Human EXT1(Exostoses 1) ELISA Kit

Human EXT1(Exostoses 1) ELISA Kit

To Order Contact us below: 

Human Exostoses 1 (EXT1) ELISA Kit
RD-EXT1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Exostoses 1 (EXT1) ELISA Kit
RD-EXT1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Exostoses 1 (EXT1) ELISA Kit
RDR-EXT1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Exostoses 1 (EXT1) ELISA Kit
RDR-EXT1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human EXT1(Exostoses 1) ELISA Kit
EH3023	FN Test	96T	EUR 524.1
Detection range: 0.781-50 ng/ml Uniprot ID: Q16394 Alias: EXT1/LGCR/TRPS2/TTV/EC 2.4.1.224/EC 2.4.1.225/exostoses(multiple) 1/exostosin 1/exostosin-1/EXT/Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase/Glucurono Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Exostoses 1 (EXT1) ELISA Kit
20-abx151458	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Exostoses 1 (EXT1) ELISA Kit
abx252416-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Exostoses 1 (EXT1)ELISA Kit
201-12-2693	SunredBio	96 tests	EUR 440
This Exostoses 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Exostoses 1 ELISA Kit (EXT1)
RK01332	Abclonal	96 Tests	EUR 521

Human Exostoses 1(EXT1)ELISA Kit
QY-E01126	Qayee Biotechnology	96T	EUR 361

Human Exostoses 1 (EXT1) ELISA Kit
SEG239Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

Human Exostoses 1 (EXT1) ELISA Kit
SEG239Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

Human Exostoses 1 (EXT1) ELISA Kit
SEG239Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

Human Exostoses 1 (EXT1) ELISA Kit
SEG239Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses 1 (EXT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses 1 (EXT1) in tissue homogenates, cell lysates and other biological fluids.

Human Exostoses 1 (EXT1) ELISA Kit
4-SEG239Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Exostoses 1 elisa. Alternative names of the recognized antigen: EXT Ttv LGCR, LGS Langer-Giedion Syndrome Chromosome Region Glucuronosyl-N-acetylglucosaminyl-Proteoglycan 4-Alpha-N-Acetylglucosaminyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exostoses 1 (EXT1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Pig Exostoses 1 (EXT1) ELISA Kit
abx361331-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Exostoses 1 (EXT1) ELISA Kit
abx362218-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Exostoses 1 (EXT1) ELISA Kit
abx356158-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Exostoses 1 (EXT1) ELISA Kit
abx359562-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Exostoses 1 (EXT1) Antibody
20-abx141663	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Exostoses 1 (EXT1) Antibody
abx036070-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Exostoses 1 (EXT1) Antibody
20-abx100786	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Exostoses 1 (EXT1) Antibody
20-abx172309	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Exostoses 1 (EXT1)
4-RPG239Hu01	Cloud-Clone	EUR 472.74 EUR 229.00 EUR 1497.76 EUR 565.92 EUR 1031.84 EUR 379.00 EUR 3594.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q16394 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Exostoses 1 expressed in: E.coli

ELISA kit for Human EXT1 (Exostoses 1)
ELK4143	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exostoses 1 (EXT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exostoses 1 (EX Show more
Description: A sandwich ELISA kit for detection of Exostoses 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human EXT1 (Exostoses 1)
E-EL-H1401	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's EXT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human EXT1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human EXT1 (Exostoses 1) in samples from Serum, Plasma, Cell supernatant

Human Exostoses 1 (EXT1) CLIA Kit
20-abx495135	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Exostoses 1 (EXT1) CLIA Kit
abx196641-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Exostoses 1 (EXT1) Protein
20-abx066473	Abbexa	EUR 662.00 EUR 272.00 EUR 2026.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Guinea pig Exostoses 1 (EXT1) ELISA Kit
abx358022-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Exostoses 1 (EXT1) polyclonal antibody
ABP-PAB-10671	Allele Biotech	100 ug	Ask for price
Product line: Genetic Disease Markers Brand:

Exostoses 1 (Ext1) polyclonal antibody
ABP-PAB-10672	Allele Biotech	100 ug	Ask for price
Product line: Genetic Disease Markers Brand:

Exostoses 1 (EXT1) Antibody (Biotin)
20-abx272389	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CLIA kit for Human EXT1 (Exostoses 1)
E-CL-H0906	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's EXT1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human EXT1 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human EXT1 (Exostoses 1) in samples from Serum, Plasma, Cell supernatant

Exostoses 1 (EXT1) Polyclonal Antibody (Human)
4-PAG239Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EXT1 (Cys334~Arg549) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1)

Exostoses 1 (EXT1) Polyclonal Antibody (Human), APC
4-PAG239Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EXT1 (Cys334~Arg549) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with APC.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), Biotinylated
4-PAG239Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EXT1 (Cys334~Arg549) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with Biotin.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), Cy3
4-PAG239Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EXT1 (Cys334~Arg549) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with Cy3.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), FITC
4-PAG239Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EXT1 (Cys334~Arg549) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with FITC.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), HRP
4-PAG239Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EXT1 (Cys334~Arg549) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with HRP.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), PE
4-PAG239Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EXT1 (Cys334~Arg549) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with PE.

Exostoses 1 (EXT1) Polyclonal Antibody (Human), APC-Cy7
4-PAG239Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EXT1 (Cys334~Arg549) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exostoses 1 (EXT1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

EXT1 ELISA KIT|Human
EF006797	Lifescience Market	96 Tests	EUR 689

Human Exostosin- 1, EXT1 ELISA KIT
ELI-47672h	Lifescience Market	96 Tests	EUR 824

Bovine Exostosin- 1, EXT1 ELISA KIT
ELI-20574b	Lifescience Market	96 Tests	EUR 928

Mouse Exostosin- 1, Ext1 ELISA KIT
ELI-32744m	Lifescience Market	96 Tests	EUR 865

Mouse Exostosin 1 (EXT1) ELISA Kit
abx389228-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
20-abx151461	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
DLR-EXTL1-Hu-48T	DL Develop	48T	EUR 554
Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
DLR-EXTL1-Hu-96T	DL Develop	96T	EUR 725
Should the Human Exostoses Like Protein 1 (EXTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
RD-EXTL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
RD-EXTL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
RDR-EXTL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
RDR-EXTL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Exostoses Like Protein 1(EXTL1)ELISA Kit
QY-E01124	Qayee Biotechnology	96T	EUR 361

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
SEL477Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
SEL477Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
SEL477Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
SEL477Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exostoses Like Protein 1 (EXTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exostoses Like Protein 1 (EXTL1) in Tissue homogenates and other biological fluids.

Human Exostoses Like Protein 1 (EXTL1) ELISA Kit
4-SEL477Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Exostoses Like Protein 1 elisa. Alternative names of the recognized antigen: EXTL Exostosin-Like 1 Glucuronosyl-N-Acetylglucosaminyl-Proteoglycan 4-Alpha-N-Acetylglucosaminyltransferase Exostosin-L Multiple exostosis-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exostoses Like Protein 1 (EXTL1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Exostoses 2 (EXT2)ELISA Kit
201-12-2694	SunredBio	96 tests	EUR 440
This Exostoses 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Exostoses 2(EXT2)ELISA Kit
QY-E01125	Qayee Biotechnology	96T	EUR 361

Ext1 ELISA Kit| Mouse Exostosin-1 ELISA Kit
EF014858	Lifescience Market	96 Tests	EUR 689

EXT1 ELISA Kit| Bovine Exostosin-1 ELISA Kit
EF011372	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human EXTL1 (Exostoses Like Protein 1)
ELK6285	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exostoses Like Protein 1 (EXTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to E Show more
Description: A sandwich ELISA kit for detection of Exostoses Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Exostosin 1 (EXT1) Antibody
abx117178-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody
20-abx001647	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody
abx029097-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody
abx029097-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody
20-abx302428	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Exostoses Like Protein 1 (EXTL1) CLIA Kit
20-abx495930	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

EXT1 siRNA
20-abx915837	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXT1 siRNA
20-abx915838	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXT1 antibody
70R-5709	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal EXT1 antibody

EXT1 antibody
70R-5710	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal EXT1 antibody

EXT1 Antibody
ABD6764	Lifescience Market	100 ug	EUR 438

EXT1 Antibody
32560-100ul	SAB	100ul	EUR 252

EXT1 Antibody
DF6764	Affbiotech	200ul	EUR 304
Description: EXT1 Antibody detects endogenous levels of total EXT1.

EXT1 Antibody
CSB-PA007899KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

EXT1 Antibody
CSB-PA007899KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

EXT1 Antibody
1-CSB-PA620959LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

anti-Ext1
YF-PA11639	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Ext1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Exostoses Like Protein 1 (EXTL1) Protein
20-abx653329	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human EXT1 shRNA Plasmid
20-abx951482	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EXT1 Recombinant Protein (Human)
RP011083	ABM	100 ug	Ask for price

Exostosin 1 (EXT1) Antibody (HRP)
20-abx314500	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody (FITC)
20-abx314501	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exostosin 1 (EXT1) Antibody (Biotin)
20-abx314502	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EXT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0704602	ABM	1.0 ug DNA	EUR 154

Exostoses (Multiple)-Like 1 (EXTL1) Antibody
abx030322-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Exostoses (Multiple)-Like 1 (EXTL1) Antibody
abx030322-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Exostoses Like Protein 1 (EXTL1) Antibody
20-abx172310	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Exostoses Like Protein 1 (EXTL1) Antibody
20-abx176347	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Exostoses Like Protein 1 (EXTL1) Antibody
20-abx211615	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Exostoses Like Protein 1 (EXTL1) Antibody
20-abx211616	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

EXT1 Conjugated Antibody
C32560	SAB	100ul	EUR 397

EXT1 Rabbit pAb
A2030-100ul	Abclonal	100 ul	EUR 308

EXT1 Rabbit pAb
A2030-200ul	Abclonal	200 ul	EUR 459

EXT1 Rabbit pAb
A2030-20ul	Abclonal	20 ul	EUR 183

EXT1 Rabbit pAb
A2030-50ul	Abclonal	50 ul	EUR 223

EXT1 Blocking Peptide
33R-3726	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXT1 antibody, catalog no. 70R-5710

EXT1 Blocking Peptide
33R-4777	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXT1 antibody, catalog no. 70R-5709

EXT1 Blocking Peptide
DF6764-BP	Affbiotech	1mg	EUR 195

EXT1 cloning plasmid
CSB-CL620959HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2241 Sequence: atgcaggccaaaaaacgctatttcatcctgctctcagctggctcttgtctcgcccttttgttttatttcggaggcttgcagtttagggcatcgaggagccacagccggagagaagaacacagcggtaggaatggcttgcaccaccccagtccggatcatttctggccccgcttcc Show more
Description: A cloning plasmid for the EXT1 gene.

pENTR223-EXT1 vector
PVT11765	Lifescience Market	2 ug	EUR 304

Anti-EXT1 antibody
STJ23589	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses.

Anti-Ext1 (5A5)
YF-MA12917	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Ext1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

EXT1 ORF Vector (Human) (pORF)
ORF003695	ABM	1.0 ug DNA	EUR 95

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Polyclonal EXT1 Antibody (Center)
AMM08624G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXT1 (Center). This antibody is tested and proven to work in the following applications:

Mouse EXT1 shRNA Plasmid
20-abx970248	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EXT1 Antibody, HRP conjugated
1-CSB-PA620959LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EXT1 Antibody, FITC conjugated
1-CSB-PA620959LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EXT1 Antibody, Biotin conjugated
1-CSB-PA620959LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXT1. Recognizes EXT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EXT1 Recombinant Protein (Rat)
RP200135	ABM	100 ug	Ask for price

EXT1 Recombinant Protein (Mouse)
RP132545	ABM	100 ug	Ask for price

Ext1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4003902	ABM	1.0 ug DNA	EUR 154

Ext1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7597802	ABM	1.0 ug DNA	EUR 154

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

EXT1 sgRNA CRISPR Lentivector set (Human)
K0704601	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit
EL3502-1	AssayPro	96 Well Plate	EUR 477

Human TGF-beta-1 AssayMax ELISA Kit
ET3102-1	AssayPro	96 Well Plate	EUR 477

Human PAI-1/tPA AssayMax ELISA Kit
EP1105-1	AssayPro	96 Well Plate	EUR 417

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EI2200-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit
EI2301-1	AssayPro	96 Well Plate	EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit
EP1100-1	AssayPro	96 Well Plate	EUR 417

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Human Glutathione Transferase zeta 1 AssayMax ELISA Kit
EG2350-1	AssayPro	96 Well Plate	EUR 477

Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit
EG3928-1	AssayPro	96 Well Plate	EUR 477

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit
EC5752-1	AssayPro	96 Well Plate	EUR 477

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5001-1	AssayPro	96 Well Plate	EUR 417

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5101-1	AssayPro	96 Well Plate	EUR 417

Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit
EA5501-1	AssayPro	96 Well Plate	EUR 417

Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit
EE2702-1	AssayPro	96 Well Plate	EUR 477

Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit
EM5110-1	AssayPro	96 Well Plate	EUR 396

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1	AssayPro	96 Well Plate	EUR 477

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1	AssayPro	96 Well Plate	EUR 417

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Ext1 ORF Vector (Rat) (pORF)
ORF066713	ABM	1.0 ug DNA	EUR 506

Human EXT1(Exostoses 1) ELISA Kit