Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit

Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit

To Order Contact us below: 

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    RD-ANTXR2-Hu-48Tests 48 Tests
    EUR 521

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    RD-ANTXR2-Hu-96Tests 96 Tests
    EUR 723

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    RDR-ANTXR2-Hu-48Tests 48 Tests
    EUR 544

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    RDR-ANTXR2-Hu-96Tests 96 Tests
    EUR 756

    Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E01A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E01A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E01A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human ANTXR2/ Anthrax toxin receptor 2 ELISA Kit

    E2878Hu 1 Kit
    EUR 605

    Human Anthrax toxin receptor 2, ANTXR2 ELISA KIT

    ELI-34543h 96 Tests
    EUR 824

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    20-abx150692
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Anthrax Toxin Receptor 2 (ANTXR2)ELISA Kit

    201-12-2399 96 tests
    EUR 440
    • This Anthrax Toxin Receptor 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

    CSB-EL001833HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Anthrax toxin receptor 2 (ANTXR2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Anthrax toxin receptor 2(ANTXR2) ELISA kit

    1-CSB-EL001833HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Anthrax toxin receptor 2(ANTXR2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

    QY-E01309 96T
    EUR 361

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    SEF212Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    SEF212Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    SEF212Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    SEF212Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

    Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    4-SEF212Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Anthrax Toxin Receptor 2 elisa. Alternative names of the recognized antigen: CMG-2
    • CMG2
    • ISH
    • JHF
    • Capillary Morphogenesis Protein 2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Anthrax Toxin Receptor 2 (ANTXR2) Antibody

    20-abx130902
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Anthrax Toxin Receptor 2 (ANTXR2) Antibody

    20-abx111012
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 2 (ANTXR2) Antibody

    20-abx171258
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Anthrax Toxin Receptor 2 (ANTXR2) Antibody

    20-abx006356
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 2 (ANTXR2) Antibody

    20-abx322401
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 2 (ANTXR2) Antibody

    abx430699-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Anthrax Toxin Receptor 2 (ANTXR2) Antibody

    abx230451-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Recombinant Anthrax Toxin Receptor 2 (ANTXR2)

    4-RPF212Hu01
    • EUR 341.92
    • EUR 194.00
    • EUR 1007.20
    • EUR 402.40
    • EUR 704.80
    • EUR 292.00
    • EUR 2368.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P58335
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 34.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Anthrax Toxin Receptor 2 expressed in: E.coli

    Human Anthrax Toxin Receptor 2 (ANTXR2) Protein

    20-abx650646
    • EUR 495.00
    • EUR 244.00
    • EUR 1372.00
    • EUR 565.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E06A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E06A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E06A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E02A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E02A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E02A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E03A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E03A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E03A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E04A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E04A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E04A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E07A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E07A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E07A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E09A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E09A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E09A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E08A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E08A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E08A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

    GA-E0832RT-48T 48T
    EUR 317

    Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

    GA-E0832RT-96T 96T
    EUR 496

    Mouse Anthrax toxin receptor 2, Antxr2 ELISA KIT

    ELI-49431m 96 Tests
    EUR 865

    Mouse Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit

    abx353181-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

    QY-E10820 96T
    EUR 361

    Mouse Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit

    QY-E20108 96T
    EUR 361

    Human Anthrax Toxin Receptor 2 (ANTXR2) CLIA Kit

    20-abx494819
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human ANTXR2 (Anthrax Toxin Receptor 2)

    ELK3782 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Anthrax Toxin Receptor 2 (ANTXR2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
    • Show more
    Description: A sandwich ELISA kit for detection of Anthrax Toxin Receptor 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ANTXR2 Anthrax Toxin Receptor 2 MouseRecombinant Protein

    PROTQ6DFX2 Regular: 5ug
    EUR 317
    Description: ANTXR2 produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 295 amino acids (32-318aa) and having a molecular mass of 31.9kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;ANTXR2 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

    Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E05A1539-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E05A1539-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit

    E05A1539-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Mouse ANTXR2 (Anthrax Toxin Receptor 2)

    E-EL-M1296 1 plate of 96 wells
    EUR 534
    • Gentaur's ANTXR2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ANTXR2. Standards or samples are added to the micro ELISA plate wells and combined wit
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Mouse ANTXR2 (Anthrax Toxin Receptor 2) in samples from Serum, Plasma, Cell supernatant

    ANTXR2 Anthrax Toxin Receptor 2 Human Recombinant Protein

    PROTP58335 Regular: 10ug
    EUR 317
    Description: ANTXR2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 307 amino acids (34-317) and having a molecular mass of 33 kDa.;ANTXR2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    Antxr2 ELISA Kit| Mouse Anthrax toxin receptor 2 ELISA Kit

    EF014213 96 Tests
    EUR 689

    Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig)

    4-PAF212Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2)

    Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), APC

    4-PAF212Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with APC.

    Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), Biotinylated

    4-PAF212Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with Biotin.

    Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), Cy3

    4-PAF212Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with Cy3.

    Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), FITC

    4-PAF212Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with FITC.

    Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), HRP

    4-PAF212Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with HRP.

    Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), PE

    4-PAF212Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with PE.

    Anthrax Toxin Receptor 2 Protein

    20-abx262784
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7

    4-PAF212Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ANTXR2 (Gln34~Gly318)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with APC-Cy7.

    Human Anthrax Toxin Receptor 1 ELISA kit

    E01A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Anthrax Toxin Receptor 1 ELISA kit

    E01A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax Toxin Receptor 1 ELISA kit

    E04A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax Toxin Receptor 1 ELISA kit

    E04A0080-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax Toxin Receptor 1 ELISA kit

    E04A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Anthrax Toxin Receptor 1 ELISA kit

    E06A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Anthrax Toxin Receptor 1 ELISA kit

    E06A0080-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Anthrax Toxin Receptor 1 ELISA kit

    E06A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax Toxin Receptor 1 ELISA kit

    E02A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax Toxin Receptor 1 ELISA kit

    E02A0080-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax Toxin Receptor 1 ELISA kit

    E02A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax Toxin Receptor 1 ELISA kit

    E03A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax Toxin Receptor 1 ELISA kit

    E03A0080-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax Toxin Receptor 1 ELISA kit

    E03A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax Toxin Receptor 1 ELISA kit

    E08A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax Toxin Receptor 1 ELISA kit

    E08A0080-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax Toxin Receptor 1 ELISA kit

    E08A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax Toxin Receptor 1 ELISA kit

    E09A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax Toxin Receptor 1 ELISA kit

    E09A0080-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax Toxin Receptor 1 ELISA kit

    E09A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax Toxin Receptor 1 ELISA kit

    E07A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax Toxin Receptor 1 ELISA kit

    E07A0080-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax Toxin Receptor 1 ELISA kit

    E07A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Anthrax toxin receptor like(ANTXRL) ELISA kit

    E01A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Anthrax toxin receptor like(ANTXRL) ELISA kit

    E01A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Anthrax toxin receptor like(ANTXRL) ELISA kit

    E01A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human ANTXR1/ Anthrax toxin receptor 1 ELISA Kit

    E2877Hu 1 Kit
    EUR 605

    Human ANTXR1(Anthrax toxin receptor 1) ELISA Kit

    EH13997 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Alias: anthrax toxin receptor 1/ANTXR1/ ATR/TEM8/Tumor endothelial marker 8
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Anthrax toxin receptor 1, ANTXR1 ELISA KIT

    ELI-34945h 96 Tests
    EUR 824

    Human Anthrax toxin receptor- like, ANTXRL ELISA KIT

    ELI-49252h 96 Tests
    EUR 824

    Human Anthrax Toxin Receptor 1 (ANTXR1) ELISA Kit

    20-abx384589
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human Anthrax Toxin Receptor 1 (ANTXR1)ELISA Kit

    201-12-2401 96 tests
    EUR 440
    • This Anthrax Toxin Receptor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human anthrax toxin receptor 1(ANTXR1) ELISA kit

    CSB-EL001832HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human anthrax toxin receptor 1 (ANTXR1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human anthrax toxin receptor 1(ANTXR1) ELISA kit

    1-CSB-EL001832HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human anthrax toxin receptor 1(ANTXR1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

    QY-E01310 96T
    EUR 361

    Human Anthrax toxin receptor 1 (ANTXR1)

    1-CSB-YP001832HU
    • EUR 430.00
    • EUR 234.00
    • EUR 1508.00
    • EUR 642.00
    • EUR 1009.00
    • EUR 291.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 34.4 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Anthrax toxin receptor 1(ANTXR1),partial expressed in Yeast

    Goat Anthrax toxin receptor like(ANTXRL) ELISA kit

    E06A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Anthrax toxin receptor like(ANTXRL) ELISA kit

    E06A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Anthrax toxin receptor like(ANTXRL) ELISA kit

    E06A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax toxin receptor like(ANTXRL) ELISA kit

    E02A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax toxin receptor like(ANTXRL) ELISA kit

    E02A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Anthrax toxin receptor like(ANTXRL) ELISA kit

    E02A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit

    E03A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit

    E03A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit

    E03A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit

    E04A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit

    E04A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit

    E04A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Anthrax Toxin Receptor 1 ELISA kit

    E05A0080-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Anthrax Toxin Receptor 1 ELISA kit

    E05A0080-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Anthrax Toxin Receptor 1 ELISA kit

    E05A0080-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax toxin receptor like(ANTXRL) ELISA kit

    E07A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax toxin receptor like(ANTXRL) ELISA kit

    E07A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Anthrax toxin receptor like(ANTXRL) ELISA kit

    E07A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit

    E09A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit

    E09A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit

    E09A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax toxin receptor like(ANTXRL) ELISA kit

    E08A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax toxin receptor like(ANTXRL) ELISA kit

    E08A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Anthrax toxin receptor like(ANTXRL) ELISA kit

    E08A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Anthrax toxin receptor- like, Antxrl ELISA KIT

    ELI-11530m 96 Tests
    EUR 865

    Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

    GA-E0831RT-48T 48T
    EUR 317

    Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

    GA-E0831RT-96T 96T
    EUR 496

    Mouse Anthrax toxin receptor 1, Antxr1 ELISA KIT

    ELI-49251m 96 Tests
    EUR 865

    Mouse Anthrax toxin receptor 1 (ANTXR1) ELISA Kit

    abx388587-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Anthrax toxin receptor 1 (ANTXR1) ELISA Kit

    abx390976-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

    QY-E10821 96T
    EUR 361

    Mouse Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit

    QY-E20107 96T
    EUR 361

    Anthrax Toxin Receptor 1 (ANTXR1) Antibody

    20-abx126826
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 1 (ANTXR1) Antibody

    20-abx111011
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 1 (ANTXR1) Antibody

    abx036391-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 1 (ANTXR1) Antibody

    abx033658-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 1 (ANTXR1) Antibody

    abx033658-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 1 (ANTXR1) Antibody

    20-abx005005
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anthrax Toxin Receptor 1 (ANTXR1) Antibody

    20-abx320127
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anthrax toxin receptor 1 (ANTXR1) Antibody

    20-abx214246
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anthrax toxin receptor 1 (ANTXR1) Antibody

    20-abx241731
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Mouse Anthrax toxin receptor 1 (Antxr1)

    1-CSB-YP001832MO
    • EUR 586.00
    • EUR 299.00
    • EUR 2172.00
    • EUR 900.00
    • EUR 1442.00
    • EUR 382.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 34.3 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in Yeast

    Mouse Anthrax toxin receptor 1 (Antxr1)

    1-CSB-MP001832MO
    • EUR 319.00
    • EUR 1081.00
    • EUR 451.00
    • EUR 801.00
    • 100ug
    • 1MG
    • 200ug
    • 500ug
    • MW: 36.3 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in Mammalian cell

    Mouse Anthrax toxin receptor 1 (Antxr1)

    1-CSB-EP001832MO
    • EUR 505.00
    • EUR 265.00
    • EUR 1827.00
    • EUR 766.00
    • EUR 1218.00
    • EUR 335.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 36.3 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in E.coli

    Antxr1 ELISA Kit| Rat Anthrax toxin receptor 1 ELISA Kit

    EF018329 96 Tests
    EUR 689

    Antxr1 ELISA Kit| Mouse Anthrax toxin receptor 1 ELISA Kit

    EF014212 96 Tests
    EUR 689

    Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit

    E05A1540-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit

    E05A1540-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit

    E05A1540-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Anthrax toxin receptor 1 protein Control/blocking peptide # 2

    ATR12-P 100 ug
    EUR 164

    Anti-TEM8 / Anthrax Toxin Receptor 1 antibody

    STJ70589 100 µg
    EUR 359

    Rabbit Anti-human Anthrax Toxin Receptor 1 (ATR1), aff pure IgG # 2

    ATR12-A 100 ug
    EUR 482

    Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)

    CA34-10ug 10ug
    EUR 156
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)

    CA34-1mg 1mg
    EUR 2283
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)

    CA34-500ug 500ug
    EUR 1613
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)

    CA34-50ug 50ug
    EUR 369
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Human Anthrax toxin receptor (ATR1) protein Control/blocking peptide # 1

    ATR11-P 100 ug
    EUR 164

    Human Anthrax toxin receptor 3 protein Control/blocking peptide # 1

    ATR31-P 100 ug
    EUR 164

    Polyclonal Goat Anti-TEM8 / Anthrax Toxin Receptor 1 Antibody

    AMM05379G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TEM8 / Anthrax Toxin Receptor 1 . This antibody is tested and proven to work in the following applications:

    Rabbit Anti-human Anthrax Toxin Receptor 3, aff pure IgG #1

    ATR31-A 100 ug
    EUR 482

    ANTXR2 ELISA KIT|Human

    EF007798 96 Tests
    EUR 689

    Purified Recombinant Anthrax toxin Edema Factor protein

    EF25-R 50 ug
    EUR 712

    Rabbit Anti-human Anthrax Toxin Receptor 1 (ATR1), aff pure IgG # 1

    ATR11-A 100 ug
    EUR 482

    Human ANTXR2 PicoKine ELISA Kit

    EK2108 96 wells
    EUR 425
    Description: For quantitative detection of human ANTXR2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

    ANTXR2 ELISA Kit (Human) (OKCD00961)

    OKCD00961 96 Wells
    EUR 831
    Description: Description of target: Necessary for cellular interactions with laminin and the extracellular matrix.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Differential gene expression during capillary morphogenesis in 3D collagen matrices: regulated expression of genes involved in basement membrane matrix assembly, cell cycle progression, cellular differentiation and G-protein signaling."_x005F_x005F_x000D_Bell S.E., Mavila A., Salazar R., Bayless K.J., Kanagala S., Maxwell S.A., Davis G.E._x005F_x005F_x000D_J. Cell Sci. 114:2755-2773(2001) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 2), FUNCTION, VARIANT PRO-357.Ref.15"Mutations in capillary morphogenesis gene-2 result in the allelic disorders juvenile hyaline fibromatosis and infantile systemic hyalinosis."_x005F_x005F_x000D_Dowling O., Difeo A., Ramirez M.C., Tukel T., Narla G., Bonafe L., Kayserili H., Yuksel-Apak M., Paller A.S., Norton K., Teebi A.S., Grum-Tokars V., Martin G.S., Davis G.E., Glucksman M.J., Martignetti J.A._x005F_x005F_x000D_Am. J. Hum. Genet. 73:957-966(2003) [PubMed] [Europe PMC] [Abstract]Cited for: VARIANTS HFS ASP-105; THR-189 AND ARG-329, FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.119 ng/mL

    ANTXR2 ELISA Kit (Human) (OKBB01474)

    OKBB01474 96 Wells
    EUR 505
    Description: Description of target: Anthrax toxin receptor 2 is a protein that in humans is encoded by the ANTXR2 gene. It is mapped to 4q21.21. This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

    ANTXR2 ELISA Kit (Human) (OKEH07748)

    OKEH07748 96 Wells
    EUR 896
    Description: Description of target: This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.153ng/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    T-2 Toxin ELISA Kit

    E4748-100
    EUR 620

    T-2 Toxin ELISA kit

    55R-2237 1 kit
    EUR 739
    Description: T-2 Toxin ELISA kit for use in research laboratory

    Tumor Endothelial Marker 8 (TEM8) / Anthrax Toxin Receptor 1; Clone TEM8/589 (Concentrate)

    RA0365-C.1 0.1 ml
    EUR 125

    Tumor Endothelial Marker 8 (TEM8) / Anthrax Toxin Receptor 1; Clone TEM8/589 (Concentrate)

    RA0365-C.5 0.5 ml
    EUR 300

    ANTXR2 ELISA Kit (Mouse) (OKEI00581)

    OKEI00581 96 Wells
    EUR 767
    Description: Description of target: Necessary for cellular interactions with laminin and the extracellular matrix.By similarity ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

    ANTXR2, human recombinant

    P1042-10
    EUR 164

    ANTXR2, human recombinant

    P1042-50
    EUR 588

    T-2 Toxin (T2) ELISA Kit

    abx364879-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    RealScreen Anthrax IgG ELISA Kit

    EL001-096 96T
    EUR 1144

    Mouse Monoclonal anti-Clostridium difficile toxin A IgG (Clone #2)

    CDTA12-M-2 100 ug
    EUR 482

    Mouse Monoclonal anti-Clostridium difficile toxin B IgG (Clone #2)

    CDTB12-M-2 100 ug
    EUR 482

    ANTXR2 siRNA

    20-abx907655
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ANTXR2 siRNA

    20-abx907656
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Antxr2 antibody

    70R-8864 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal Antxr2 antibody

    ANTXR2 antibody

    70R-15731 50 ul
    EUR 435
    Description: Rabbit polyclonal ANTXR2 antibody

    ANTXR2 Antibody

    1-CSB-PA001833ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against ANTXR2. Recognizes ANTXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

    ANTXR2 Antibody

    1-CSB-PA001833GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against ANTXR2. Recognizes ANTXR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

    anti-ANTXR2

    YF-PA22017 50 ul
    EUR 363
    Description: Mouse polyclonal to ANTXR2

    anti-ANTXR2

    YF-PA22018 50 ug
    EUR 363
    Description: Mouse polyclonal to ANTXR2

    T-2 and HT-2 Toxin ELISA Kit

    abx157113-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.

    Purified Recombinant Anthrax toxin Edema Factor (EF) protein control for WB

    EF12-C 100 ul
    EUR 286

    T-2 Toxin

    AG057 1 mg
    EUR 438

    T-2 Toxin

    AT057 1mg
    EUR 1114

    AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    ANTXR2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0096803 1.0 ug DNA
    EUR 154

    Human ANTXR2 shRNA Plasmid

    20-abx964580
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    ANTXR2 Recombinant Protein (Human)

    RP001336 100 ug Ask for price

    Human Pertussiu Toxin(PT)ELISA Kit

    GA-E1816HM-48T 48T
    EUR 289

    Human Pertussiu Toxin(PT)ELISA Kit

    GA-E1816HM-96T 96T
    EUR 466

    Human Pertussis Toxin (PT) ELISA Kit

    abx052424-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.

    Human Pertussiu Toxin,PT ELISA Kit

    201-12-1800 96 tests
    EUR 440
    • This Pertussiu Toxin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Pertussiu Toxin(PT)ELISA Kit

    QY-E04230 96T
    EUR 361

    Anti-VEGF Receptor 2/KDR Antibody

    A00901-2 100ug/vial
    EUR 334

    Anti-Adiponectin Receptor 2 (mouse) Antibody

    A02218-2 200ug
    EUR 498
    Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.

    RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9

    PROTQ99969-2 Regular: 5ug
    EUR 317
    Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

    anti- ANTXR2 antibody

    FNab00451 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: anthrax toxin receptor 2
    • Uniprot ID: P58335
    • Gene ID: 118429
    • Research Area: Immunology
    Description: Antibody raised against ANTXR2

    ANTXR2 Rabbit pAb

    A6526-100ul 100 ul
    EUR 308

    ANTXR2 Rabbit pAb

    A6526-200ul 200 ul
    EUR 459

    ANTXR2 Rabbit pAb

    A6526-20ul 20 ul
    EUR 183

    ANTXR2 Rabbit pAb

    A6526-50ul 50 ul
    EUR 223

    Antxr2 Blocking Peptide

    33R-3429 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Antxr2 antibody, catalog no. 70R-8864

    ANTXR2 Polyclonal Antibody

    30720-100ul 100ul
    EUR 252

    ANTXR2 Polyclonal Antibody

    30720-50ul 50ul
    EUR 187

    ANTXR2 cloning plasmid

    CSB-CL001833HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 459
    • Sequence: atgtggtggttttggcccctttgctgcaaagtggttattaaggatcctccaccaccacccccccctgcaccaaaagaggaggaagaagaacctttgcctactaaaaagtggccaactgtggatgcttcctattatggtggtcgaggggttggaggaattaaaagaatggaggttcg
    • Show more
    Description: A cloning plasmid for the ANTXR2 gene.

    ANTXR2, mouse recombinant

    P1043-10
    EUR 316

    Anti-ANTXR2 antibody

    PAab00451 100 ug
    EUR 355

    Anti-ANTXR2 antibody

    STJ28609 100 µl
    EUR 277
    Description: This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene.

    TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein

    PROTP20333-2 Regular: 20ug
    EUR 317
    Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.

    Human Multidrug and toxin extrusion protein 2, SLC47A2 ELISA KIT

    ELI-53017h 96 Tests
    EUR 824

    T-2 Toxin [HRP]

    DAGA-013H 1mg
    EUR 1105

    T-2 Toxin [KLH]

    DAGA-015K 1mg
    EUR 1014

    T-2 Toxin [BSA]

    DAGHZ07 1mg
    EUR 780

    T-2 Toxin Standard

    SD012 0.5ug/mL
    EUR 607

    HT-2 Toxin Standard

    SD014 0.5ug/mL
    EUR 607

    ANTXR2 ORF Vector (Human) (pORF)

    ORF000446 1.0 ug DNA
    EUR 95

    Antxr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3356203 1.0 ug DNA
    EUR 154

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    Human Ras-Related C3 Botulinum Toxin Substrate 2 (RAC2) ELISA Kit

    abx382652-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Anthrax LF Antibody

    20-abx137198
    • EUR 1177.00
    • EUR 1887.00
    • 200 ul
    • 400 ul
    • Shipped within 5-10 working days.

    Anthrax LF Antibody

    abx137198-600l 600 µl
    EUR 2221
    • Shipped within 5-10 working days.

    Anthrax protective Antigen

    30R-AA014 100 ug
    EUR 970
    Description: Purified recombinant Bacillus Anthrax protective Antigen

    Anthrax PA Antibody

    24269-100ul 100ul
    EUR 390

    E. coli Shiga toxin 2 PCR kit

    PCR-VH108-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of E. coli Shiga toxin 2

    E. coli Shiga toxin 2 PCR kit

    PCR-VH108-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of E. coli Shiga toxin 2

    Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit