Human PTMa(Prothymosin Alpha) ELISA Kit

Human PTMa(Prothymosin Alpha) ELISA Kit

To Order Contact us below: 

    Human Prothymosin Alpha (PTMa) ELISA Kit
    RDR-PTMa-Hu-96Tests 96 Tests
    EUR 756
    Human Prothymosin Alpha (PTMa) ELISA Kit
    RD-PTMa-Hu-48Tests 48 Tests
    EUR 521
    Human Prothymosin Alpha (PTMa) ELISA Kit
    RD-PTMa-Hu-96Tests 96 Tests
    EUR 723
    Human Prothymosin alpha (PTMA)
    1-CSB-YP019000HU
    • EUR 430.00
    • EUR 234.00
    • EUR 1508.00
    • EUR 642.00
    • EUR 1009.00
    • EUR 291.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.2 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast
    Human Prothymosin alpha (PTMA)
    1-CSB-YP019000HUb0
    • EUR 430.00
    • EUR 234.00
    • EUR 1508.00
    • EUR 642.00
    • EUR 1009.00
    • EUR 291.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.7 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast
    Human Prothymosin Alpha (PTMa)ELISA kit
    201-12-2264 96 tests
    EUR 440
    • This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Prothymosin alpha (PTMa) ELISA Kit
    20-abx152865
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Prothymosin alpha (PTMA) ELISA Kit
    abx251157-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.
    Human PTMA/ Prothymosin alpha ELISA Kit
    E2090Hu 1 Kit
    EUR 571
    Human PTMA(Prothymosin alpha) ELISA Kit
    EH1845 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P06454
    • Alias: PTMA/Prothymosin alpha/TMSA
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    Human Prothymosin alpha, PTMA ELISA KIT
    ELI-05264h 96 Tests
    EUR 824
    Human Prothymosin alpha (PTMA) ELISA Kit
    abx517923-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Prothymosin Alpha(PTMa)ELISA Kit
    QY-E01901 96T
    EUR 361
    Human Prothymosin Alpha (PTMa) ELISA Kit
    SED221Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.
    Human Prothymosin Alpha (PTMa) ELISA Kit
    SED221Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.
    Human Prothymosin Alpha (PTMa) ELISA Kit
    SED221Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.
    Human Prothymosin Alpha (PTMa) ELISA Kit
    SED221Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.
    Human Prothymosin Alpha (PTMa) ELISA Kit
    4-SED221Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Prothymosin Alpha elisa. Alternative names of the recognized antigen: TMSA
    • PTM-A
    • Pro-Thymosin A
    • Gene Sequence 28
    • Thymosin alpha-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prothymosin Alpha (PTMa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Rat Prothymosin alpha (Ptma)
    1-CSB-YP019000RA
    • EUR 504.00
    • EUR 265.00
    • EUR 1832.00
    • EUR 763.00
    • EUR 1216.00
    • EUR 334.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.3 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast
    Prothymosin Alpha (PTMA) Antibody
    abx026432-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Prothymosin Alpha (PTMA) Antibody
    abx026432-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Prothymosin Alpha (PTMA) Antibody
    20-abx110156
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Prothymosin Alpha (PTMA) Antibody
    20-abx121680
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Prothymosin Alpha (PTMa) Antibody
    20-abx128206
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Prothymosin Alpha (PTMa) Antibody
    20-abx174300
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Prothymosin Alpha (PTMA) Antibody
    20-abx241156
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Prothymosin Alpha (PTMA) Antibody
    20-abx241411
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Prothymosin Alpha (PTMA) Antibody
    20-abx241412
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Prothymosin Alpha (PTMA) Antibody
    abx236808-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.
    Prothymosin Alpha (PTMA) Antibody
    abx431948-200ul 200 ul
    EUR 286
    • Shipped within 1-3 working days.
    Prothymosin Alpha (PTMA) Protein
    20-abx262698
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    Recombinant Prothymosin Alpha (PTMa)
    4-RPD221Hu01
    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P06454
    • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 42.1kDa
    • Isoelectric Point: 3.7
    Description: Recombinant Human Prothymosin Alpha expressed in: E.coli
    Recombinant Prothymosin Alpha (PTMa)
    4-RPD221Ra01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Inquire
    • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 42.2kDa
    • Isoelectric Point: 3.7
    Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli
    Mouse Ptma/ Prothymosin alpha ELISA Kit
    E1227Mo 1 Kit
    EUR 571
    Bovine Prothymosin alpha, PTMA ELISA KIT
    ELI-05262b 96 Tests
    EUR 928
    Mouse Prothymosin alpha, Ptma ELISA KIT
    ELI-05263m 96 Tests
    EUR 865
    Cow Prothymosin alpha (PTMA) ELISA Kit
    abx517922-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Prothymosin alpha (PTMA) ELISA Kit
    abx517924-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Rat Prothymosin alpha (PTMA) ELISA Kit
    abx517925-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Mouse Prothymosin Alpha(PTMa)ELISA kit
    GA-E0811MS-48T 48T
    EUR 336
    Mouse Prothymosin Alpha(PTMa)ELISA kit
    GA-E0811MS-96T 96T
    EUR 534
    Rat Prothymosin Alpha(PTMa)ELISA kit
    QY-E10505 96T
    EUR 361
    Mouse Prothymosin Alpha(PTMa)ELISA kit
    QY-E21293 96T
    EUR 361
    Human Prothymosin Alpha (PTMA) Protein
    abx060044-100ug 100 ug
    EUR 328
    • Shipped within 5-10 working days.
    Human Prothymosin Alpha (PTMa) Protein
    20-abx166598
    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Prothymosin alpha (PTMa) CLIA Kit
    20-abx494145
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human PTMa (Prothymosin Alpha)
    ELK3885 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prothymosin Alpha (PTM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prothymos
    • Show more
    Description: A sandwich ELISA kit for detection of Prothymosin Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Prothymosin, alpha (PTMA)
    KTE61059-48T 48T
    EUR 354
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Prothymosin, alpha (PTMA)
    KTE61059-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Prothymosin, alpha (PTMA)
    KTE61059-96T 96T
    EUR 572
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Canine Prothymosin, alpha (PTMA)
    KTE20099-48T 48T
    EUR 354
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Canine Prothymosin, alpha (PTMA)
    KTE20099-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Canine Prothymosin, alpha (PTMA)
    KTE20099-96T 96T
    EUR 572
    • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Rat Prothymosin Alpha (PTMa) Protein
    20-abx654881
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human)
    4-PAD221Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa)
    PTMA Prothymosin Alpha Human Recombinant Protein
    PROTP06454-1 Regular: 10ug
    EUR 317
    Description: PTMA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.5 kDa.;PTMA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC
    4-PAD221Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC.
    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated
    4-PAD221Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin.
    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3
    4-PAD221Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3.
    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC
    4-PAD221Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC.
    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP
    4-PAD221Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP.
    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE
    4-PAD221Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE.
    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7
    4-PAD221Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7.
    ELISA kit for Human Prothymosin alpha
    EK3812 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Prothymosin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.
    Prothymosin, alpha Antibody
    20-abx114891
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Ptma/ Rat Ptma ELISA Kit
    ELI-05265r 96 Tests
    EUR 657
    Prothymosin alpha Polyclonal Antibody
    42262-100ul 100ul
    EUR 333
    Prothymosin alpha Antibody (Biotin)
    20-abx105848
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Prothymosin alpha Antibody (FITC)
    20-abx107264
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Prothymosin alpha Antibody (HRP)
    20-abx108684
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Prothymosin alpha Blocking Peptide
    20-abx161390
    • EUR 606.00
    • EUR 1428.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    anti- Prothymosin alpha antibody
    FNab06808 100µg
    EUR 585
    • Immunogen: prothymosin, alpha
    • Uniprot ID: P06454
    • Research Area: Cancer, Metabolism
    Description: Antibody raised against Prothymosin alpha
    Anti-Prothymosin alpha antibody
    PAab06808 100 ug
    EUR 412
    Human PTMA ELISA Kit
    ELA-E1609h 96 Tests
    EUR 824
    PTMA ELISA KIT|Human
    EF005969 96 Tests
    EUR 689
    Prothymosin alpha Polyclonal Conjugated Antibody
    C42262 100ul
    EUR 397
    PTMA ELISA Kit (Human) (OKCD08419)
    OKCD08419 96 Wells
    EUR 975
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL
    PTMA ELISA Kit (Human) (OKEH01154)
    OKEH01154 96 Wells
    EUR 662
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.039 ng/mL
    PTMA
    E541-447 100ug
    EUR 343
    PTMA ELISA Kit (Rat) (OKEH06132)
    OKEH06132 96 Wells
    EUR 662
    Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL
    PTMA ELISA Kit (Mouse) (OKEH04264)
    OKEH04264 96 Wells
    EUR 662
    Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL
    PTMA antibody
    70R-19633 50 ul
    EUR 435
    Description: Rabbit polyclonal PTMA antibody
    PTMA Antibody
    37277-100ul 100ul
    EUR 252
    PTMA Antibody
    1-CSB-PA721303
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
    PTMA Antibody
    1-CSB-PA799716
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
    PTMA Antibody
    1-CSB-PA272943
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
    PTMA Antibody
    1-CSB-PA01524A0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    PTMA Antibody
    1-CSB-PA019000GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
    PTMA siRNA
    20-abx904361
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PTMA siRNA
    20-abx930331
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PTMA siRNA
    20-abx930332
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PTMS Prothymosin Human Recombinant Protein
    PROTP20962 Regular: 10ug
    EUR 317
    Description: PTMS Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 125 amino acids (1-102aa) and having a molecular mass of 13.9kDa.
    Human PTMA shRNA Plasmid
    20-abx953893
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    PTMA Recombinant Protein (Human)
    RP025144 100 ug Ask for price
    PTMA Recombinant Protein (Human)
    RP025147 100 ug Ask for price
    Human TNF-alpha ELISA Kit, 96 tests, Quantitative
    100-215-TNH 1 kit
    EUR 482
    PTMA Conjugated Antibody
    C37277 100ul
    EUR 397
    PTMA cloning plasmid
    CSB-CL019000HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 333
    • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
    • Show more
    Description: A cloning plasmid for the PTMA gene.
    PTMA cloning plasmid
    CSB-CL019000HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 333
    • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
    • Show more
    Description: A cloning plasmid for the PTMA gene.
    Monoclonal PTMA Antibody
    AMM01760G 0.05mg
    EUR 484
    Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP
    PTMA Polyclonal Antibody
    A52464 100 µg
    EUR 570.55
    Description: The best epigenetics products
    PTMA Rabbit pAb
    A1956-100ul 100 ul
    EUR 308
    PTMA Rabbit pAb
    A1956-200ul 200 ul
    EUR 459
    PTMA Rabbit pAb
    A1956-20ul 20 ul
    EUR 183
    PTMA Rabbit pAb
    A1956-50ul 50 ul
    EUR 223
    PTMA Polyclonal Antibody
    ABP60026-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein
    PTMA Polyclonal Antibody
    ABP60026-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein
    PTMA Polyclonal Antibody
    ABP60026-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein
    PTMA Polyclonal Antibody
    ES11817-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    PTMA Polyclonal Antibody
    ES11817-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    Anti-PTMA antibody
    STJ11100717 100 µl
    EUR 277
    Anti-PTMA antibody
    STJ192975 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PTMA
    Anti-PTMA antibody
    STJ71788 100 µg
    EUR 359
    PTMA ORF Vector (Human) (pORF)
    ORF008382 1.0 ug DNA
    EUR 95
    PTMA ORF Vector (Human) (pORF)
    ORF008383 1.0 ug DNA
    EUR 95
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
    Human Alpha Fetoprotein (AFP) ELISA Kit, 96 tests, Quantitative
    500 1 kit
    EUR 469
    Column Packing Kit
    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
    PCR Mycoplasma Detection Kit
    M034-Kit Kit
    EUR 266
    Mouse alpha 2-Macroglobulin (A2M) ELISA kit
    600-720-A2M 1 Kit
    EUR 773
    Human Anti-Alpha Fodrin IgG ELISA kit, 96 tests, Quantitative
    3300-160-AFG 1 kit
    EUR 590
    Human hypoxia-inducible transcription factor 1 alpha (HIF-1 alpha) ELISA Kit, 96 tests, Quantitative
    100-530-HIF 1 Kit
    EUR 712
    PTMA Antibody, HRP conjugated
    1-CSB-PA01524B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    PTMA Antibody, FITC conjugated
    1-CSB-PA01524C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    PTMA Antibody, Biotin conjugated
    1-CSB-PA01524D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    PTMA protein (His tag)
    80R-3024 50 ug
    EUR 413
    Description: Purified recombinant PTMA protein (His tag)
    Mouse PTMA shRNA Plasmid
    20-abx972279
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Rat PTMA shRNA Plasmid
    20-abx985361
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    PTMA Recombinant Protein (Mouse)
    RP165578 100 ug Ask for price
    PTMA Recombinant Protein (Rat)
    RP222875 100 ug Ask for price
    PTMA sgRNA CRISPR Lentivector set (Human)
    K1752701 3 x 1.0 ug
    EUR 339
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    Recombinant (E.Coli) Human p38 alpha/SAPK2 alpha
    RP-675 1 ug
    EUR 286
    Mouse TNF-alpha ELISA Kit, 96 tests, Quantitative
    100-210-TNF 1 kit
    EUR 482
    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Human 17 alpha Hydroxyprogesterone (17-OHP/17OHP) ELISA Kit, 96 tests, Quantitative
    1870 1 kit
    EUR 529
    Human Zeta (z) Globin (alpha thalassemia ) ELISA Kit, 96 tests, Semi-Quantitative
    1970 1 kit
    EUR 651
    Human Fodrin-alpha (spectrin-alpha) control/blocking peptide
    FOD11-P 100 ug
    EUR 164
    Rabbit Anti-Human Fodrin-alpha (spectrin-alpha) antiserum
    FOD11-S 100 ul
    EUR 457
    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9
    Recombinant Human Alpha-Synuclein
    RP-847 20 ug
    EUR 164
    Chicken Interferon alpha (IFN-?) ELISA Kit, 96 tests, Quantitative
    10680 1 Kit
    EUR 773
    Monkey Interferon-alpha (IFN-?) ELISA Kit, 96 tests, Quantitative
    9745 1 Kit
    EUR 773
    Pig Alpha Fetoprotein (?FP) ELISA Kit, 96 tests, Quantitative
    9930 1 Kit
    EUR 773
    Pig Interferon alpha (IFN-?) ELISA Kit, 96 tests, Quantitative
    9945 1 Kit
    EUR 773
    Mouse IL-1 alpha ELISA Kit, 96 tests, Quantitative
    MIL-01A-145 1 kit
    EUR 482
    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PTMA sgRNA CRISPR Lentivector (Human) (Target 1)
    K1752702 1.0 ug DNA
    EUR 154
    PTMA sgRNA CRISPR Lentivector (Human) (Target 2)
    K1752703 1.0 ug DNA
    EUR 154
    PTMA sgRNA CRISPR Lentivector (Human) (Target 3)
    K1752704 1.0 ug DNA
    EUR 154
    PTMA Protein Vector (Human) (pPB-C-His)
    PV033525 500 ng
    EUR 329
    PTMA Protein Vector (Human) (pPB-N-His)
    PV033526 500 ng
    EUR 329
    PTMA Protein Vector (Human) (pPM-C-HA)
    PV033527 500 ng
    EUR 329
    PTMA Protein Vector (Human) (pPM-C-His)
    PV033528 500 ng
    EUR 329
    PTMA Protein Vector (Human) (pPB-C-His)
    PV033529 500 ng
    EUR 329
    PTMA Protein Vector (Human) (pPB-N-His)
    PV033530 500 ng
    EUR 329
    PTMA Protein Vector (Human) (pPM-C-HA)
    PV033531 500 ng
    EUR 329
    PTMA Protein Vector (Human) (pPM-C-His)
    PV033532 500 ng
    EUR 329
    Recombinant Human PTMA Protein, His, E.coli-10ug
    QP13206-10ug 10ug
    EUR 201
    Recombinant Human PTMA Protein, His, E.coli-1mg
    QP13206-1mg 1mg
    EUR 5251
    Recombinant Human PTMA Protein, His, E.coli-2ug
    QP13206-2ug 2ug
    EUR 155
    Polyclonal PTMA Antibody (N-term)
    APR03615G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications:
    Polyclonal PTMA Antibody (C-Term)
    APG00574G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications:
    Polyclonal PTMA Antibody (C-Terminus)
    APG01175G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications:
    PTMA Polyclonal Antibody, Biotin Conjugated
    A52461 100 µg
    EUR 570.55
    Description: Ask the seller for details
    PTMA Polyclonal Antibody, FITC Conjugated
    A52462 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Human PTMa(Prothymosin Alpha) ELISA Kit