Human CORT(Cortistatin) ELISA Kit

Human CORT(Cortistatin) ELISA Kit

To Order Contact us below: 

Human Cortistatin (CORT) ELISA Kit
RDR-CORT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Cortistatin (CORT) ELISA Kit
RD-CORT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Cortistatin (CORT) ELISA Kit
RD-CORT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Cortistatin (CORT) ELISA Kit
CEC393Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.

Human Cortistatin (CORT) ELISA Kit
CEC393Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.

Human Cortistatin (CORT) ELISA Kit
CEC393Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.

Human Cortistatin (CORT) ELISA Kit
CEC393Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.

Human Cortistatin (CORT) ELISA Kit
4-CEC393Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Cortistatin elisa. Alternative names of the recognized antigen: CST14 CST17 CST29
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Cortistatin (CORT) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human cortistatin(CORT) ELISA kit
E01C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cortistatin(CORT) ELISA kit
E01C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cortistatin(CORT) ELISA kit
E01C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cortistatin, CORT ELISA KIT
ELI-26185h	Lifescience Market	96 Tests	EUR 824

Human Cortistatin (CORT) ELISA Kit
20-abx151159	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human cortistatin (CORT) ELISA kit
CSB-EL005821HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cortistatin (CORT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human cortistatin (CORT) ELISA kit
1-CSB-EL005821HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cortistatin (CORT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Cortistatin ELISA Kit (CORT)
RK01167	Abclonal	96 Tests	EUR 521

Human Cortistatin(CORT)ELISA Kit
QY-E01991	Qayee Biotechnology	96T	EUR 361

Goat cortistatin(CORT) ELISA kit
E06C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cortistatin(CORT) ELISA kit
E06C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cortistatin(CORT) ELISA kit
E06C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cortistatin(CORT) ELISA kit
E02C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cortistatin(CORT) ELISA kit
E02C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cortistatin(CORT) ELISA kit
E02C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cortistatin(CORT) ELISA kit
E03C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cortistatin(CORT) ELISA kit
E03C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cortistatin(CORT) ELISA kit
E03C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cortistatin(CORT) ELISA kit
E04C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cortistatin(CORT) ELISA kit
E04C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cortistatin(CORT) ELISA kit
E04C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cortistatin(CORT) ELISA kit
E07C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cortistatin(CORT) ELISA kit
E07C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cortistatin(CORT) ELISA kit
E07C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cortistatin(CORT) ELISA kit
E08C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cortistatin(CORT) ELISA kit
E08C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cortistatin(CORT) ELISA kit
E08C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cortistatin(CORT) ELISA kit
E09C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cortistatin(CORT) ELISA kit
E09C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cortistatin(CORT) ELISA kit
E09C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cortistatin, Cort ELISA KIT
ELI-50784m	Lifescience Market	96 Tests	EUR 865

Mouse Cortistatin (CORT) ELISA Kit
abx388921-96tests	Abbexa	96 tests	EUR 903
Shipped within 5-12 working days.

Rat Cortistatin (CORT) ELISA Kit
abx392283-96tests	Abbexa	96 tests	EUR 903
Shipped within 5-12 working days.

Rat cortistatin (CORT) ELISA kit
CSB-EL005821RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat cortistatin (CORT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat cortistatin (CORT) ELISA kit
1-CSB-EL005821RA	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat cortistatin (CORT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cortistatin (CORT) Antibody
20-abx176029	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Cortistatin (CORT) Antibody
20-abx171936	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

ELISA kit for Human CORT (Cortistatin)
ELK4050	ELK Biotech	1 plate of 96 wells	EUR 432
A monoclonal antibody specific to Cortistatin (CORT) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Cortistatin (CORT) and unlabeled Cortistatin (CORT) (Standards or samples) with the pre-c Show more
Description: A competitive Inhibition ELISA kit for detection of Cortistatin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cortistatin (CORT) CLIA Kit
20-abx490463	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Cortistatin (CORT) Protein
20-abx653061	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Guinea pig cortistatin(CORT) ELISA kit
E05C1957-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cortistatin(CORT) ELISA kit
E05C1957-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cortistatin(CORT) ELISA kit
E05C1957-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cort ELISA Kit| Rat Cortistatin ELISA Kit
EF016993	Lifescience Market	96 Tests	EUR 689

Cort ELISA Kit| Mouse Cortistatin ELISA Kit
EF014548	Lifescience Market	96 Tests	EUR 689

OVA Conjugated Cortistatin (CORT)
4-CPC393Hu21	Cloud-Clone	EUR 207.52 EUR 158.00 EUR 503.20 EUR 234.40 EUR 368.80 EUR 202.00 EUR 1108.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O00230 Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Human Cortistatin expressed in: chemical synthesis

Human Cortistatin (CORT) Protein (OVA)
20-abx651266	Abbexa	EUR 286.00 EUR 203.00 EUR 704.00 EUR 328.00 EUR 244.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Corticosterone (Cort) ELISA Kit
DLR-Cort-Ge-48T	DL Develop	48T	EUR 469
Should the Corticosterone (Cort) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Corticosterone (Cort) in samples from serum, plasma, urine or other biological fluids.

Corticosterone (Cort) ELISA Kit
DLR-Cort-Ge-96T	DL Develop	96T	EUR 608
Should the Corticosterone (Cort) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Corticosterone (Cort) in samples from serum, plasma, urine or other biological fluids.

General Corticosterone (Cort) ELISA Kit
RDR-Cort-Ge-48Tests	Reddot Biotech	48 Tests	EUR 488

General Corticosterone (Cort) ELISA Kit
RDR-Cort-Ge-96Tests	Reddot Biotech	96 Tests	EUR 676

General Corticosterone (Cort) ELISA Kit
RD-Cort-Ge-48Tests	Reddot Biotech	48 Tests	EUR 467

General Corticosterone (Cort) ELISA Kit
RD-Cort-Ge-96Tests	Reddot Biotech	96 Tests	EUR 646

CORT/ Rat CORT ELISA Kit
ELA-E0540r	Lifescience Market	96 Tests	EUR 886

Cort/ Rat Cort ELISA Kit
ELI-25412r	Lifescience Market	96 Tests	EUR 886

Human CORT ELISA Kit
EHC0015	Abclonal	96Tests	EUR 521

Human CORT ELISA Kit
EHC0073	Abclonal	96Tests	EUR 521

CORT ELISA KIT|Human
EF000011	Lifescience Market	96 Tests	EUR 689

CORT ELISA KIT|Human
EF010943	Lifescience Market	96 Tests	EUR 689

Human CORT(Corticosterone) ELISA Kit
EH4860	FN Test	96T	EUR 524.1
Detection range: 2.81-180 ng/ml Uniprot ID: O00230
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens ;Sensitivity: 1.688 ng/ml

Human Corticosterone(CORT)ELISA Kit
GA-E1081HM-48T	GenAsia Biotech	48T	EUR 289

Human Corticosterone(CORT)ELISA Kit
GA-E1081HM-96T	GenAsia Biotech	96T	EUR 466

Human Corticosterone,CORT ELISA Kit
201-12-1065	SunredBio	96 tests	EUR 440
This Corticosterone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Corticosterone, CORT ELISA Kit
CSB-E07968h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Corticosterone, CORT ELISA Kit
1-CSB-E07968h	Cusabio	EUR 678.00 EUR 4644.00 EUR 2467.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Corticosterone,CORT ELISA Kit
CN-03316H1	ChemNorm	96T	EUR 449

Human Corticosterone,CORT ELISA Kit
CN-03316H2	ChemNorm	48T	EUR 299

Human Corticosterone(CORT)ELISA Kit
QY-E01989	Qayee Biotechnology	96T	EUR 361

CORT ELISA Kit (Human) (OKCA02089)
OKCA02089	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Binds to all human somatostatin receptor (SSTR) subtypes. It also inhibits cAMP production induced by forskolin through SSTRs. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL

Cortistatin-17 (human)
H-5536.0500	Bachem	0.5mg	EUR 334
Description: Sum Formula: C96H139N27O24S3; CAS# [189450-19-9] net

Cortistatin-17 (human)
H-5536.1000	Bachem	1.0mg	EUR 515
Description: Sum Formula: C96H139N27O24S3; CAS# [189450-19-9] net

Cortistatin-29 (human)
H-6458.0500	Bachem	0.5mg	EUR 248
Description: Sum Formula: C149H223N47O42S3; CAS# [1815618-16-6] net

Cortistatin-29 (human)
H-6458.1000	Bachem	1.0mg	EUR 393
Description: Sum Formula: C149H223N47O42S3; CAS# [1815618-16-6] net

Cortistatin 17, human
5-01001	CHI Scientific	4 x 1mg	Ask for price

Goat CORT ELISA Kit
EGTC0015	Abclonal	96Tests	EUR 521

Goat CORT ELISA Kit
EGTC0073	Abclonal	96Tests	EUR 521

Canine CORT ELISA Kit
ECC0015	Abclonal	96Tests	EUR 521

Canine CORT ELISA Kit
ECC0073	Abclonal	96Tests	EUR 521

Chicken CORT ELISA Kit
ECKC0015	Abclonal	96Tests	EUR 521

Bovine CORT ELISA Kit
EBC0015	Abclonal	96Tests	EUR 521

Bovine CORT ELISA Kit
EBC0073	Abclonal	96Tests	EUR 521

Anserini CORT ELISA Kit
EAC0015	Abclonal	96Tests	EUR 521

Anserine CORT ELISA Kit
EAC0073	Abclonal	96Tests	EUR 521

Rat CORT ELISA Kit
ERC0015	Abclonal	96Tests	EUR 521

Rat CORT ELISA Kit
ERC0073	Abclonal	96Tests	EUR 521

Rabbit CORT ELISA Kit
ERTC0015	Abclonal	96Tests	EUR 521

Rabbit CORT ELISA Kit
ERTC0073	Abclonal	96Tests	EUR 521

CORT(Corticosterone) ELISA Kit
EU3108	FN Test	96T	EUR 524.1
Detection range: 2.81-180 ng/ml Alias: Corticosterone
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: General;Sensitivity: 1.688 ng/ml

Sheep CORT ELISA Kit
ESC0015	Abclonal	96Tests	EUR 521

Porcine CORT ELISA Kit
EPC0015	Abclonal	96Tests	EUR 521

Porcine CORT ELISA Kit
EPC0073	Abclonal	96Tests	EUR 521

Mouse CORT ELISA Kit
EMC0015	Abclonal	96Tests	EUR 521

Mouse CORT ELISA Kit
EMC0073	Abclonal	96Tests	EUR 521

Monkey CORT ELISA Kit
EMKC0015	Abclonal	96Tests	EUR 521

Corticosterone (CORT) ELISA Kit
K4222-100	Biovision		EUR 805

Mouse CORT ELISA Kit
STJ150483	St John's Laboratory	1 kit	EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of CORT in Mouse serum, plasma and other biological fluids

Rat CORT ELISA Kit
STJ150495	St John's Laboratory	1 kit	EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of CORT in Rat serum, plasma and other biological fluids

Cortistatin-8
B5367-1	ApexBio	1 mg	EUR 299

Cortistatin 14
B5416-.5	ApexBio	500 µg	EUR 161

Cortistatin 14
B5416-1	ApexBio	1 mg	EUR 250

Cortistatin-14
HY-P1932	MedChemExpress	5mg	EUR 601

ELISA kit for Human Corticosterone (CORT)
KTE62277-48T	Abbkine	48T	EUR 365
Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress therefore, corticosterone can be used Show more
Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Corticosterone (CORT)
KTE62277-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2525
Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress therefore, corticosterone can be used Show more
Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Corticosterone (CORT)
KTE62277-96T	Abbkine	96T	EUR 637
Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress therefore, corticosterone can be used Show more
Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

General Corticosterone (Cort) ELISA Kit
CEA540Ge-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5359.82
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

General Corticosterone (Cort) ELISA Kit
CEA540Ge-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 529.04
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

General Corticosterone (Cort) ELISA Kit
CEA540Ge-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 712.92
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

General Corticosterone (Cort) ELISA Kit
CEA540Ge-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2908.14
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

General Corticosterone (Cort) ELISA Kit
4-CEA540Ge	Cloud-Clone	EUR 5410.00 EUR 2859.00 EUR 713.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Corticosterone elisa. Alternative names of the recognized antigen: Corticosrone
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Corticosterone (Cort) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Guinea Pig CORT ELISA Kit
EGC0015	Abclonal	96Tests	EUR 521

Guinea Pig CORT ELISA Kit
EGC0073	Abclonal	96Tests	EUR 521

Chicken CORT(Corticosterone) ELISA Kit
ECH0077	FN Test	96T	EUR 567.6
Detection range: 2.81-180 ng/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Chicken;Sensitivity: 1.688 ng/ml

Mouse Corticosterone(CORT)ELISA Kit
GA-E0463MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Corticosterone(CORT)ELISA Kit
GA-E0463MS-96T	GenAsia Biotech	96T	EUR 534

Rat Corticosterone(CORT)ELISA Kit
GA-E0504RT-48T	GenAsia Biotech	48T	EUR 317

Rat Corticosterone(CORT)ELISA Kit
GA-E0504RT-96T	GenAsia Biotech	96T	EUR 496

Rabbit Corticosterone,CORT ELISA Kit
GA-E0059RB-48T	GenAsia Biotech	48T	EUR 326

Rabbit Corticosterone,CORT ELISA Kit
GA-E0059RB-96T	GenAsia Biotech	96T	EUR 524

Rat CORT(Corticosterone) ELISA Kit
ER0859	FN Test	96T	EUR 524.1
Detection range: 2.81-180 ng/ml Alias: CORT
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 1.688 ng/ml

Rabbit CORT(Corticosterone) ELISA Kit
ERB0169	FN Test	96T	EUR 567.6
Detection range: 2.81-180 ng/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rabbit;Sensitivity: 1.686 ng/ml

Mouse CORT(Corticosterone) ELISA Kit
EM0946	FN Test	96T	EUR 524.1
Detection range: 2.81-180 ng/ml Alias: CORT
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Mus ;Sensitivity: 1.688 ng/ml

Goat corticosterone (CORT) ELISA kit
CSB-EQ027629GO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Goat corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Goat corticosterone (CORT) ELISA kit
1-CSB-EQ027629GO	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Goat corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Sheep corticosterone (CORT) ELISA kit
CSB-EQ027629SH-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Sheep corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Sheep corticosterone (CORT) ELISA kit
1-CSB-EQ027629SH	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Sheep corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Horse Corticosterone (CORT) ELISA kit
CSB-E14998Hs-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Horse Corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Horse Corticosterone (CORT) ELISA kit
1-CSB-E14998Hs	Cusabio	EUR 678.00 EUR 4644.00 EUR 2467.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Horse Corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit Corticosterone, CORT ELISA Kit
CSB-E06957Rb-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rabbit Corticosterone, CORT ELISA Kit
1-CSB-E06957Rb	Cusabio	EUR 678.00 EUR 4644.00 EUR 2467.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Corticosterone, CORT ELISA Kit
CSB-E07014r-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat Corticosterone, CORT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Corticosterone, CORT ELISA Kit
1-CSB-E07014r	Cusabio	EUR 967.00 EUR 5925.00 EUR 3134.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat Corticosterone, CORT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Corticosterone, CORT ELISA Kit
CSB-E07969m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Mouse Corticosterone, CORT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Corticosterone, CORT ELISA Kit
1-CSB-E07969m	Cusabio	EUR 678.00 EUR 4644.00 EUR 2467.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Mouse Corticosterone, CORT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chicken Corticosterone, CORT ELISA kit
CSB-E11991C-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Chicken Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Chicken Corticosterone, CORT ELISA kit
1-CSB-E11991C	Cusabio	EUR 967.00 EUR 5925.00 EUR 3134.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Chicken Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Canine Corticosterone, CORT ELISA Kit
CSB-E12760c-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Canine Corticosterone, CORT in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Canine Corticosterone, CORT ELISA Kit
1-CSB-E12760c	Cusabio	EUR 678.00 EUR 4644.00 EUR 2467.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Canine Corticosterone, CORT in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Corticosterone, CORT ELISA Kit
CSB-E06812p-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Pig Corticosterone, CORT ELISA Kit
1-CSB-E06812p	Cusabio	EUR 678.00 EUR 4644.00 EUR 2467.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Corticosterone,CORT ELISA Kit
CN-01965R1	ChemNorm	96T	EUR 481

Rat Corticosterone,CORT ELISA Kit
CN-01965R2	ChemNorm	48T	EUR 332

Mouse Corticosterone,CORT ELISA Kit
CN-02344M1	ChemNorm	96T	EUR 480

Mouse Corticosterone,CORT ELISA Kit
CN-02344M2	ChemNorm	48T	EUR 331

Rabbit Corticosterone,CORT ELISA Kit
CN-00689R1	ChemNorm	96T	EUR 457

Rabbit Corticosterone,CORT ELISA Kit
CN-00689R2	ChemNorm	48T	EUR 306

PoFAine Corticosterone,CORT ELISA Kit
CN-01232P1	ChemNorm	96T	EUR 467

PoFAine Corticosterone,CORT ELISA Kit
CN-01232P2	ChemNorm	48T	EUR 316

General Corticosterone ELISA Kit (Cort)
RK00640	Abclonal	96 Tests	EUR 521

Rat Corticosterone(CORT)ELISA Kit
QY-E11148	Qayee Biotechnology	96T	EUR 361

Rabbit Corticosterone,CORT ELISA Kit
QY-E30240	Qayee Biotechnology	96T	EUR 374

Mouse Corticosterone(CORT)ELISA Kit
QY-E20390	Qayee Biotechnology	96T	EUR 361

CORT ELISA Kit (Mouse) (OKCA01646)
OKCA01646	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: This gene encodes a member of the somatostatin family of multifunctional peptides attributed with neurohormone, neurotransmitter/modulator and autocrine/paracrine actions. The encoded preproprotein undergoes proteolytic processing to generate a mature functional peptide that can bind to somatostatin receptors. Mice lacking the encoded protein exhibit elevated levels of growth hormone in the plasma without major changes in somatic growth and have exacerbated nociceptive responses to neuropathic and inflammatory pain sensitization. Transgenic mice overexpressing the encoded protein in neurons do not express long-term potentiation in the dentate gyrus and exhibit deficits in synaptic plasticity and learning.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.039 ng/mL

Cortistatin-29 (rat)
H-6444.0500	Bachem	0.5mg	EUR 248
Description: Sum Formula: C161H240N46O41S2; CAS# [1815618-17-7] net

Cortistatin-29 (rat)
H-6444.1000	Bachem	1.0mg	EUR 393
Description: Sum Formula: C161H240N46O41S2; CAS# [1815618-17-7] net

Cortistatin-14 (TFA)
HY-P1932A	MedChemExpress	1mg	EUR 187

Cortistatin 14 Antibody
10651-05011	AssayPro	150 ug	EUR 217

Cortistatin 29 Antibody
10671-05011	AssayPro	150 ug	EUR 217

Pro-Cortistatin Antibody
10691-05011	AssayPro	150 ug	EUR 217

CORT ELISA Kit| General Corticosterone ELISA Kit
EF019604	Lifescience Market	96 Tests	EUR 689

CORT ELISA Kit| Rat Corticosterone ELISA Kit
EF016992	Lifescience Market	96 Tests	EUR 689

CORT ELISA Kit| Mouse Corticosterone ELISA Kit
EF013533	Lifescience Market	96 Tests	EUR 689

ELISA kit for Mouse CORT (Corticosterone)
E-EL-M0349	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CORT ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Mouse CORT. During the reaction, Mouse CORT in the sample or standard competes with a fixed amount of Mouse CORT on Show more
Description: A competitive ELISA kit for quantitative measurement of Mouse CORT (Corticosterone) in samples from Serum, Plasma, Cell supernatant

ELISA kit for General Cort (Corticosterone)
ELK7957	ELK Biotech	1 plate of 96 wells	EUR 372
A monoclonal antibody specific to Corticosterone (Cort) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Corticosterone (Cort) and unlabeled Corticosterone (Cort) (Standards or samples) with Show more
Description: A competitive Inhibition ELISA kit for detection of Corticosterone from General in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat CORT (Corticosterone)
E-EL-R0269	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CORT ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Rat CORT. During the reaction, Rat CORT in the sample or standard competes with a fixed amount of Rat CORT on the s Show more
Description: A competitive ELISA kit for quantitative measurement of Rat CORT (Corticosterone) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Chicken Corticosterone (CORT)
KTE30147-48T	Abbkine	48T	EUR 354
Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a Show more
Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Corticosterone (CORT)
KTE30147-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a Show more
Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Corticosterone (CORT)
KTE30147-96T	Abbkine	96T	EUR 572
Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a Show more
Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Porcine corticosterone / corticosterone (CORT) ELISA Kit
QY-E40120	Qayee Biotechnology	96T	EUR 400

CORT siRNA
20-abx901206	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CORT siRNA
20-abx912573	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CORT siRNA
20-abx912574	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CORT antibody
70R-9808	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CORT antibody

Cortistatin 14 (mouse, rat)
5-01000	CHI Scientific	4 x 1mg	Ask for price

Human CORT shRNA Plasmid
20-abx950930	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CORT Recombinant Protein (Human)
RP038242	ABM	100 ug	Ask for price

Wide-range General Corticosterone (Cort) ELISA Kit
WEA540Ge-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5098.02
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

Wide-range General Corticosterone (Cort) ELISA Kit
WEA540Ge-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 507.48
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

Wide-range General Corticosterone (Cort) ELISA Kit
WEA540Ge-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 682.12
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

Wide-range General Corticosterone (Cort) ELISA Kit
WEA540Ge-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2769.54
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

Wide-range General Corticosterone (Cort) ELISA Kit
4-WEA540Ge	Cloud-Clone	EUR 5149.00 EUR 2720.00 EUR 683.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Corticosterone elisa. Alternative names of the recognized antigen: Corticosrone
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Wide-range General Corticosterone (Cort) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

General Corticosterone (Cort)CLIA Kit
CCA540Ge-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5490.72
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

General Corticosterone (Cort)CLIA Kit
CCA540Ge-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 539.82
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

General Corticosterone (Cort)CLIA Kit
CCA540Ge-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 728.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

General Corticosterone (Cort)CLIA Kit
CCA540Ge-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2977.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.

General Corticosterone (Cort) CLIA Kit
4-CCA540Ge	Cloud-Clone	EUR 5541.00 EUR 2978.00 EUR 729.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Corticosterone Clia kit. Alternative names of the recognized antigen: Corticosrone
Description: Competitive Inhibition chemiluminescent immunoassay for detection of General Corticosterone (Cort)serum, plasma, urine and other biological fluids

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

CORT cloning plasmid
CSB-CL005821HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 468 Sequence: ATGTATAGACACAAAAACAGCTGGAGATTGGGCTTAAAATACCCACCAAGCTCCAAAGAAGAGACCCAAGTCCCCAAAACATTGATTTCAGGGCTGCCAGGAAGGAAGAGCAGCAGCAGGGTGGGAGAGAAGCTCCAGTCAGCCCACAAGATGCCATTGTCCCCCGGCCTCCTGCT Show more
Description: A cloning plasmid for the CORT gene.

CORT Blocking Peptide
33R-6294	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CORT antibody, catalog no. 70R-9808

Cortistatin 29 Antibody (Biotin Conjugate)
10671-05021	AssayPro	150 ug	EUR 276

Pro-Cortistatin Antibody (Biotin Conjugate)
10691-05021	AssayPro	150 ug	EUR 276

CORT ORF Vector (Human) (pORF)
ORF012748	ABM	1.0 ug DNA	EUR 354

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Rat CORT shRNA Plasmid
20-abx984909	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CORT shRNA Plasmid
20-abx969774	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BSA Conjugated Corticosterone (Cort)
4-CPA540Ge11	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): 346.5Da Isoelectric Point: Inquire
Description: Recombinant Pan-species Corticosterone expressed in: Protein conjugation

OVA Conjugated Corticosterone (Cort)
4-CPA540Ge21	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): 346.5Da Isoelectric Point: Inquire
Description: Recombinant Pan-species Corticosterone expressed in: Protein conjugation

CORT Recombinant Protein (Rat)
RP195983	ABM	100 ug	Ask for price

CORT Recombinant Protein (Mouse)
RP125591	ABM	100 ug	Ask for price

CORT sgRNA CRISPR Lentivector set (Human)
K0492401	ABM	3 x 1.0 ug	EUR 339

Human Carnitine-O-Octanoyltransferase (CORT) Protein
20-abx168950	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

APITD1-CORT ORF Vector (Human) (pORF)
ORF015676	ABM	1.0 ug DNA	Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

CORT sgRNA CRISPR Lentivector (Human) (Target 1)
K0492402	ABM	1.0 ug DNA	EUR 154

CORT sgRNA CRISPR Lentivector (Human) (Target 2)
K0492403	ABM	1.0 ug DNA	EUR 154

CORT sgRNA CRISPR Lentivector (Human) (Target 3)
K0492404	ABM	1.0 ug DNA	EUR 154

APITD1-CORT sgRNA CRISPR Lentivector set (Human)
K2746701	ABM	3 x 1.0 ug	EUR 339

Carnitine-O-Octanoyltransferase (CORT) Polyclonal Antibody (Human)
4-PAC406Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CORT (Lys410~Leu612) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnitine-O-Octanoyltransferase (CORT)

CORT Protein Vector (Human) (pPB-C-His)
PV050989	ABM	500 ng	EUR 481

CORT Protein Vector (Human) (pPB-N-His)
PV050990	ABM	500 ng	EUR 481

CORT Protein Vector (Human) (pPM-C-HA)
PV050991	ABM	500 ng	EUR 481

CORT Protein Vector (Human) (pPM-C-His)
PV050992	ABM	500 ng	EUR 481

Carnitine-O-Octanoyltransferase (CORT) Antibody
20-abx130909	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carnitine-O-Octanoyltransferase (CORT) Antibody
20-abx130910	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Corticosterone (Cort) Polyclonal Antibody (General)
4-PAA540Ge01	Cloud-Clone	EUR 228.00 EUR 2219.00 EUR 559.00 EUR 283.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Small Molecule, Cort conjugated to BSA. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against General Corticosterone (Cort)

Cort ORF Vector (Rat) (pORF)
ORF065329	ABM	1.0 ug DNA	EUR 506

Cort ORF Vector (Mouse) (pORF)
ORF041865	ABM	1.0 ug DNA	EUR 506

Recombinant Carnitine-O-Octanoyltransferase (CORT)
4-RPC406Hu01	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UKG9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Carnitine-O-Octanoyltransferase expressed in: E.coli

Human CORT(Cortistatin) ELISA Kit