Human CORT(Cortistatin) ELISA Kit

Human CORT(Cortistatin) ELISA Kit

To Order Contact us below: 

Human Cortistatin (CORT) ELISA Kit
RDR-CORT-Hu-96Tests 96 Tests
EUR 756
Human Cortistatin (CORT) ELISA Kit
RD-CORT-Hu-48Tests 48 Tests
EUR 521
Human Cortistatin (CORT) ELISA Kit
RD-CORT-Hu-96Tests 96 Tests
EUR 723
Human Cortistatin (CORT) ELISA Kit
CEC393Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.
Human Cortistatin (CORT) ELISA Kit
CEC393Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.
Human Cortistatin (CORT) ELISA Kit
CEC393Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.
Human Cortistatin (CORT) ELISA Kit
CEC393Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cortistatin (CORT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Cortistatin (CORT) in serum, plasma and other biological fluids.
Human Cortistatin (CORT) ELISA Kit
4-CEC393Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cortistatin elisa. Alternative names of the recognized antigen: CST14
  • CST17
  • CST29
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Cortistatin (CORT) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
Human cortistatin(CORT) ELISA kit
E01C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human cortistatin(CORT) ELISA kit
E01C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human cortistatin(CORT) ELISA kit
E01C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cortistatin, CORT ELISA KIT
ELI-26185h 96 Tests
EUR 824
Human Cortistatin (CORT) ELISA Kit
20-abx151159
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human cortistatin (CORT) ELISA kit
CSB-EL005821HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cortistatin (CORT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human cortistatin (CORT) ELISA kit
1-CSB-EL005821HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cortistatin (CORT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Cortistatin ELISA Kit (CORT)
RK01167 96 Tests
EUR 521
Human Cortistatin(CORT)ELISA Kit
QY-E01991 96T
EUR 361
Goat cortistatin(CORT) ELISA kit
E06C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat cortistatin(CORT) ELISA kit
E06C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat cortistatin(CORT) ELISA kit
E06C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat cortistatin(CORT) ELISA kit
E02C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat cortistatin(CORT) ELISA kit
E02C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat cortistatin(CORT) ELISA kit
E02C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse cortistatin(CORT) ELISA kit
E03C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse cortistatin(CORT) ELISA kit
E03C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse cortistatin(CORT) ELISA kit
E03C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit cortistatin(CORT) ELISA kit
E04C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit cortistatin(CORT) ELISA kit
E04C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit cortistatin(CORT) ELISA kit
E04C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig cortistatin(CORT) ELISA kit
E07C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig cortistatin(CORT) ELISA kit
E07C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig cortistatin(CORT) ELISA kit
E07C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog cortistatin(CORT) ELISA kit
E08C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog cortistatin(CORT) ELISA kit
E08C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog cortistatin(CORT) ELISA kit
E08C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey cortistatin(CORT) ELISA kit
E09C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey cortistatin(CORT) ELISA kit
E09C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey cortistatin(CORT) ELISA kit
E09C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cortistatin, Cort ELISA KIT
ELI-50784m 96 Tests
EUR 865
Mouse Cortistatin (CORT) ELISA Kit
abx388921-96tests 96 tests
EUR 903
  • Shipped within 5-12 working days.
Rat Cortistatin (CORT) ELISA Kit
abx392283-96tests 96 tests
EUR 903
  • Shipped within 5-12 working days.
Rat cortistatin (CORT) ELISA kit
CSB-EL005821RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat cortistatin (CORT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat cortistatin (CORT) ELISA kit
1-CSB-EL005821RA
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat cortistatin (CORT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
ELISA kit for Human CORT (Cortistatin)
ELK4050 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Cortistatin (CORT) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Cortistatin (CORT) and unlabeled Cortistatin (CORT) (Standards or samples) with the pre-c
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Cortistatin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Cortistatin (CORT) Antibody
20-abx176029
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Cortistatin (CORT) Antibody
20-abx171936
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Human Cortistatin (CORT) CLIA Kit
20-abx490463
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Cortistatin (CORT) Protein
20-abx653061
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Guinea pig cortistatin(CORT) ELISA kit
E05C1957-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig cortistatin(CORT) ELISA kit
E05C1957-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig cortistatin(CORT) ELISA kit
E05C1957-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cortistatin(CORT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Cort ELISA Kit| Rat Cortistatin ELISA Kit
EF016993 96 Tests
EUR 689
Cort ELISA Kit| Mouse Cortistatin ELISA Kit
EF014548 96 Tests
EUR 689
OVA Conjugated Cortistatin (CORT)
4-CPC393Hu21
  • EUR 207.52
  • EUR 158.00
  • EUR 503.20
  • EUR 234.40
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00230
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Cortistatin expressed in: chemical synthesis
Human Cortistatin (CORT) Protein (OVA)
20-abx651266
  • EUR 286.00
  • EUR 203.00
  • EUR 704.00
  • EUR 328.00
  • EUR 244.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Corticosterone (Cort) ELISA Kit
DLR-Cort-Ge-48T 48T
EUR 469
  • Should the Corticosterone (Cort) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Corticosterone (Cort) in samples from serum, plasma, urine or other biological fluids.
Corticosterone (Cort) ELISA Kit
DLR-Cort-Ge-96T 96T
EUR 608
  • Should the Corticosterone (Cort) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Corticosterone (Cort) in samples from serum, plasma, urine or other biological fluids.
General Corticosterone (Cort) ELISA Kit
RDR-Cort-Ge-48Tests 48 Tests
EUR 488
General Corticosterone (Cort) ELISA Kit
RDR-Cort-Ge-96Tests 96 Tests
EUR 676
General Corticosterone (Cort) ELISA Kit
RD-Cort-Ge-48Tests 48 Tests
EUR 467
General Corticosterone (Cort) ELISA Kit
RD-Cort-Ge-96Tests 96 Tests
EUR 646
CORT/ Rat CORT ELISA Kit
ELA-E0540r 96 Tests
EUR 886
Cort/ Rat Cort ELISA Kit
ELI-25412r 96 Tests
EUR 886
Human CORT ELISA Kit
EHC0015 96Tests
EUR 521
Human CORT ELISA Kit
EHC0073 96Tests
EUR 521
CORT ELISA KIT|Human
EF000011 96 Tests
EUR 689
CORT ELISA KIT|Human
EF010943 96 Tests
EUR 689
Human CORT(Corticosterone) ELISA Kit
EH4860 96T
EUR 524.1
  • Detection range: 2.81-180 ng/ml
  • Uniprot ID: O00230
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens ;Sensitivity: 1.688 ng/ml
Human Corticosterone(CORT)ELISA Kit
GA-E1081HM-48T 48T
EUR 289
Human Corticosterone(CORT)ELISA Kit
GA-E1081HM-96T 96T
EUR 466
Human Corticosterone,CORT ELISA Kit
201-12-1065 96 tests
EUR 440
  • This Corticosterone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Corticosterone, CORT ELISA Kit
CSB-E07968h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Corticosterone, CORT ELISA Kit
1-CSB-E07968h
  • EUR 678.00
  • EUR 4644.00
  • EUR 2467.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Corticosterone,CORT ELISA Kit
CN-03316H1 96T
EUR 449
Human Corticosterone,CORT ELISA Kit
CN-03316H2 48T
EUR 299
Human Corticosterone(CORT)ELISA Kit
QY-E01989 96T
EUR 361
Cortistatin-17 (human)
H-5536.0500 0.5mg
EUR 334
Description: Sum Formula: C96H139N27O24S3; CAS# [189450-19-9] net
Cortistatin-17 (human)
H-5536.1000 1.0mg
EUR 515
Description: Sum Formula: C96H139N27O24S3; CAS# [189450-19-9] net
Cortistatin-29 (human)
H-6458.0500 0.5mg
EUR 248
Description: Sum Formula: C149H223N47O42S3; CAS# [1815618-16-6] net
Cortistatin-29 (human)
H-6458.1000 1.0mg
EUR 393
Description: Sum Formula: C149H223N47O42S3; CAS# [1815618-16-6] net
Cortistatin 17, human
5-01001 4 x 1mg Ask for price
Goat CORT ELISA Kit
EGTC0015 96Tests
EUR 521
Goat CORT ELISA Kit
EGTC0073 96Tests
EUR 521
Canine CORT ELISA Kit
ECC0015 96Tests
EUR 521
Canine CORT ELISA Kit
ECC0073 96Tests
EUR 521
Chicken CORT ELISA Kit
ECKC0015 96Tests
EUR 521
Bovine CORT ELISA Kit
EBC0015 96Tests
EUR 521
Bovine CORT ELISA Kit
EBC0073 96Tests
EUR 521
Anserini CORT ELISA Kit
EAC0015 96Tests
EUR 521
Anserine CORT ELISA Kit
EAC0073 96Tests
EUR 521
Rat CORT ELISA Kit
ERC0015 96Tests
EUR 521
Rat CORT ELISA Kit
ERC0073 96Tests
EUR 521
Rabbit CORT ELISA Kit
ERTC0015 96Tests
EUR 521
Rabbit CORT ELISA Kit
ERTC0073 96Tests
EUR 521
CORT(Corticosterone) ELISA Kit
EU3108 96T
EUR 524.1
  • Detection range: 2.81-180 ng/ml
  • Alias: Corticosterone
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: General;Sensitivity: 1.688 ng/ml
Sheep CORT ELISA Kit
ESC0015 96Tests
EUR 521
Porcine CORT ELISA Kit
EPC0015 96Tests
EUR 521
Porcine CORT ELISA Kit
EPC0073 96Tests
EUR 521
Mouse CORT ELISA Kit
EMC0015 96Tests
EUR 521
Mouse CORT ELISA Kit
EMC0073 96Tests
EUR 521
Monkey CORT ELISA Kit
EMKC0015 96Tests
EUR 521
Corticosterone (CORT) ELISA Kit
K4222-100
EUR 805
Mouse CORT ELISA Kit
STJ150483 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of CORT in Mouse serum, plasma and other biological fluids
Rat CORT ELISA Kit
STJ150495 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of CORT in Rat serum, plasma and other biological fluids
Cortistatin-8
B5367-1 1 mg
EUR 299
Cortistatin 14
B5416-.5 500 µg
EUR 161
Cortistatin 14
B5416-1 1 mg
EUR 250
Cortistatin-14
HY-P1932 5mg
EUR 601
ELISA kit for Human Corticosterone (CORT)
KTE62277-48T 48T
EUR 365
  • Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress
  • therefore, corticosterone can be used
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Corticosterone (CORT)
KTE62277-5platesof96wells 5 plates of 96 wells
EUR 2525
  • Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress
  • therefore, corticosterone can be used
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Corticosterone (CORT)
KTE62277-96T 96T
EUR 637
  • Corticosterone is a glucocorticoid produced by the adrenal cortex in response to ACTH (adrenocoridotropic hormone), and is the precursor to aldosterone. The production of glucorcorticoids is increased by stress
  • therefore, corticosterone can be used
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
General Corticosterone (Cort) ELISA Kit
CEA540Ge-10x96wellstestplate 10x96-wells test plate
EUR 5359.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
General Corticosterone (Cort) ELISA Kit
CEA540Ge-1x48wellstestplate 1x48-wells test plate
EUR 529.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
General Corticosterone (Cort) ELISA Kit
CEA540Ge-1x96wellstestplate 1x96-wells test plate
EUR 712.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
General Corticosterone (Cort) ELISA Kit
CEA540Ge-5x96wellstestplate 5x96-wells test plate
EUR 2908.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
General Corticosterone (Cort) ELISA Kit
4-CEA540Ge
  • EUR 5410.00
  • EUR 2859.00
  • EUR 713.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Corticosterone elisa. Alternative names of the recognized antigen: Corticosrone
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Corticosterone (Cort) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.
Guinea Pig CORT ELISA Kit
EGC0015 96Tests
EUR 521
Guinea Pig CORT ELISA Kit
EGC0073 96Tests
EUR 521
Chicken CORT(Corticosterone) ELISA Kit
ECH0077 96T
EUR 567.6
  • Detection range: 2.81-180 ng/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Chicken;Sensitivity: 1.688 ng/ml
Mouse Corticosterone(CORT)ELISA Kit
GA-E0463MS-48T 48T
EUR 336
Mouse Corticosterone(CORT)ELISA Kit
GA-E0463MS-96T 96T
EUR 534
Rat Corticosterone(CORT)ELISA Kit
GA-E0504RT-48T 48T
EUR 317
Rat Corticosterone(CORT)ELISA Kit
GA-E0504RT-96T 96T
EUR 496
Rabbit Corticosterone,CORT ELISA Kit
GA-E0059RB-48T 48T
EUR 326
Rabbit Corticosterone,CORT ELISA Kit
GA-E0059RB-96T 96T
EUR 524
Rat CORT(Corticosterone) ELISA Kit
ER0859 96T
EUR 524.1
  • Detection range: 2.81-180 ng/ml
  • Alias: CORT
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 1.688 ng/ml
Rabbit CORT(Corticosterone) ELISA Kit
ERB0169 96T
EUR 567.6
  • Detection range: 2.81-180 ng/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rabbit;Sensitivity: 1.686 ng/ml
Mouse CORT(Corticosterone) ELISA Kit
EM0946 96T
EUR 524.1
  • Detection range: 2.81-180 ng/ml
  • Alias: CORT
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Mus ;Sensitivity: 1.688 ng/ml
Goat corticosterone (CORT) ELISA kit
CSB-EQ027629GO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Goat corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Goat corticosterone (CORT) ELISA kit
1-CSB-EQ027629GO
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Goat corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Sheep corticosterone (CORT) ELISA kit
CSB-EQ027629SH-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Sheep corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Sheep corticosterone (CORT) ELISA kit
1-CSB-EQ027629SH
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Sheep corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Horse Corticosterone (CORT) ELISA kit
CSB-E14998Hs-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Horse Corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Horse Corticosterone (CORT) ELISA kit
1-CSB-E14998Hs
  • EUR 678.00
  • EUR 4644.00
  • EUR 2467.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Horse Corticosterone (CORT) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rabbit Corticosterone, CORT ELISA Kit
CSB-E06957Rb-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rabbit Corticosterone, CORT ELISA Kit
1-CSB-E06957Rb
  • EUR 678.00
  • EUR 4644.00
  • EUR 2467.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Corticosterone, CORT ELISA Kit
CSB-E07014r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat Corticosterone, CORT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat Corticosterone, CORT ELISA Kit
1-CSB-E07014r
  • EUR 967.00
  • EUR 5925.00
  • EUR 3134.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Rat Corticosterone, CORT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Corticosterone, CORT ELISA Kit
CSB-E07969m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Mouse Corticosterone, CORT in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Corticosterone, CORT ELISA Kit
1-CSB-E07969m
  • EUR 678.00
  • EUR 4644.00
  • EUR 2467.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Mouse Corticosterone, CORT in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Chicken Corticosterone, CORT ELISA kit
CSB-E11991C-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Chicken Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Chicken Corticosterone, CORT ELISA kit
1-CSB-E11991C
  • EUR 967.00
  • EUR 5925.00
  • EUR 3134.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Chicken Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Canine Corticosterone, CORT ELISA Kit
CSB-E12760c-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Canine Corticosterone, CORT in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Canine Corticosterone, CORT ELISA Kit
1-CSB-E12760c
  • EUR 678.00
  • EUR 4644.00
  • EUR 2467.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Canine Corticosterone, CORT in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Pig Corticosterone, CORT ELISA Kit
CSB-E06812p-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Corticosterone, CORT in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Pig Corticosterone, CORT ELISA Kit
1-CSB-E06812p
  • EUR 678.00
  • EUR 4644.00
  • EUR 2467.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Corticosterone, CORT in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Corticosterone,CORT ELISA Kit
CN-01965R1 96T
EUR 481
Rat Corticosterone,CORT ELISA Kit
CN-01965R2 48T
EUR 332
Mouse Corticosterone,CORT ELISA Kit
CN-02344M1 96T
EUR 480
Mouse Corticosterone,CORT ELISA Kit
CN-02344M2 48T
EUR 331
Rabbit Corticosterone,CORT ELISA Kit
CN-00689R1 96T
EUR 457
Rabbit Corticosterone,CORT ELISA Kit
CN-00689R2 48T
EUR 306
PoFAine Corticosterone,CORT ELISA Kit
CN-01232P1 96T
EUR 467
PoFAine Corticosterone,CORT ELISA Kit
CN-01232P2 48T
EUR 316
General Corticosterone ELISA Kit (Cort)
RK00640 96 Tests
EUR 521
Rat Corticosterone(CORT)ELISA Kit
QY-E11148 96T
EUR 361
Rabbit Corticosterone,CORT ELISA Kit
QY-E30240 96T
EUR 374
Mouse Corticosterone(CORT)ELISA Kit
QY-E20390 96T
EUR 361
CORT ELISA Kit| General Corticosterone ELISA Kit
EF019604 96 Tests
EUR 689
CORT ELISA Kit| Rat Corticosterone ELISA Kit
EF016992 96 Tests
EUR 689
CORT ELISA Kit| Mouse Corticosterone ELISA Kit
EF013533 96 Tests
EUR 689
Cortistatin-29 (rat)
H-6444.0500 0.5mg
EUR 248
Description: Sum Formula: C161H240N46O41S2; CAS# [1815618-17-7] net
Cortistatin-29 (rat)
H-6444.1000 1.0mg
EUR 393
Description: Sum Formula: C161H240N46O41S2; CAS# [1815618-17-7] net
Cortistatin-14 (TFA)
HY-P1932A 1mg
EUR 187
Cortistatin 14 Antibody
10651-05011 150 ug
EUR 217
Cortistatin 29 Antibody
10671-05011 150 ug
EUR 217
Pro-Cortistatin Antibody
10691-05011 150 ug
EUR 217
ELISA kit for Mouse CORT (Corticosterone)
E-EL-M0349 1 plate of 96 wells
EUR 534
  • Gentaur's CORT ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Mouse CORT. During the reaction, Mouse CORT in the sample or standard competes with a fixed amount of Mouse CORT on
  • Show more
Description: A competitive ELISA kit for quantitative measurement of Mouse CORT (Corticosterone) in samples from Serum, Plasma, Cell supernatant
ELISA kit for General Cort (Corticosterone)
ELK7957 1 plate of 96 wells
EUR 372
  • A monoclonal antibody specific to Corticosterone (Cort) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Corticosterone (Cort) and unlabeled Corticosterone (Cort) (Standards or samples) with
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Corticosterone from General in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Rat CORT (Corticosterone)
E-EL-R0269 1 plate of 96 wells
EUR 534
  • Gentaur's CORT ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Rat CORT. During the reaction, Rat CORT in the sample or standard competes with a fixed amount of Rat CORT on the s
  • Show more
Description: A competitive ELISA kit for quantitative measurement of Rat CORT (Corticosterone) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Chicken Corticosterone (CORT)
KTE30147-48T 48T
EUR 354
  • Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Chicken Corticosterone (CORT)
KTE30147-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Chicken Corticosterone (CORT)
KTE30147-96T 96T
EUR 572
  • Corticosterone (CORT), the major stress hormone produced in the cortex of the adrenal gland, plays a regulatory role in stress-induced HPA axis activity in rodents8. Chronically elevated CORT levels activate the chronic stress-response network, and a
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Corticosterone (CORT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Porcine corticosterone / corticosterone (CORT) ELISA Kit
QY-E40120 96T
EUR 400
CORT siRNA
20-abx901206
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CORT siRNA
20-abx912573
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CORT siRNA
20-abx912574
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CORT antibody
70R-9808 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CORT antibody
Cortistatin 14 (mouse, rat)
5-01000 4 x 1mg Ask for price
Human CORT shRNA Plasmid
20-abx950930
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CORT Recombinant Protein (Human)
RP038242 100 ug Ask for price
Wide-range General Corticosterone (Cort) ELISA Kit
WEA540Ge-10x96wellstestplate 10x96-wells test plate
EUR 5098.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
Wide-range General Corticosterone (Cort) ELISA Kit
WEA540Ge-1x48wellstestplate 1x48-wells test plate
EUR 507.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
Wide-range General Corticosterone (Cort) ELISA Kit
WEA540Ge-1x96wellstestplate 1x96-wells test plate
EUR 682.12
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
Wide-range General Corticosterone (Cort) ELISA Kit
WEA540Ge-5x96wellstestplate 5x96-wells test plate
EUR 2769.54
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Wide-range General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
Wide-range General Corticosterone (Cort) ELISA Kit
4-WEA540Ge
  • EUR 5149.00
  • EUR 2720.00
  • EUR 683.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Corticosterone elisa. Alternative names of the recognized antigen: Corticosrone
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Wide-range General Corticosterone (Cort) in samples from serum, plasma, urine and other biological fluids with no significant corss-reactivity with analogues from other species.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
General Corticosterone (Cort)CLIA Kit
CCA540Ge-10x96wellstestplate 10x96-wells test plate
EUR 5490.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
General Corticosterone (Cort)CLIA Kit
CCA540Ge-1x48wellstestplate 1x48-wells test plate
EUR 539.82
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
General Corticosterone (Cort)CLIA Kit
CCA540Ge-1x96wellstestplate 1x96-wells test plate
EUR 728.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
General Corticosterone (Cort)CLIA Kit
CCA540Ge-5x96wellstestplate 5x96-wells test plate
EUR 2977.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Corticosterone (Cort) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of General Corticosterone (Cort) in serum, plasma, urine and other biological fluids.
General Corticosterone (Cort) CLIA Kit
4-CCA540Ge
  • EUR 5541.00
  • EUR 2978.00
  • EUR 729.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Corticosterone Clia kit. Alternative names of the recognized antigen: Corticosrone
Description: Competitive Inhibition chemiluminescent immunoassay for detection of General Corticosterone (Cort)serum, plasma, urine and other biological fluids
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
CORT cloning plasmid
CSB-CL005821HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 468
  • Sequence: ATGTATAGACACAAAAACAGCTGGAGATTGGGCTTAAAATACCCACCAAGCTCCAAAGAAGAGACCCAAGTCCCCAAAACATTGATTTCAGGGCTGCCAGGAAGGAAGAGCAGCAGCAGGGTGGGAGAGAAGCTCCAGTCAGCCCACAAGATGCCATTGTCCCCCGGCCTCCTGCT
  • Show more
Description: A cloning plasmid for the CORT gene.
CORT Blocking Peptide
33R-6294 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CORT antibody, catalog no. 70R-9808
Cortistatin 29 Antibody (Biotin Conjugate)
10671-05021 150 ug
EUR 276
Pro-Cortistatin Antibody (Biotin Conjugate)
10691-05021 150 ug
EUR 276
CORT ORF Vector (Human) (pORF)
ORF012748 1.0 ug DNA
EUR 354
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
Rat CORT shRNA Plasmid
20-abx984909
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CORT shRNA Plasmid
20-abx969774
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
BSA Conjugated Corticosterone (Cort)
4-CPA540Ge11
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 346.5Da
  • Isoelectric Point: Inquire
Description: Recombinant Pan-species Corticosterone expressed in: Protein conjugation
OVA Conjugated Corticosterone (Cort)
4-CPA540Ge21
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 346.5Da
  • Isoelectric Point: Inquire
Description: Recombinant Pan-species Corticosterone expressed in: Protein conjugation
CORT Recombinant Protein (Rat)
RP195983 100 ug Ask for price
CORT Recombinant Protein (Mouse)
RP125591 100 ug Ask for price
CORT sgRNA CRISPR Lentivector set (Human)
K0492401 3 x 1.0 ug
EUR 339
Human Carnitine-O-Octanoyltransferase (CORT) Protein
20-abx168950
  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
APITD1-CORT ORF Vector (Human) (pORF)
ORF015676 1.0 ug DNA Ask for price
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
CORT sgRNA CRISPR Lentivector (Human) (Target 1)
K0492402 1.0 ug DNA
EUR 154
CORT sgRNA CRISPR Lentivector (Human) (Target 2)
K0492403 1.0 ug DNA
EUR 154
CORT sgRNA CRISPR Lentivector (Human) (Target 3)
K0492404 1.0 ug DNA
EUR 154
APITD1-CORT sgRNA CRISPR Lentivector set (Human)
K2746701 3 x 1.0 ug
EUR 339
Carnitine-O-Octanoyltransferase (CORT) Polyclonal Antibody (Human)
4-PAC406Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CORT (Lys410~Leu612)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnitine-O-Octanoyltransferase (CORT)
CORT Protein Vector (Human) (pPB-C-His)
PV050989 500 ng
EUR 481
CORT Protein Vector (Human) (pPB-N-His)
PV050990 500 ng
EUR 481
CORT Protein Vector (Human) (pPM-C-HA)
PV050991 500 ng
EUR 481
CORT Protein Vector (Human) (pPM-C-His)
PV050992 500 ng
EUR 481
Carnitine-O-Octanoyltransferase (CORT) Antibody
20-abx130909
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Carnitine-O-Octanoyltransferase (CORT) Antibody
20-abx130910
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Corticosterone (Cort) Polyclonal Antibody (General)
4-PAA540Ge01
  • EUR 228.00
  • EUR 2219.00
  • EUR 559.00
  • EUR 283.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Small Molecule, Cort conjugated to BSA.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against General Corticosterone (Cort)
Cort ORF Vector (Rat) (pORF)
ORF065329 1.0 ug DNA
EUR 506
Cort ORF Vector (Mouse) (pORF)
ORF041865 1.0 ug DNA
EUR 506
Recombinant Carnitine-O-Octanoyltransferase (CORT)
4-RPC406Hu01
  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UKG9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Carnitine-O-Octanoyltransferase expressed in: E.coli
Recombinant Carnitine-O-Octanoyltransferase (CORT)
4-RPC406Mu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9DC50
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Carnitine-O-Octanoyltransferase expressed in: E.coli
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428

Human CORT(Cortistatin) ELISA Kit