Human EXT1(Exostoses 1) ELISA Kit

Human EXT1(Exostoses 1) ELISA Kit

To Order Contact us below: 

    Human Exostoses 1 (EXT1) ELISA Kit

    RDR-EXT1-Hu-48Tests 48 Tests
    EUR 544

    Human Exostoses 1 (EXT1) ELISA Kit

    RDR-EXT1-Hu-96Tests 96 Tests
    EUR 756

    Human Exostoses 1 (EXT1) ELISA Kit

    RD-EXT1-Hu-48Tests 48 Tests
    EUR 521

    Human Exostoses 1 (EXT1) ELISA Kit

    RD-EXT1-Hu-96Tests 96 Tests
    EUR 723

    Human Exostoses 1 (EXT1)ELISA Kit

    201-12-2693 96 tests
    EUR 440
    • This Exostoses 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Exostoses 1 (EXT1) ELISA Kit

    20-abx151458
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Exostoses 1 (EXT1) ELISA Kit

    abx252416-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human EXT1(Exostoses 1) ELISA Kit

    EH3023 96T
    EUR 524.1
    • Detection range: 0.781-50 ng/ml
    • Uniprot ID: Q16394
    • Alias: EXT1/LGCR/TRPS2/TTV/EC 2.4.1.224/EC 2.4.1.225/exostoses(multiple) 1/exostosin 1/exostosin-1/EXT/Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase/Glucurono
    • Show more
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

    Human Exostoses 1(EXT1)ELISA Kit

    QY-E01126 96T
    EUR 361

    Human Exostoses 1 ELISA Kit (EXT1)

    RK01332 96 Tests
    EUR 521

    Human Exostoses 1 (EXT1) ELISA Kit

    SEG239Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

    Human Exostoses 1 (EXT1) ELISA Kit

    SEG239Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

    Human Exostoses 1 (EXT1) ELISA Kit

    SEG239Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

    Human Exostoses 1 (EXT1) ELISA Kit

    SEG239Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

    Human Exostoses 1 (EXT1) ELISA Kit

    4-SEG239Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Exostoses 1 elisa. Alternative names of the recognized antigen: EXT
    • Ttv
    • LGCR, LGS
    • Langer-Giedion Syndrome Chromosome Region
    • Glucuronosyl-N-acetylglucosaminyl-Proteoglycan 4-Alpha-N-Acetylglucosaminyltransferase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exostoses 1 (EXT1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Monkey Exostoses 1 (EXT1) ELISA Kit

    abx359562-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Pig Exostoses 1 (EXT1) ELISA Kit

    abx361331-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Rabbit Exostoses 1 (EXT1) ELISA Kit

    abx362218-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Chicken Exostoses 1 (EXT1) ELISA Kit

    abx356158-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Exostoses 1 (EXT1) Antibody

    20-abx100786
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Exostoses 1 (EXT1) Antibody

    abx036070-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Exostoses 1 (EXT1) Antibody

    20-abx141663
    • EUR 370.00
    • EUR 606.00
    • EUR 300.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Exostoses 1 (EXT1) Antibody

    20-abx172309
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Recombinant Exostoses 1 (EXT1)

    4-RPG239Hu01
    • EUR 472.74
    • EUR 229.00
    • EUR 1497.76
    • EUR 565.92
    • EUR 1031.84
    • EUR 379.00
    • EUR 3594.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q16394
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 25.9kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Exostoses 1 expressed in: E.coli

    ELISA kit for Human EXT1 (Exostoses 1)

    E-EL-H1401 1 plate of 96 wells
    EUR 534
    • Gentaur's EXT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human EXT1. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human EXT1 (Exostoses 1) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Human EXT1 (Exostoses 1)

    ELK4143 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exostoses 1 (EXT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exostoses 1 (EX
    • Show more
    Description: A sandwich ELISA kit for detection of Exostoses 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Exostoses 1 (EXT1) CLIA Kit

    abx196641-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Exostoses 1 (EXT1) CLIA Kit

    20-abx495135
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Exostoses 1 (EXT1) Protein

    20-abx066473
    • EUR 662.00
    • EUR 272.00
    • EUR 2026.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Guinea pig Exostoses 1 (EXT1) ELISA Kit

    abx358022-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Exostoses 1 (EXT1) Antibody (Biotin)

    20-abx272389
    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Exostoses 1 (EXT1) polyclonal antibody

    ABP-PAB-10671 100 ug Ask for price
      • Product line: Genetic Disease Markers
      • Brand:

    Exostoses 1 (Ext1) polyclonal antibody

    ABP-PAB-10672 100 ug Ask for price
      • Product line: Genetic Disease Markers
      • Brand:

    CLIA kit for Human EXT1 (Exostoses 1)

    E-CL-H0906 1 plate of 96 wells
    EUR 584
    • Gentaur's EXT1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human EXT1 . Standards or samples are added to the micro CLIA plate wells and combined with the
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Human EXT1 (Exostoses 1) in samples from Serum, Plasma, Cell supernatant

    Exostoses 1 (EXT1) Polyclonal Antibody (Human)

    4-PAG239Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: EXT1 (Cys334~Arg549)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1)

    Exostoses 1 (EXT1) Polyclonal Antibody (Human), APC

    4-PAG239Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: EXT1 (Cys334~Arg549)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with APC.

    Exostoses 1 (EXT1) Polyclonal Antibody (Human), Biotinylated

    4-PAG239Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: EXT1 (Cys334~Arg549)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with Biotin.

    Exostoses 1 (EXT1) Polyclonal Antibody (Human), Cy3

    4-PAG239Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: EXT1 (Cys334~Arg549)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with Cy3.

    Exostoses 1 (EXT1) Polyclonal Antibody (Human), FITC

    4-PAG239Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: EXT1 (Cys334~Arg549)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with FITC.

    Exostoses 1 (EXT1) Polyclonal Antibody (Human), HRP

    4-PAG239Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: EXT1 (Cys334~Arg549)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with HRP.

    Exostoses 1 (EXT1) Polyclonal Antibody (Human), PE

    4-PAG239Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: EXT1 (Cys334~Arg549)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with PE.

    Exostoses 1 (EXT1) Polyclonal Antibody (Human), APC-Cy7

    4-PAG239Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: EXT1 (Cys334~Arg549)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with APC-Cy7.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    EXT1 ELISA KIT|Human

    EF006797 96 Tests
    EUR 689

    Human Exostosin- 1, EXT1 ELISA KIT

    ELI-47672h 96 Tests
    EUR 824

    EXT1 ELISA Kit (Human) (OKCD01905)

    OKCD01905 96 Wells
    EUR 831
    Description: Description of target: Glycosyltransferase required for the biosynthesis of heparan-sulfate. The EXT1/EXT2 complex possesses substantially higher glycosyltransferase activity than EXT1 or EXT2 alone. Appears to be a tumor suppressor. Required for the exosomal release of SDCBP, CD63 and syndecan.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.28 ng/mL

    Bovine Exostosin- 1, EXT1 ELISA KIT

    ELI-20574b 96 Tests
    EUR 928

    Mouse Exostosin 1 (EXT1) ELISA Kit

    abx389228-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Exostosin- 1, Ext1 ELISA KIT

    ELI-32744m 96 Tests
    EUR 865

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    DLR-EXTL1-Hu-48T 48T
    EUR 554
    • Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    DLR-EXTL1-Hu-96T 96T
    EUR 725
    • Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    20-abx151461
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Exostoses Like Protein 1(EXTL1)ELISA Kit

    QY-E01124 96T
    EUR 361

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    RDR-EXTL1-Hu-48Tests 48 Tests
    EUR 589

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    RDR-EXTL1-Hu-96Tests 96 Tests
    EUR 820

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    RD-EXTL1-Hu-48Tests 48 Tests
    EUR 563

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    RD-EXTL1-Hu-96Tests 96 Tests
    EUR 783

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    SEL477Hu-10x96wellstestplate 10x96-wells test plate
    EUR 5189.65
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    SEL477Hu-1x48wellstestplate 1x48-wells test plate
    EUR 515.03
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    SEL477Hu-1x96wellstestplate 1x96-wells test plate
    EUR 692.9
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    SEL477Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2818.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

    Human Exostoses Like Protein 1 (EXTL1) ELISA Kit

    4-SEL477Hu
    • EUR 5240.00
    • EUR 2769.00
    • EUR 693.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Exostoses Like Protein 1 elisa. Alternative names of the recognized antigen: EXTL
    • Exostosin-Like 1
    • Glucuronosyl-N-Acetylglucosaminyl-Proteoglycan 4-Alpha-N-Acetylglucosaminyltransferase
    • Exostosin-L
    • Multiple exostosis-like protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Exostoses 2 (EXT2)ELISA Kit

    201-12-2694 96 tests
    EUR 440
    • This Exostoses 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Exostoses 2(EXT2)ELISA Kit

    QY-E01125 96T
    EUR 361

    Ext1 ELISA Kit| Mouse Exostosin-1 ELISA Kit

    EF014858 96 Tests
    EUR 689

    EXT1 ELISA Kit| Bovine Exostosin-1 ELISA Kit

    EF011372 96 Tests
    EUR 689

    ELISA kit for Human EXTL1 (Exostoses Like Protein 1)

    ELK6285 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exostoses Like Protein 1 (EXTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to E
    • Show more
    Description: A sandwich ELISA kit for detection of Exostoses Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Exostosin 1 (EXT1) Antibody

    abx117178-100ug 100 ug
    EUR 467
    • Shipped within 5-10 working days.

    Exostosin 1 (EXT1) Antibody

    abx029097-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Exostosin 1 (EXT1) Antibody

    abx029097-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Exostosin 1 (EXT1) Antibody

    20-abx302428
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Exostosin 1 (EXT1) Antibody

    20-abx001647
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Human Exostoses Like Protein 1 (EXTL1) CLIA Kit

    20-abx495930
    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    EXT1 Antibody

    32560-100ul 100ul
    EUR 252

    EXT1 Antibody

    1-CSB-PA620959LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

    EXT1 Antibody

    DF6764 200ul
    EUR 304
    Description: EXT1 Antibody detects endogenous levels of total EXT1.

    EXT1 antibody

    70R-5709 50 ug
    EUR 467
    Description: Rabbit polyclonal EXT1 antibody

    EXT1 antibody

    70R-5710 50 ug
    EUR 467
    Description: Rabbit polyclonal EXT1 antibody

    EXT1 Antibody

    CSB-PA007899KA01HU-
    EUR 335
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

    EXT1 Antibody

    CSB-PA007899KA01HU-100ul 100ul
    EUR 389
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

    EXT1 siRNA

    20-abx915837
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    EXT1 siRNA

    20-abx915838
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    EXT1 Antibody

    ABD6764 100 ug
    EUR 438

    anti-Ext1

    YF-PA11639 100 ug
    EUR 403
    Description: Rabbit polyclonal to Ext1

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    Human Exostoses Like Protein 1 (EXTL1) Protein

    20-abx653329
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    Human EXT1 shRNA Plasmid

    20-abx951482
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    EXT1 Recombinant Protein (Human)

    RP011083 100 ug Ask for price

    Exostosin 1 (EXT1) Antibody (HRP)

    20-abx314500
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Exostosin 1 (EXT1) Antibody (FITC)

    20-abx314501
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Exostosin 1 (EXT1) Antibody (Biotin)

    20-abx314502
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    EXT1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0704602 1.0 ug DNA
    EUR 154

    Exostoses Like Protein 1 (EXTL1) Antibody

    20-abx176347
    • EUR 1316.00
    • EUR 620.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Exostoses Like Protein 1 (EXTL1) Antibody

    20-abx211615
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Exostoses Like Protein 1 (EXTL1) Antibody

    20-abx211616
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Exostoses Like Protein 1 (EXTL1) Antibody

    20-abx172310
    • EUR 926.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Exostoses (Multiple)-Like 1 (EXTL1) Antibody

    abx030322-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Exostoses (Multiple)-Like 1 (EXTL1) Antibody

    abx030322-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    EXT1 Blocking Peptide

    33R-3726 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXT1 antibody, catalog no. 70R-5710

    EXT1 Blocking Peptide

    33R-4777 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXT1 antibody, catalog no. 70R-5709

    EXT1 Blocking Peptide

    DF6764-BP 1mg
    EUR 195

    EXT1 Conjugated Antibody

    C32560 100ul
    EUR 397

    EXT1 cloning plasmid

    CSB-CL620959HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2241
    • Sequence: atgcaggccaaaaaacgctatttcatcctgctctcagctggctcttgtctcgcccttttgttttatttcggaggcttgcagtttagggcatcgaggagccacagccggagagaagaacacagcggtaggaatggcttgcaccaccccagtccggatcatttctggccccgcttcc
    • Show more
    Description: A cloning plasmid for the EXT1 gene.

    EXT1 Rabbit pAb

    A2030-100ul 100 ul
    EUR 308

    EXT1 Rabbit pAb

    A2030-200ul 200 ul
    EUR 459

    EXT1 Rabbit pAb

    A2030-20ul 20 ul
    EUR 183

    EXT1 Rabbit pAb

    A2030-50ul 50 ul
    EUR 223

    pENTR223-EXT1 vector

    PVT11765 2 ug
    EUR 304

    Anti-EXT1 antibody

    STJ23589 100 µl
    EUR 277
    Description: This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses.

    Anti-Ext1 (5A5)

    YF-MA12917 100 ug
    EUR 363
    Description: Mouse monoclonal to Ext1

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    EXT1 ORF Vector (Human) (pORF)

    ORF003695 1.0 ug DNA
    EUR 95

    AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    Human Hexokinase-1 AssayMax ELISA Kit

    EH3101-1 96 Well Plate
    EUR 477

    Human Complexin-1 AssayMax ELISA Kit

    EC3505-1 96 Well Plate
    EUR 417

    Human Glutaredoxin-1 AssayMax ELISA Kit

    EG2153-1 96 Well Plate
    EUR 417

    EXT1 Antibody, HRP conjugated

    1-CSB-PA620959LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    EXT1 Antibody, FITC conjugated

    1-CSB-PA620959LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    EXT1 Antibody, Biotin conjugated

    1-CSB-PA620959LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Polyclonal EXT1 Antibody (Center)

    AMM08624G 0.1ml
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXT1 (Center). This antibody is tested and proven to work in the following applications:

    Mouse EXT1 shRNA Plasmid

    20-abx970248
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    EXT1 Recombinant Protein (Rat)

    RP200135 100 ug Ask for price

    EXT1 Recombinant Protein (Mouse)

    RP132545 100 ug Ask for price

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Ext1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7597802 1.0 ug DNA
    EUR 154

    Ext1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4003902 1.0 ug DNA
    EUR 154

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    EXT1 sgRNA CRISPR Lentivector set (Human)

    K0704601 3 x 1.0 ug
    EUR 339

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

    EL3502-1 96 Well Plate
    EUR 477

    Human TGF-beta-1 AssayMax ELISA Kit

    ET3102-1 96 Well Plate
    EUR 477

    Human PAI-1/tPA AssayMax ELISA Kit

    EP1105-1 96 Well Plate
    EUR 417

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

    EK2802-1 96 Well Plate
    EUR 477

    Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

    EI2200-1 96 Well Plate
    EUR 477

    Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit

    EI2301-1 96 Well Plate
    EUR 477

    Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit

    EP1100-1 96 Well Plate
    EUR 417

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit

    EC5752-1 96 Well Plate
    EUR 477

    Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

    EA5001-1 96 Well Plate
    EUR 417

    Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

    EA5101-1 96 Well Plate
    EUR 417

    Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit

    EA5501-1 96 Well Plate
    EUR 417

    Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit

    EE2702-1 96 Well Plate
    EUR 477

    Human Glutathione Transferase zeta 1 AssayMax ELISA Kit

    EG2350-1 96 Well Plate
    EUR 477

    Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit

    EG3928-1 96 Well Plate
    EUR 477

    Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit

    EM5110-1 96 Well Plate
    EUR 396

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit

    EH5215-1 96 Well Plate
    EUR 417

    Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit

    EI1001-1 96 Well Plate
    EUR 477

    Human EXT1(Exostoses 1) ELISA Kit