105 in the research laboratory

    Human APP ELISA Kit
    55R-1726 1 kit
    EUR 651
    Description: ELISA kit for detection of APP in the research laboratory

    Human BAFF ELISA Kit
    55R-1727 1 kit
    EUR 624
    Description: ELISA kit for detection of BAFF in the research laboratory

    Human CCL17 ELISA Kit
    55R-1735 1 kit
    EUR 624
    Description: ELISA kit for detection of CCL17 in the research laboratory

    Human CD40 ELISA Kit
    55R-1736 1 kit
    EUR 651
    Description: ELISA kit for detection of CD40 in the research laboratory

    Human NCAM1 ELISA Kit
    55R-1738 1 kit
    EUR 651
    Description: ELISA Kit for detection of NCAM1 in the research laboratory

    Human SYNC(Syncoilin) ELISA Kit