Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit

Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit

To Order Contact us below: 

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

RD-ANTXR2-Hu-48Tests 48 Tests
EUR 521

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

RD-ANTXR2-Hu-96Tests 96 Tests
EUR 723

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

RDR-ANTXR2-Hu-48Tests 48 Tests
EUR 544

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

RDR-ANTXR2-Hu-96Tests 96 Tests
EUR 756

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

E01A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

E01A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

E01A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ANTXR2/ Anthrax toxin receptor 2 ELISA Kit

E2878Hu 1 Kit
EUR 605

Human Anthrax toxin receptor 2, ANTXR2 ELISA KIT

ELI-34543h 96 Tests
EUR 824

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

20-abx150692
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Anthrax Toxin Receptor 2 (ANTXR2)ELISA Kit

201-12-2399 96 tests
EUR 440
  • This Anthrax Toxin Receptor 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

CSB-EL001833HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Anthrax toxin receptor 2 (ANTXR2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

1-CSB-EL001833HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Anthrax toxin receptor 2(ANTXR2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

QY-E01309 96T
EUR 361

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

SEF212Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

SEF212Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

SEF212Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

SEF212Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

4-SEF212Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anthrax Toxin Receptor 2 elisa. Alternative names of the recognized antigen: CMG-2
  • CMG2
  • ISH
  • JHF
  • Capillary Morphogenesis Protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody

20-abx130902
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody

20-abx111012
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody

20-abx171258
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody

20-abx006356
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody

20-abx322401
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody

abx430699-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody

abx230451-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Anthrax Toxin Receptor 2 (ANTXR2)

4-RPF212Hu01
  • EUR 341.92
  • EUR 194.00
  • EUR 1007.20
  • EUR 402.40
  • EUR 704.80
  • EUR 292.00
  • EUR 2368.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P58335
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Anthrax Toxin Receptor 2 expressed in: E.coli

Human Anthrax Toxin Receptor 2 (ANTXR2) Protein

20-abx650646
  • EUR 495.00
  • EUR 244.00
  • EUR 1372.00
  • EUR 565.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit

E06A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit

E06A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit

E06A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit

E02A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit

E02A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit

E02A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit

E03A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit

E03A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit

E03A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit

E04A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit

E04A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit

E04A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

E07A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

E07A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

E07A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit

E09A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit

E09A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit

E09A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit

E08A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit

E08A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit

E08A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

GA-E0832RT-48T 48T
EUR 317

Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

GA-E0832RT-96T 96T
EUR 496

Mouse Anthrax toxin receptor 2, Antxr2 ELISA KIT

ELI-49431m 96 Tests
EUR 865

Mouse Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

abx353181-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

QY-E10820 96T
EUR 361

Mouse Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

QY-E20108 96T
EUR 361

Human Anthrax Toxin Receptor 2 (ANTXR2) CLIA Kit

20-abx494819
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human ANTXR2 (Anthrax Toxin Receptor 2)

ELK3782 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Anthrax Toxin Receptor 2 (ANTXR2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Anthrax Toxin Receptor 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ANTXR2 Anthrax Toxin Receptor 2 MouseRecombinant Protein

PROTQ6DFX2 Regular: 5ug
EUR 317
Description: ANTXR2 produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 295 amino acids (32-318aa) and having a molecular mass of 31.9kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;ANTXR2 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

E05A1539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

E05A1539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

E05A1539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse ANTXR2 (Anthrax Toxin Receptor 2)

E-EL-M1296 1 plate of 96 wells
EUR 534
  • Gentaur's ANTXR2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ANTXR2. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ANTXR2 (Anthrax Toxin Receptor 2) in samples from Serum, Plasma, Cell supernatant

ANTXR2 Anthrax Toxin Receptor 2 Human Recombinant Protein

PROTP58335 Regular: 10ug
EUR 317
Description: ANTXR2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 307 amino acids (34-317) and having a molecular mass of 33 kDa.;ANTXR2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Antxr2 ELISA Kit| Mouse Anthrax toxin receptor 2 ELISA Kit

EF014213 96 Tests
EUR 689

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig)

4-PAF212Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2)

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), APC

4-PAF212Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with APC.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), Biotinylated

4-PAF212Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with Biotin.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), Cy3

4-PAF212Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with Cy3.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), FITC

4-PAF212Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with FITC.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), HRP

4-PAF212Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with HRP.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), PE

4-PAF212Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with PE.

Anthrax Toxin Receptor 2 Protein

20-abx262784
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7

4-PAF212Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with APC-Cy7.

Human Anthrax Toxin Receptor 1 ELISA kit

E01A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax Toxin Receptor 1 ELISA kit

E01A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax Toxin Receptor 1 ELISA kit

E04A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax Toxin Receptor 1 ELISA kit

E04A0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax Toxin Receptor 1 ELISA kit

E04A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax Toxin Receptor 1 ELISA kit

E06A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax Toxin Receptor 1 ELISA kit

E06A0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax Toxin Receptor 1 ELISA kit

E06A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax Toxin Receptor 1 ELISA kit

E02A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax Toxin Receptor 1 ELISA kit

E02A0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax Toxin Receptor 1 ELISA kit

E02A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax Toxin Receptor 1 ELISA kit

E03A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax Toxin Receptor 1 ELISA kit

E03A0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax Toxin Receptor 1 ELISA kit

E03A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax Toxin Receptor 1 ELISA kit

E08A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax Toxin Receptor 1 ELISA kit

E08A0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax Toxin Receptor 1 ELISA kit

E08A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax Toxin Receptor 1 ELISA kit

E09A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax Toxin Receptor 1 ELISA kit

E09A0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax Toxin Receptor 1 ELISA kit

E09A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax Toxin Receptor 1 ELISA kit

E07A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax Toxin Receptor 1 ELISA kit

E07A0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax Toxin Receptor 1 ELISA kit

E07A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor like(ANTXRL) ELISA kit

E01A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor like(ANTXRL) ELISA kit

E01A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor like(ANTXRL) ELISA kit

E01A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ANTXR1/ Anthrax toxin receptor 1 ELISA Kit

E2877Hu 1 Kit
EUR 605

Human ANTXR1(Anthrax toxin receptor 1) ELISA Kit

EH13997 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: anthrax toxin receptor 1/ANTXR1/ ATR/TEM8/Tumor endothelial marker 8
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Anthrax toxin receptor 1, ANTXR1 ELISA KIT

ELI-34945h 96 Tests
EUR 824

Human Anthrax toxin receptor- like, ANTXRL ELISA KIT

ELI-49252h 96 Tests
EUR 824

Human Anthrax Toxin Receptor 1 (ANTXR1) ELISA Kit

20-abx384589
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Anthrax Toxin Receptor 1 (ANTXR1)ELISA Kit

201-12-2401 96 tests
EUR 440
  • This Anthrax Toxin Receptor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human anthrax toxin receptor 1(ANTXR1) ELISA kit

CSB-EL001832HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human anthrax toxin receptor 1 (ANTXR1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human anthrax toxin receptor 1(ANTXR1) ELISA kit

1-CSB-EL001832HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human anthrax toxin receptor 1(ANTXR1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

QY-E01310 96T
EUR 361

Human Anthrax toxin receptor 1 (ANTXR1)

1-CSB-YP001832HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Anthrax toxin receptor 1(ANTXR1),partial expressed in Yeast

Goat Anthrax toxin receptor like(ANTXRL) ELISA kit

E06A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax toxin receptor like(ANTXRL) ELISA kit

E06A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax toxin receptor like(ANTXRL) ELISA kit

E06A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor like(ANTXRL) ELISA kit

E02A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor like(ANTXRL) ELISA kit

E02A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor like(ANTXRL) ELISA kit

E02A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit

E03A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit

E03A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit

E03A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit

E04A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit

E04A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit

E04A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax Toxin Receptor 1 ELISA kit

E05A0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax Toxin Receptor 1 ELISA kit

E05A0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax Toxin Receptor 1 ELISA kit

E05A0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor like(ANTXRL) ELISA kit

E07A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor like(ANTXRL) ELISA kit

E07A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor like(ANTXRL) ELISA kit

E07A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit

E09A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit

E09A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit

E09A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor like(ANTXRL) ELISA kit

E08A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor like(ANTXRL) ELISA kit

E08A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor like(ANTXRL) ELISA kit

E08A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor- like, Antxrl ELISA KIT

ELI-11530m 96 Tests
EUR 865

Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

GA-E0831RT-48T 48T
EUR 317

Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

GA-E0831RT-96T 96T
EUR 496

Mouse Anthrax toxin receptor 1, Antxr1 ELISA KIT

ELI-49251m 96 Tests
EUR 865

Mouse Anthrax toxin receptor 1 (ANTXR1) ELISA Kit

abx388587-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Anthrax toxin receptor 1 (ANTXR1) ELISA Kit

abx390976-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

QY-E10821 96T
EUR 361

Mouse Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

QY-E20107 96T
EUR 361

Anthrax Toxin Receptor 1 (ANTXR1) Antibody

20-abx126826
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody

20-abx111011
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody

abx036391-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody

abx033658-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody

abx033658-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody

20-abx005005
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody

20-abx320127
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anthrax toxin receptor 1 (ANTXR1) Antibody

20-abx214246
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anthrax toxin receptor 1 (ANTXR1) Antibody

20-abx241731
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Anthrax toxin receptor 1 (Antxr1)

1-CSB-YP001832MO
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in Yeast

Mouse Anthrax toxin receptor 1 (Antxr1)

1-CSB-MP001832MO
  • EUR 319.00
  • EUR 1081.00
  • EUR 451.00
  • EUR 801.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 36.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in Mammalian cell

Mouse Anthrax toxin receptor 1 (Antxr1)

1-CSB-EP001832MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in E.coli

Antxr1 ELISA Kit| Rat Anthrax toxin receptor 1 ELISA Kit

EF018329 96 Tests
EUR 689

Antxr1 ELISA Kit| Mouse Anthrax toxin receptor 1 ELISA Kit

EF014212 96 Tests
EUR 689

Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit

E05A1540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit

E05A1540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit

E05A1540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor 1 protein Control/blocking peptide # 2

ATR12-P 100 ug
EUR 164

Anti-TEM8 / Anthrax Toxin Receptor 1 antibody

STJ70589 100 µg
EUR 359

Rabbit Anti-human Anthrax Toxin Receptor 1 (ATR1), aff pure IgG # 2

ATR12-A 100 ug
EUR 482

Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)

CA34-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)

CA34-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)

CA34-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)

CA34-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Human Anthrax toxin receptor (ATR1) protein Control/blocking peptide # 1

ATR11-P 100 ug
EUR 164

Human Anthrax toxin receptor 3 protein Control/blocking peptide # 1

ATR31-P 100 ug
EUR 164

Polyclonal Goat Anti-TEM8 / Anthrax Toxin Receptor 1 Antibody

AMM05379G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TEM8 / Anthrax Toxin Receptor 1 . This antibody is tested and proven to work in the following applications:

Rabbit Anti-human Anthrax Toxin Receptor 3, aff pure IgG #1

ATR31-A 100 ug
EUR 482

ANTXR2 ELISA KIT|Human

EF007798 96 Tests
EUR 689

Purified Recombinant Anthrax toxin Edema Factor protein

EF25-R 50 ug
EUR 712

Rabbit Anti-human Anthrax Toxin Receptor 1 (ATR1), aff pure IgG # 1

ATR11-A 100 ug
EUR 482

Human ANTXR2 PicoKine ELISA Kit

EK2108 96 wells
EUR 425
Description: For quantitative detection of human ANTXR2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

T-2 Toxin ELISA Kit

E4748-100
EUR 620

T-2 Toxin ELISA kit

55R-2237 1 kit
EUR 739
Description: T-2 Toxin ELISA kit for use in research laboratory

Tumor Endothelial Marker 8 (TEM8) / Anthrax Toxin Receptor 1; Clone TEM8/589 (Concentrate)

RA0365-C.1 0.1 ml
EUR 125

Tumor Endothelial Marker 8 (TEM8) / Anthrax Toxin Receptor 1; Clone TEM8/589 (Concentrate)

RA0365-C.5 0.5 ml
EUR 300

T-2 Toxin (T2) ELISA Kit

abx364879-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ANTXR2, human recombinant

P1042-10
EUR 164

ANTXR2, human recombinant

P1042-50
EUR 588

RealScreen Anthrax IgG ELISA Kit

EL001-096 96T
EUR 1144

Mouse Monoclonal anti-Clostridium difficile toxin A IgG (Clone #2)

CDTA12-M-2 100 ug
EUR 482

Mouse Monoclonal anti-Clostridium difficile toxin B IgG (Clone #2)

CDTB12-M-2 100 ug
EUR 482

ANTXR2 siRNA

20-abx907655
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ANTXR2 siRNA

20-abx907656
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Antxr2 antibody

70R-8864 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Antxr2 antibody

ANTXR2 antibody

70R-15731 50 ul
EUR 435
Description: Rabbit polyclonal ANTXR2 antibody

ANTXR2 Antibody

1-CSB-PA001833ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ANTXR2. Recognizes ANTXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ANTXR2 Antibody

1-CSB-PA001833GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ANTXR2. Recognizes ANTXR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

anti-ANTXR2

YF-PA22017 50 ul
EUR 363
Description: Mouse polyclonal to ANTXR2

anti-ANTXR2

YF-PA22018 50 ug
EUR 363
Description: Mouse polyclonal to ANTXR2

T-2 and HT-2 Toxin ELISA Kit

abx157113-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Purified Recombinant Anthrax toxin Edema Factor (EF) protein control for WB

EF12-C 100 ul
EUR 286

T-2 Toxin

AG057 1 mg
EUR 438

T-2 Toxin

AT057 1mg
EUR 1114

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ANTXR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0096803 1.0 ug DNA
EUR 154

Human ANTXR2 shRNA Plasmid

20-abx964580
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ANTXR2 Recombinant Protein (Human)

RP001336 100 ug Ask for price

Human Pertussiu Toxin(PT)ELISA Kit

GA-E1816HM-48T 48T
EUR 289

Human Pertussiu Toxin(PT)ELISA Kit

GA-E1816HM-96T 96T
EUR 466

Human Pertussis Toxin (PT) ELISA Kit

abx052424-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Human Pertussiu Toxin,PT ELISA Kit

201-12-1800 96 tests
EUR 440
  • This Pertussiu Toxin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Pertussiu Toxin(PT)ELISA Kit

QY-E04230 96T
EUR 361

Anti-VEGF Receptor 2/KDR Antibody

A00901-2 100ug/vial
EUR 334

Anti-Adiponectin Receptor 2 (mouse) Antibody

A02218-2 200ug
EUR 498
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.

RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9

PROTQ99969-2 Regular: 5ug
EUR 317
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

anti- ANTXR2 antibody

FNab00451 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: anthrax toxin receptor 2
  • Uniprot ID: P58335
  • Gene ID: 118429
  • Research Area: Immunology
Description: Antibody raised against ANTXR2

ANTXR2 Rabbit pAb

A6526-100ul 100 ul
EUR 308

ANTXR2 Rabbit pAb

A6526-200ul 200 ul
EUR 459

ANTXR2 Rabbit pAb

A6526-20ul 20 ul
EUR 183

ANTXR2 Rabbit pAb

A6526-50ul 50 ul
EUR 223

Antxr2 Blocking Peptide

33R-3429 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Antxr2 antibody, catalog no. 70R-8864

ANTXR2 Polyclonal Antibody

30720-100ul 100ul
EUR 252

ANTXR2 Polyclonal Antibody

30720-50ul 50ul
EUR 187

ANTXR2 cloning plasmid

CSB-CL001833HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atgtggtggttttggcccctttgctgcaaagtggttattaaggatcctccaccaccacccccccctgcaccaaaagaggaggaagaagaacctttgcctactaaaaagtggccaactgtggatgcttcctattatggtggtcgaggggttggaggaattaaaagaatggaggttcg
  • Show more
Description: A cloning plasmid for the ANTXR2 gene.

ANTXR2, mouse recombinant

P1043-10
EUR 316

Anti-ANTXR2 antibody

PAab00451 100 ug
EUR 355

Anti-ANTXR2 antibody

STJ28609 100 µl
EUR 277
Description: This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene.

TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein

PROTP20333-2 Regular: 20ug
EUR 317
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.

Human Multidrug and toxin extrusion protein 2, SLC47A2 ELISA KIT

ELI-53017h 96 Tests
EUR 824

T-2 Toxin [HRP]

DAGA-013H 1mg
EUR 1105

T-2 Toxin [KLH]

DAGA-015K 1mg
EUR 1014

T-2 Toxin [BSA]

DAGHZ07 1mg
EUR 780

T-2 Toxin Standard

SD012 0.5ug/mL
EUR 607

HT-2 Toxin Standard

SD014 0.5ug/mL
EUR 607

ANTXR2 ORF Vector (Human) (pORF)

ORF000446 1.0 ug DNA
EUR 95

Antxr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3356203 1.0 ug DNA
EUR 154

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Ras-Related C3 Botulinum Toxin Substrate 2 (RAC2) ELISA Kit

abx382652-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Anthrax LF Antibody

20-abx137198
  • EUR 1177.00
  • EUR 1887.00
  • 200 ul
  • 400 ul
  • Shipped within 5-10 working days.

Anthrax LF Antibody

abx137198-600l 600 µl
EUR 2221
  • Shipped within 5-10 working days.

Anthrax protective Antigen

30R-AA014 100 ug
EUR 970
Description: Purified recombinant Bacillus Anthrax protective Antigen

Anthrax PA Antibody

24269-100ul 100ul
EUR 390

E. coli Shiga toxin 2 PCR kit

PCR-VH108-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of E. coli Shiga toxin 2

E. coli Shiga toxin 2 PCR kit

PCR-VH108-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of E. coli Shiga toxin 2

Recombinant Human TWEAK Receptor Protein

PROTQ9NP84-2 25ug
EUR 317
Description: TWEAKR belongs to the TNF family of transmembrane proteins and contains a cytoplasmic "death domain", which can activated the cell's apoptotic machinery. It is expressed in the spleen, thymus, peripheral blood lymphocytes, colon, and small intestine. Signal transduction by TWEAKR can be activated by either the membrane anchored or the soluble TWEAK. Recombinant soluble TWEAKR is a 53 amino acid polypeptide (5.6 kDa) comprising the entire extracellular domain of the full length TWEAKR protein.

Recombinant Human sRANK Receptor Protein

PROTQ9Y6Q6-2 100ug
EUR 317
Description: RANKL and RANK are members of the TNF superfamily of ligands and receptors that play an important role in the regulation of specific immunity and bone turnover. RANK (receptor) was originally identified as a dendritic-cell-membrane protein, which by interacting with RANKL augments the ability of dendritic cells to stimulate naïve T cell proliferation and to promote the survival of RANK + T cells. RANK is also expressed in a variety of tissues including skeletal muscle, thymus, liver, colon, small intestine and adrenal gland. The RANK/RANKL interaction is important in the regulation of osteoclastogenesis and in dendritic-cell-mediated T cell immune responses. Impairments in RANK signaling have been implicated in the induction of expansile osteolysis and Paget disease of bone (PDB2). Recombinant human sRANK receptor is a 19.3 kDa polypeptide containing the TNFR homologous cysteine rich portion of the extracellular domain of RANK receptor (175 amino acid residues).

Recombinant Human sFas Receptor Protein

PROTP25445-2 20ug
EUR 317
Description: Fas and Fas Ligand (FasL) belong to the TNF superfamily and are type I and type II transmembrane proteins, respectively. Binding of FasL to Fas triggers apoptosis in Fas-bearing cells. The mechanism of apoptosis involves recruitment of pro-caspase 8 through an adaptor molecule called FADD followed by processing of the pro-enzyme to active forms. These active caspases then cleave various cellular substrates leading to the eventual cell death. sFasR is capable of inhibiting FasL-induced apoptosis by acting as a decoy receptor that serves as a sink for FasL. The full length Fas (receptor) is a 319 amino acid type I transmembrane protein, which contains a 157 amino acid extracellular domain, a 17 amino acid transmembrane domain, and 145 amino acid cytoplasmic domain. Recombinant human soluble Fas (sFas Receptor) is a 157 amino acid polypeptide (17.6 kDa) corresponding to the TNFR homologous cysteine rich extracellular domain Fas.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit