Human CORT(Cortistatin) ELISA Kit

Human CORT(Cortistatin) ELISA Kit

To Order Contact us below: 

    Human Cortistatin (CORT) ELISA Kit
    RDR-CORT-Hu-96Tests 96 Tests
    EUR 756
    Human Cortistatin (CORT) ELISA Kit
    RD-CORT-Hu-48Tests 48 Tests
    EUR 521
    Human Cortistatin (CORT) ELISA Kit
    RD-CORT-Hu-96Tests 96 Tests
    EUR 723
    Human cortistatin(CORT) ELISA kit
    E01C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human cortistatin(CORT) ELISA kit
    E01C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human cortistatin(CORT) ELISA kit
    E01C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cortistatin (CORT) ELISA Kit
    20-abx151159
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Cortistatin, CORT ELISA KIT
    ELI-26185h 96 Tests
    EUR 824
    Human Cortistatin (CORT) ELISA Kit
    CEC393Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.
    Human Cortistatin (CORT) ELISA Kit
    CEC393Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.
    Human Cortistatin (CORT) ELISA Kit
    CEC393Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.
    Human Cortistatin (CORT) ELISA Kit
    CEC393Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.
    Human Cortistatin (CORT) ELISA Kit
    4-CEC393Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Cortistatin elisa. Alternative names of the recognized antigen: CST14
    • CST17
    • CST29
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Cortistatin (CORT) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human cortistatin (CORT) ELISA kit
    CSB-EL005821HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human cortistatin (CORT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human cortistatin (CORT) ELISA kit
    1-CSB-EL005821HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human cortistatin (CORT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Cortistatin(CORT)ELISA Kit
    QY-E01991 96T
    EUR 361
    Human Cortistatin ELISA Kit (CORT)
    RK01167 96 Tests
    EUR 521
    Rat cortistatin(CORT) ELISA kit
    E02C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat cortistatin(CORT) ELISA kit
    E02C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat cortistatin(CORT) ELISA kit
    E02C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse cortistatin(CORT) ELISA kit
    E03C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse cortistatin(CORT) ELISA kit
    E03C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse cortistatin(CORT) ELISA kit
    E03C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat cortistatin(CORT) ELISA kit
    E06C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat cortistatin(CORT) ELISA kit
    E06C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat cortistatin(CORT) ELISA kit
    E06C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit cortistatin(CORT) ELISA kit
    E04C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit cortistatin(CORT) ELISA kit
    E04C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit cortistatin(CORT) ELISA kit
    E04C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey cortistatin(CORT) ELISA kit
    E09C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey cortistatin(CORT) ELISA kit
    E09C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey cortistatin(CORT) ELISA kit
    E09C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog cortistatin(CORT) ELISA kit
    E08C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog cortistatin(CORT) ELISA kit
    E08C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog cortistatin(CORT) ELISA kit
    E08C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig cortistatin(CORT) ELISA kit
    E07C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig cortistatin(CORT) ELISA kit
    E07C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig cortistatin(CORT) ELISA kit
    E07C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat cortistatin (CORT) ELISA kit
    CSB-EL005821RA-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Rat cortistatin (CORT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Rat cortistatin (CORT) ELISA kit
    1-CSB-EL005821RA
    • EUR 703.00
    • EUR 4843.00
    • EUR 2570.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Rat cortistatin (CORT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Rat Cortistatin (CORT) ELISA Kit
    abx392283-96tests 96 tests
    EUR 903
    • Shipped within 5-12 working days.
    Mouse Cortistatin (CORT) ELISA Kit
    abx388921-96tests 96 tests
    EUR 903
    • Shipped within 5-12 working days.
    Mouse Cortistatin, Cort ELISA KIT
    ELI-50784m 96 Tests
    EUR 865
    Cortistatin (CORT) Antibody
    20-abx176029
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Cortistatin (CORT) Antibody
    20-abx171936
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    ELISA kit for Human CORT (Cortistatin)
    ELK4050 1 plate of 96 wells
    EUR 432
    • A monoclonal antibody specific to Cortistatin (CORT) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Cortistatin (CORT) and unlabeled Cortistatin (CORT) (Standards or samples) with the pre-c
    • Show more
    Description: A competitive Inhibition ELISA kit for detection of Cortistatin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Human Cortistatin (CORT) CLIA Kit
    20-abx490463
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Human Cortistatin (CORT) Protein
    20-abx653061
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Guinea pig cortistatin(CORT) ELISA kit
    E05C1957-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig cortistatin(CORT) ELISA kit
    E05C1957-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig cortistatin(CORT) ELISA kit
    E05C1957-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Cort ELISA Kit| Rat Cortistatin ELISA Kit
    EF016993 96 Tests
    EUR 689
    Cort ELISA Kit| Mouse Cortistatin ELISA Kit
    EF014548 96 Tests
    EUR 689
    OVA Conjugated Cortistatin (CORT)
    4-CPC393Hu21
    • EUR 207.52
    • EUR 158.00
    • EUR 503.20
    • EUR 234.40
    • EUR 368.80
    • EUR 202.00
    • EUR 1108.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: O00230
    • Buffer composition: PBS, pH 7.4.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): Inquire
    • Isoelectric Point: Inquire
    Description: Recombinant Human Cortistatin expressed in: chemical synthesis
    Human Cortistatin (CORT) Protein (OVA)
    20-abx651266
    • EUR 286.00
    • EUR 203.00
    • EUR 704.00
    • EUR 328.00
    • EUR 244.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Corticosterone (Cort) ELISA Kit
    DLR-Cort-Ge-48T 48T
    EUR 469
    • Should the Corticosterone (Cort) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A competitive inhibition quantitative ELISA assay kit for detection of Corticosterone (Cort) in samples from serum, plasma, urine or other biological fluids.
    Corticosterone (Cort) ELISA Kit
    DLR-Cort-Ge-96T 96T
    EUR 608
    • Should the Corticosterone (Cort) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A competitive inhibition quantitative ELISA assay kit for detection of Corticosterone (Cort) in samples from serum, plasma, urine or other biological fluids.
    General Corticosterone (Cort) ELISA Kit
    RDR-Cort-Ge-48Tests 48 Tests
    EUR 488
    General Corticosterone (Cort) ELISA Kit
    RDR-Cort-Ge-96Tests 96 Tests
    EUR 676
    General Corticosterone (Cort) ELISA Kit
    RD-Cort-Ge-48Tests 48 Tests
    EUR 467
    General Corticosterone (Cort) ELISA Kit
    RD-Cort-Ge-96Tests 96 Tests
    EUR 646
    CORT/ Rat CORT ELISA Kit
    ELA-E0540r 96 Tests
    EUR 886
    Cort/ Rat Cort ELISA Kit
    ELI-25412r 96 Tests
    EUR 886
    Human CORT ELISA Kit
    EHC0015 96Tests
    EUR 521
    Human CORT ELISA Kit
    EHC0073 96Tests
    EUR 521
    CORT ELISA KIT|Human
    EF000011 96 Tests
    EUR 689
    CORT ELISA KIT|Human
    EF010943 96 Tests
    EUR 689
    Human Corticosterone,CORT ELISA Kit
    201-12-1065 96 tests
    EUR 440
    • This Corticosterone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human CORT(Corticosterone) ELISA Kit
    EH4860 96T
    EUR 524.1
    • Detection range: 2.81-180 ng/ml
    • Uniprot ID: O00230
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens ;Sensitivity: 1.688 ng/ml
    Human Corticosterone, CORT ELISA Kit
    CSB-E07968h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativecompetitive ELISA kit for measuring Human Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Corticosterone, CORT ELISA Kit
    1-CSB-E07968h
    • EUR 678.00
    • EUR 4644.00
    • EUR 2467.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativecompetitive ELISA kit for measuring Human Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Corticosterone,CORT ELISA Kit
    CN-03316H1 96T
    EUR 449
    Human Corticosterone,CORT ELISA Kit
    CN-03316H2 48T
    EUR 299
    Human Corticosterone(CORT)ELISA Kit
    GA-E1081HM-48T 48T
    EUR 289
    Human Corticosterone(CORT)ELISA Kit
    GA-E1081HM-96T 96T
    EUR 466
    Human Corticosterone(CORT)ELISA Kit
    QY-E01989 96T
    EUR 361
    CORT ELISA Kit (Human) (OKCA02089)
    OKCA02089 96 Wells
    EUR 833
    Description: Description of target: Binds to all human somatostatin receptor (SSTR) subtypes. It also inhibits cAMP production induced by forskolin through SSTRs. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL
    Cortistatin 17, human
    5-01001 4 x 1mg Ask for price
    Cortistatin-29 (human)
    H-6458.0500 0.5mg
    EUR 248
    Description: Sum Formula: C149H223N47O42S3; CAS# [1815618-16-6] net
    Cortistatin-29 (human)
    H-6458.1000 1.0mg
    EUR 393
    Description: Sum Formula: C149H223N47O42S3; CAS# [1815618-16-6] net
    Cortistatin-17 (human)
    H-5536.0500 0.5mg
    EUR 334
    Description: Sum Formula: C96H139N27O24S3; CAS# [189450-19-9] net
    Cortistatin-17 (human)
    H-5536.1000 1.0mg
    EUR 515
    Description: Sum Formula: C96H139N27O24S3; CAS# [189450-19-9] net
    Goat CORT ELISA Kit
    EGTC0015 96Tests
    EUR 521
    Goat CORT ELISA Kit
    EGTC0073 96Tests
    EUR 521
    Bovine CORT ELISA Kit
    EBC0015 96Tests
    EUR 521
    Bovine CORT ELISA Kit
    EBC0073 96Tests
    EUR 521
    Canine CORT ELISA Kit
    ECC0015 96Tests
    EUR 521
    Canine CORT ELISA Kit
    ECC0073 96Tests
    EUR 521
    Chicken CORT ELISA Kit
    ECKC0015 96Tests
    EUR 521
    Anserini CORT ELISA Kit
    EAC0015 96Tests
    EUR 521
    Anserine CORT ELISA Kit
    EAC0073 96Tests
    EUR 521
    Mouse CORT ELISA Kit
    EMC0015 96Tests
    EUR 521
    Mouse CORT ELISA Kit
    EMC0073 96Tests
    EUR 521
    CORT(Corticosterone) ELISA Kit
    EU3108 96T
    EUR 524.1
    • Detection range: 2.81-180 ng/ml
    • Alias: Corticosterone
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: General;Sensitivity: 1.688 ng/ml
    Rat CORT ELISA Kit
    ERC0015 96Tests
    EUR 521
    Rat CORT ELISA Kit
    ERC0073 96Tests
    EUR 521
    Sheep CORT ELISA Kit
    ESC0015 96Tests
    EUR 521
    Rabbit CORT ELISA Kit
    ERTC0015 96Tests
    EUR 521
    Rabbit CORT ELISA Kit
    ERTC0073 96Tests
    EUR 521
    Monkey CORT ELISA Kit
    EMKC0015 96Tests
    EUR 521
    Porcine CORT ELISA Kit
    EPC0015 96Tests
    EUR 521
    Porcine CORT ELISA Kit
    EPC0073 96Tests
    EUR 521
    Corticosterone (CORT) ELISA Kit
    K4222-100
    EUR 805
    Mouse CORT ELISA Kit
    STJ150483 1 kit
    EUR 412
    Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of CORT in Mouse serum, plasma and other biological fluids
    Rat CORT ELISA Kit
    STJ150495 1 kit
    EUR 412
    Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of CORT in Rat serum, plasma and other biological fluids
    Cortistatin-8
    B5367-1 1 mg
    EUR 299
    Cortistatin 14
    B5416-.5 500 µg
    EUR 161
    Cortistatin 14
    B5416-1 1 mg
    EUR 250
    Cortistatin-14
    HY-P1932 5mg
    EUR 601
    ELISA kit for Human Corticosterone (CORT)
    KTE62277-48T 48T
    EUR 365
    • Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress
    • therefore, corticosterone can be used
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Corticosterone (CORT)
    KTE62277-5platesof96wells 5 plates of 96 wells
    EUR 2525
    • Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress
    • therefore, corticosterone can be used
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Corticosterone (CORT)
    KTE62277-96T 96T
    EUR 637
    • Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress
    • therefore, corticosterone can be used
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Pig Corticosterone, CORT ELISA Kit
    CSB-E06812p-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Pig Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Pig Corticosterone, CORT ELISA Kit
    1-CSB-E06812p
    • EUR 678.00
    • EUR 4644.00
    • EUR 2467.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Pig Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Goat corticosterone (CORT) ELISA kit
    CSB-EQ027629GO-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Goat corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Goat corticosterone (CORT) ELISA kit
    1-CSB-EQ027629GO
    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Goat corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Sheep corticosterone (CORT) ELISA kit
    CSB-EQ027629SH-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Sheep corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Sheep corticosterone (CORT) ELISA kit
    1-CSB-EQ027629SH
    • EUR 703.00
    • EUR 4843.00
    • EUR 2570.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Sheep corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Chicken CORT(Corticosterone) ELISA Kit
    ECH0077 96T
    EUR 567.6
    • Detection range: 2.81-180 ng/ml
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Chicken;Sensitivity: 1.688 ng/ml
    Guinea Pig CORT ELISA Kit
    EGC0015 96Tests
    EUR 521
    Guinea Pig CORT ELISA Kit
    EGC0073 96Tests
    EUR 521
    General Corticosterone (Cort) ELISA Kit
    CEA540Ge-10x96wellstestplate 10x96-wells test plate
    EUR 5359.82
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    General Corticosterone (Cort) ELISA Kit
    CEA540Ge-1x48wellstestplate 1x48-wells test plate
    EUR 529.04
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    General Corticosterone (Cort) ELISA Kit
    CEA540Ge-1x96wellstestplate 1x96-wells test plate
    EUR 712.92
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    General Corticosterone (Cort) ELISA Kit
    CEA540Ge-5x96wellstestplate 5x96-wells test plate
    EUR 2908.14
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    General Corticosterone (Cort) ELISA Kit
    4-CEA540Ge
    • EUR 5410.00
    • EUR 2859.00
    • EUR 713.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Corticosterone elisa. Alternative names of the recognized antigen: Corticosrone
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Corticosterone (Cort) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.
    Rabbit Corticosterone,CORT ELISA Kit
    CN-00689R1 96T
    EUR 457
    Rabbit Corticosterone,CORT ELISA Kit
    CN-00689R2 48T
    EUR 306
    PoFAine Corticosterone,CORT ELISA Kit
    CN-01232P1 96T
    EUR 467
    PoFAine Corticosterone,CORT ELISA Kit
    CN-01232P2 48T
    EUR 316
    Rabbit Corticosterone, CORT ELISA Kit
    CSB-E06957Rb-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Rabbit Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Rabbit Corticosterone, CORT ELISA Kit
    1-CSB-E06957Rb
    • EUR 678.00
    • EUR 4644.00
    • EUR 2467.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Rabbit Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Rat Corticosterone, CORT ELISA Kit
    CSB-E07014r-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativecompetitive ELISA kit for measuring Rat Corticosterone, CORT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Rat Corticosterone, CORT ELISA Kit
    1-CSB-E07014r
    • EUR 967.00
    • EUR 5925.00
    • EUR 3134.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativecompetitive ELISA kit for measuring Rat Corticosterone, CORT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Mouse Corticosterone, CORT ELISA Kit
    CSB-E07969m-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativecompetitive ELISA kit for measuring Mouse Corticosterone, CORT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Mouse Corticosterone, CORT ELISA Kit
    1-CSB-E07969m
    • EUR 678.00
    • EUR 4644.00
    • EUR 2467.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativecompetitive ELISA kit for measuring Mouse Corticosterone, CORT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Horse Corticosterone (CORT) ELISA kit
    CSB-E14998Hs-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Horse Corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Horse Corticosterone (CORT) ELISA kit
    1-CSB-E14998Hs
    • EUR 678.00
    • EUR 4644.00
    • EUR 2467.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Horse Corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Chicken Corticosterone, CORT ELISA kit
    CSB-E11991C-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativecompetitive ELISA kit for measuring Chicken Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Chicken Corticosterone, CORT ELISA kit
    1-CSB-E11991C
    • EUR 967.00
    • EUR 5925.00
    • EUR 3134.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativecompetitive ELISA kit for measuring Chicken Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Canine Corticosterone, CORT ELISA Kit
    CSB-E12760c-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Canine Corticosterone, CORT in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Canine Corticosterone, CORT ELISA Kit
    1-CSB-E12760c
    • EUR 678.00
    • EUR 4644.00
    • EUR 2467.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Canine Corticosterone, CORT in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Rat Corticosterone,CORT ELISA Kit
    CN-01965R1 96T
    EUR 481
    Rat Corticosterone,CORT ELISA Kit
    CN-01965R2 48T
    EUR 332
    Mouse Corticosterone,CORT ELISA Kit
    CN-02344M1 96T
    EUR 480
    Mouse Corticosterone,CORT ELISA Kit
    CN-02344M2 48T
    EUR 331
    Mouse CORT(Corticosterone) ELISA Kit
    EM0946 96T
    EUR 524.1
    • Detection range: 2.81-180 ng/ml
    • Alias: CORT
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Mus ;Sensitivity: 1.688 ng/ml
    Rat CORT(Corticosterone) ELISA Kit
    ER0859 96T
    EUR 524.1
    • Detection range: 2.81-180 ng/ml
    • Alias: CORT
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 1.688 ng/ml
    Rabbit CORT(Corticosterone) ELISA Kit
    ERB0169 96T
    EUR 567.6
    • Detection range: 2.81-180 ng/ml
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rabbit;Sensitivity: 1.686 ng/ml
    Rabbit Corticosterone,CORT ELISA Kit
    GA-E0059RB-48T 48T
    EUR 326
    Rabbit Corticosterone,CORT ELISA Kit
    GA-E0059RB-96T 96T
    EUR 524
    Mouse Corticosterone(CORT)ELISA Kit
    GA-E0463MS-48T 48T
    EUR 336
    Mouse Corticosterone(CORT)ELISA Kit
    GA-E0463MS-96T 96T
    EUR 534
    Rat Corticosterone(CORT)ELISA Kit
    GA-E0504RT-48T 48T
    EUR 317
    Rat Corticosterone(CORT)ELISA Kit
    GA-E0504RT-96T 96T
    EUR 496
    Rat Corticosterone(CORT)ELISA Kit
    QY-E11148 96T
    EUR 361
    General Corticosterone ELISA Kit (Cort)
    RK00640 96 Tests
    EUR 521
    Mouse Corticosterone(CORT)ELISA Kit
    QY-E20390 96T
    EUR 361
    Rabbit Corticosterone,CORT ELISA Kit
    QY-E30240 96T
    EUR 374
    CORT ELISA Kit (Mouse) (OKCA01646)
    OKCA01646 96 Wells
    EUR 846
    Description: Description of target: This gene encodes a member of the somatostatin family of multifunctional peptides attributed with neurohormone, neurotransmitter/modulator and autocrine/paracrine actions. The encoded preproprotein undergoes proteolytic processing to generate a mature functional peptide that can bind to somatostatin receptors. Mice lacking the encoded protein exhibit elevated levels of growth hormone in the plasma without major changes in somatic growth and have exacerbated nociceptive responses to neuropathic and inflammatory pain sensitization. Transgenic mice overexpressing the encoded protein in neurons do not express long-term potentiation in the dentate gyrus and exhibit deficits in synaptic plasticity and learning.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.039 ng/mL
    Cortistatin 14 Antibody
    10651-05011 150 ug
    EUR 217
    Cortistatin 29 Antibody
    10671-05011 150 ug
    EUR 217
    Pro-Cortistatin Antibody
    10691-05011 150 ug
    EUR 217
    Cortistatin-29 (rat)
    H-6444.0500 0.5mg
    EUR 248
    Description: Sum Formula: C161H240N46O41S2; CAS# [1815618-17-7] net
    Cortistatin-29 (rat)
    H-6444.1000 1.0mg
    EUR 393
    Description: Sum Formula: C161H240N46O41S2; CAS# [1815618-17-7] net
    Cortistatin-14 (TFA)
    HY-P1932A 1mg
    EUR 187
    CORT ELISA Kit| Rat Corticosterone ELISA Kit
    EF016992 96 Tests
    EUR 689
    CORT ELISA Kit| General Corticosterone ELISA Kit
    EF019604 96 Tests
    EUR 689
    CORT ELISA Kit| Mouse Corticosterone ELISA Kit
    EF013533 96 Tests
    EUR 689
    ELISA kit for Mouse CORT (Corticosterone)
    E-EL-M0349 1 plate of 96 wells
    EUR 534
    • Gentaur's CORT ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Mouse CORT. During the reaction, Mouse CORT in the sample or standard competes with a fixed amount of Mouse CORT on
    • Show more
    Description: A competitive ELISA kit for quantitative measurement of Mouse CORT (Corticosterone) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for Rat CORT (Corticosterone)
    E-EL-R0269 1 plate of 96 wells
    EUR 534
    • Gentaur's CORT ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Rat CORT. During the reaction, Rat CORT in the sample or standard competes with a fixed amount of Rat CORT on the s
    • Show more
    Description: A competitive ELISA kit for quantitative measurement of Rat CORT (Corticosterone) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for General Cort (Corticosterone)
    ELK7957 1 plate of 96 wells
    EUR 372
    • A monoclonal antibody specific to Corticosterone (Cort) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Corticosterone (Cort) and unlabeled Corticosterone (Cort) (Standards or samples) with
    • Show more
    Description: A competitive Inhibition ELISA kit for detection of Corticosterone from General in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Chicken Corticosterone (CORT)
    KTE30147-48T 48T
    EUR 354
    • Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Chicken Corticosterone (CORT)
    KTE30147-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Chicken Corticosterone (CORT)
    KTE30147-96T 96T
    EUR 572
    • Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Porcine corticosterone / corticosterone (CORT) ELISA Kit
    QY-E40120 96T
    EUR 400
    CORT antibody
    70R-9808 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal CORT antibody
    CORT siRNA
    20-abx901206
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CORT siRNA
    20-abx912573
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CORT siRNA
    20-abx912574
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Cortistatin 14 (mouse, rat)
    5-01000 4 x 1mg Ask for price
    Human CORT shRNA Plasmid
    20-abx950930
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    CORT Recombinant Protein (Human)
    RP038242 100 ug Ask for price
    Wide-range General Corticosterone (Cort) ELISA Kit
    WEA540Ge-10x96wellstestplate 10x96-wells test plate
    EUR 5098.02
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: C
    • Show more
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    Wide-range General Corticosterone (Cort) ELISA Kit
    WEA540Ge-1x48wellstestplate 1x48-wells test plate
    EUR 507.48
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: C
    • Show more
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    Wide-range General Corticosterone (Cort) ELISA Kit
    WEA540Ge-1x96wellstestplate 1x96-wells test plate
    EUR 682.12
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: C
    • Show more
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    Wide-range General Corticosterone (Cort) ELISA Kit
    WEA540Ge-5x96wellstestplate 5x96-wells test plate
    EUR 2769.54
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: C
    • Show more
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    Wide-range General Corticosterone (Cort) ELISA Kit
    4-WEA540Ge
    • EUR 5149.00
    • EUR 2720.00
    • EUR 683.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Corticosterone elisa. Alternative names of the recognized antigen: Corticosrone
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Wide-range General Corticosterone (Cort) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
    General Corticosterone (Cort)CLIA Kit
    CCA540Ge-10x96wellstestplate 10x96-wells test plate
    EUR 5490.72
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    General Corticosterone (Cort)CLIA Kit
    CCA540Ge-1x48wellstestplate 1x48-wells test plate
    EUR 539.82
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    General Corticosterone (Cort)CLIA Kit
    CCA540Ge-1x96wellstestplate 1x96-wells test plate
    EUR 728.32
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    General Corticosterone (Cort)CLIA Kit
    CCA540Ge-5x96wellstestplate 5x96-wells test plate
    EUR 2977.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
    General Corticosterone (Cort) CLIA Kit
    4-CCA540Ge
    • EUR 5541.00
    • EUR 2978.00
    • EUR 729.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Corticosterone Clia kit. Alternative names of the recognized antigen: Corticosrone
    Description: Competitive Inhibition chemiluminescent immunoassay for detection of General Corticosterone (Cort)serum, plasma, urine and other biological fluids
    Column Packing Kit
    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
    CORT Blocking Peptide
    33R-6294 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CORT antibody, catalog no. 70R-9808
    CORT cloning plasmid
    CSB-CL005821HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 468
    • Sequence: ATGTATAGACACAAAAACAGCTGGAGATTGGGCTTAAAATACCCACCAAGCTCCAAAGAAGAGACCCAAGTCCCCAAAACATTGATTTCAGGGCTGCCAGGAAGGAAGAGCAGCAGCAGGGTGGGAGAGAAGCTCCAGTCAGCCCACAAGATGCCATTGTCCCCCGGCCTCCTGCT
    • Show more
    Description: A cloning plasmid for the CORT gene.
    PCR Mycoplasma Detection Kit
    M034-Kit Kit
    EUR 266
    Cortistatin 29 Antibody (Biotin Conjugate)
    10671-05021 150 ug
    EUR 276
    Pro-Cortistatin Antibody (Biotin Conjugate)
    10691-05021 150 ug
    EUR 276
    CORT ORF Vector (Human) (pORF)
    ORF012748 1.0 ug DNA
    EUR 354
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Rat CORT shRNA Plasmid
    20-abx984909
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse CORT shRNA Plasmid
    20-abx969774
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    BSA Conjugated Corticosterone (Cort)
    4-CPA540Ge11
    • EUR 413.60
    • EUR 214.00
    • EUR 1276.00
    • EUR 492.00
    • EUR 884.00
    • EUR 340.00
    • EUR 3040.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Inquire
    • Buffer composition: PBS, pH 7.4.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 346.5Da
    • Isoelectric Point: Inquire
    Description: Recombinant Pan-species Corticosterone expressed in: Protein conjugation
    OVA Conjugated Corticosterone (Cort)
    4-CPA540Ge21
    • EUR 413.60
    • EUR 214.00
    • EUR 1276.00
    • EUR 492.00
    • EUR 884.00
    • EUR 340.00
    • EUR 3040.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Inquire
    • Buffer composition: PBS, pH 7.4.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 346.5Da
    • Isoelectric Point: Inquire
    Description: Recombinant Pan-species Corticosterone expressed in: Protein conjugation
    CORT Recombinant Protein (Rat)
    RP195983 100 ug Ask for price
    CORT Recombinant Protein (Mouse)
    RP125591 100 ug Ask for price
    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9
    Human Carnitine-O-Octanoyltransferase (CORT) Protein
    20-abx168950
    • EUR 453.00
    • EUR 230.00
    • EUR 1233.00
    • EUR 523.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    CORT sgRNA CRISPR Lentivector set (Human)
    K0492401 3 x 1.0 ug
    EUR 339
    APITD1-CORT ORF Vector (Human) (pORF)
    ORF015676 1.0 ug DNA Ask for price
    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing
    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing
    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing
    CORT sgRNA CRISPR Lentivector (Human) (Target 1)
    K0492402 1.0 ug DNA
    EUR 154
    CORT sgRNA CRISPR Lentivector (Human) (Target 2)
    K0492403 1.0 ug DNA
    EUR 154
    CORT sgRNA CRISPR Lentivector (Human) (Target 3)
    K0492404 1.0 ug DNA
    EUR 154
    APITD1-CORT sgRNA CRISPR Lentivector set (Human)
    K2746701 3 x 1.0 ug
    EUR 339
    Carnitine-O-Octanoyltransferase (CORT) Polyclonal Antibody (Human)
    4-PAC406Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CORT (Lys410~Leu612)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carnitine-O-Octanoyltransferase (CORT)
    CORT Protein Vector (Human) (pPB-C-His)
    PV050989 500 ng
    EUR 481
    CORT Protein Vector (Human) (pPB-N-His)
    PV050990 500 ng
    EUR 481
    CORT Protein Vector (Human) (pPM-C-HA)
    PV050991 500 ng
    EUR 481
    CORT Protein Vector (Human) (pPM-C-His)
    PV050992 500 ng
    EUR 481
    Carnitine-O-Octanoyltransferase (CORT) Antibody
    20-abx130909
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Carnitine-O-Octanoyltransferase (CORT) Antibody
    20-abx130910
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Corticosterone (Cort) Polyclonal Antibody (General)
    4-PAA540Ge01
    • EUR 228.00
    • EUR 2219.00
    • EUR 559.00
    • EUR 283.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Small Molecule, Cort conjugated to BSA.
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against General Corticosterone (Cort)
    Cort ORF Vector (Rat) (pORF)
    ORF065329 1.0 ug DNA
    EUR 506
    Cort ORF Vector (Mouse) (pORF)
    ORF041865 1.0 ug DNA
    EUR 506
    Recombinant Carnitine-O-Octanoyltransferase (CORT)
    4-RPC406Hu01
    • EUR 315.04
    • EUR 187.00
    • EUR 906.40
    • EUR 368.80
    • EUR 637.60
    • EUR 274.00
    • EUR 2116.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9UKG9
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 26.8kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Carnitine-O-Octanoyltransferase expressed in: E.coli

    Human CORT(Cortistatin) ELISA Kit