Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit

Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit

To Order Contact us below: 

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
RD-ANTXR2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
RD-ANTXR2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
RDR-ANTXR2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
RDR-ANTXR2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit
E01A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit
E01A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit
E01A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ANTXR2/ Anthrax toxin receptor 2 ELISA Kit
E2878Hu	Sunlong	1 Kit	EUR 605

Human Anthrax toxin receptor 2, ANTXR2 ELISA KIT
ELI-34543h	Lifescience Market	96 Tests	EUR 824

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
20-abx150692	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Anthrax Toxin Receptor 2 (ANTXR2)ELISA Kit
201-12-2399	SunredBio	96 tests	EUR 440
This Anthrax Toxin Receptor 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit
CSB-EL001833HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Anthrax toxin receptor 2 (ANTXR2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Anthrax toxin receptor 2(ANTXR2) ELISA kit
1-CSB-EL001833HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Anthrax toxin receptor 2(ANTXR2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit
QY-E01309	Qayee Biotechnology	96T	EUR 361

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
SEF212Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
SEF212Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
SEF212Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
SEF212Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anthrax Toxin Receptor 2 (ANTXR2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in tissue homogenates, cell lysates and other biological fluids.

Human Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
4-SEF212Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Anthrax Toxin Receptor 2 elisa. Alternative names of the recognized antigen: CMG-2 CMG2 ISH JHF Capillary Morphogenesis Protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Anthrax Toxin Receptor 2 (ANTXR2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody
20-abx130902	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody
20-abx111012	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody
20-abx171258	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody
20-abx006356	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody
20-abx322401	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody
abx430699-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Antibody
abx230451-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Anthrax Toxin Receptor 2 (ANTXR2)
4-RPF212Hu01	Cloud-Clone	EUR 341.92 EUR 194.00 EUR 1007.20 EUR 402.40 EUR 704.80 EUR 292.00 EUR 2368.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P58335 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Anthrax Toxin Receptor 2 expressed in: E.coli

Human Anthrax Toxin Receptor 2 (ANTXR2) Protein
20-abx650646	Abbexa	EUR 495.00 EUR 244.00 EUR 1372.00 EUR 565.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit
E06A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit
E06A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax toxin receptor 2(ANTXR2) ELISA kit
E06A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit
E02A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit
E02A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor 2(ANTXR2) ELISA kit
E02A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit
E03A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit
E03A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor 2(ANTXR2) ELISA kit
E03A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit
E04A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit
E04A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor 2(ANTXR2) ELISA kit
E04A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit
E07A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit
E07A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor 2(ANTXR2) ELISA kit
E07A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit
E09A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit
E09A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor 2(ANTXR2) ELISA kit
E09A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit
E08A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit
E08A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor 2(ANTXR2) ELISA kit
E08A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit
GA-E0832RT-48T	GenAsia Biotech	48T	EUR 317

Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit
GA-E0832RT-96T	GenAsia Biotech	96T	EUR 496

Mouse Anthrax toxin receptor 2, Antxr2 ELISA KIT
ELI-49431m	Lifescience Market	96 Tests	EUR 865

Mouse Anthrax Toxin Receptor 2 (ANTXR2) ELISA Kit
abx353181-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit
QY-E10820	Qayee Biotechnology	96T	EUR 361

Mouse Anthrax Toxin Receptor 2(ANTXR2)ELISA Kit
QY-E20108	Qayee Biotechnology	96T	EUR 361

Human Anthrax Toxin Receptor 2 (ANTXR2) CLIA Kit
20-abx494819	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human ANTXR2 (Anthrax Toxin Receptor 2)
ELK3782	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Anthrax Toxin Receptor 2 (ANTXR2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Anthrax Toxin Receptor 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ANTXR2 Anthrax Toxin Receptor 2 MouseRecombinant Protein
PROTQ6DFX2	BosterBio	Regular: 5ug	EUR 317
Description: ANTXR2 produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 295 amino acids (32-318aa) and having a molecular mass of 31.9kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;ANTXR2 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit
E05A1539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit
E05A1539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax toxin receptor 2(ANTXR2) ELISA kit
E05A1539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor 2(ANTXR2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse ANTXR2 (Anthrax Toxin Receptor 2)
E-EL-M1296	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ANTXR2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ANTXR2. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ANTXR2 (Anthrax Toxin Receptor 2) in samples from Serum, Plasma, Cell supernatant

ANTXR2 Anthrax Toxin Receptor 2 Human Recombinant Protein
PROTP58335	BosterBio	Regular: 10ug	EUR 317
Description: ANTXR2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 307 amino acids (34-317) and having a molecular mass of 33 kDa.;ANTXR2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Antxr2 ELISA Kit| Mouse Anthrax toxin receptor 2 ELISA Kit
EF014213	Lifescience Market	96 Tests	EUR 689

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig)
4-PAF212Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANTXR2 (Gln34~Gly318) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2)

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAF212Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANTXR2 (Gln34~Gly318) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with APC.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAF212Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANTXR2 (Gln34~Gly318) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with Biotin.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAF212Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANTXR2 (Gln34~Gly318) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with Cy3.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), FITC
4-PAF212Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANTXR2 (Gln34~Gly318) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with FITC.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), HRP
4-PAF212Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANTXR2 (Gln34~Gly318) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with HRP.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), PE
4-PAF212Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANTXR2 (Gln34~Gly318) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with PE.

Anthrax Toxin Receptor 2 Protein
20-abx262784	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Anthrax Toxin Receptor 2 (ANTXR2) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7
4-PAF212Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ANTXR2 (Gln34~Gly318) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Anthrax Toxin Receptor 2 (ANTXR2). This antibody is labeled with APC-Cy7.

Human Anthrax Toxin Receptor 1 ELISA kit
E01A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax Toxin Receptor 1 ELISA kit
E01A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax Toxin Receptor 1 ELISA kit
E04A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax Toxin Receptor 1 ELISA kit
E04A0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax Toxin Receptor 1 ELISA kit
E04A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax Toxin Receptor 1 ELISA kit
E06A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax Toxin Receptor 1 ELISA kit
E06A0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax Toxin Receptor 1 ELISA kit
E06A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax Toxin Receptor 1 ELISA kit
E02A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax Toxin Receptor 1 ELISA kit
E02A0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax Toxin Receptor 1 ELISA kit
E02A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax Toxin Receptor 1 ELISA kit
E03A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax Toxin Receptor 1 ELISA kit
E03A0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax Toxin Receptor 1 ELISA kit
E03A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax Toxin Receptor 1 ELISA kit
E08A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax Toxin Receptor 1 ELISA kit
E08A0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax Toxin Receptor 1 ELISA kit
E08A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax Toxin Receptor 1 ELISA kit
E09A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax Toxin Receptor 1 ELISA kit
E09A0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax Toxin Receptor 1 ELISA kit
E09A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax Toxin Receptor 1 ELISA kit
E07A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax Toxin Receptor 1 ELISA kit
E07A0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax Toxin Receptor 1 ELISA kit
E07A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor like(ANTXRL) ELISA kit
E01A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor like(ANTXRL) ELISA kit
E01A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor like(ANTXRL) ELISA kit
E01A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ANTXR1/ Anthrax toxin receptor 1 ELISA Kit
E2877Hu	Sunlong	1 Kit	EUR 605

Human ANTXR1(Anthrax toxin receptor 1) ELISA Kit
EH13997	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: anthrax toxin receptor 1/ANTXR1/ ATR/TEM8/Tumor endothelial marker 8
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Anthrax toxin receptor 1, ANTXR1 ELISA KIT
ELI-34945h	Lifescience Market	96 Tests	EUR 824

Human Anthrax toxin receptor- like, ANTXRL ELISA KIT
ELI-49252h	Lifescience Market	96 Tests	EUR 824

Human Anthrax Toxin Receptor 1 (ANTXR1) ELISA Kit
20-abx384589	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Anthrax Toxin Receptor 1 (ANTXR1)ELISA Kit
201-12-2401	SunredBio	96 tests	EUR 440
This Anthrax Toxin Receptor 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human anthrax toxin receptor 1(ANTXR1) ELISA kit
CSB-EL001832HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human anthrax toxin receptor 1 (ANTXR1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human anthrax toxin receptor 1(ANTXR1) ELISA kit
1-CSB-EL001832HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human anthrax toxin receptor 1(ANTXR1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit
QY-E01310	Qayee Biotechnology	96T	EUR 361

Human Anthrax toxin receptor 1 (ANTXR1)
1-CSB-YP001832HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 34.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Anthrax toxin receptor 1(ANTXR1),partial expressed in Yeast

Goat Anthrax toxin receptor like(ANTXRL) ELISA kit
E06A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax toxin receptor like(ANTXRL) ELISA kit
E06A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Anthrax toxin receptor like(ANTXRL) ELISA kit
E06A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor like(ANTXRL) ELISA kit
E02A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor like(ANTXRL) ELISA kit
E02A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Anthrax toxin receptor like(ANTXRL) ELISA kit
E02A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit
E03A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit
E03A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor like(ANTXRL) ELISA kit
E03A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit
E04A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit
E04A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anthrax toxin receptor like(ANTXRL) ELISA kit
E04A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax Toxin Receptor 1 ELISA kit
E05A0080-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax Toxin Receptor 1 ELISA kit
E05A0080-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax Toxin Receptor 1 ELISA kit
E05A0080-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax Toxin Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor like(ANTXRL) ELISA kit
E07A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor like(ANTXRL) ELISA kit
E07A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Anthrax toxin receptor like(ANTXRL) ELISA kit
E07A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit
E09A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit
E09A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Anthrax toxin receptor like(ANTXRL) ELISA kit
E09A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor like(ANTXRL) ELISA kit
E08A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor like(ANTXRL) ELISA kit
E08A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Anthrax toxin receptor like(ANTXRL) ELISA kit
E08A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anthrax toxin receptor- like, Antxrl ELISA KIT
ELI-11530m	Lifescience Market	96 Tests	EUR 865

Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit
GA-E0831RT-48T	GenAsia Biotech	48T	EUR 317

Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit
GA-E0831RT-96T	GenAsia Biotech	96T	EUR 496

Mouse Anthrax toxin receptor 1, Antxr1 ELISA KIT
ELI-49251m	Lifescience Market	96 Tests	EUR 865

Mouse Anthrax toxin receptor 1 (ANTXR1) ELISA Kit
abx388587-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Anthrax toxin receptor 1 (ANTXR1) ELISA Kit
abx390976-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit
QY-E10821	Qayee Biotechnology	96T	EUR 361

Mouse Anthrax Toxin Receptor 1(ANTXR1)ELISA Kit
QY-E20107	Qayee Biotechnology	96T	EUR 361

Anthrax Toxin Receptor 1 (ANTXR1) Antibody
20-abx126826	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody
20-abx111011	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody
abx036391-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody
abx033658-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody
abx033658-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody
20-abx005005	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anthrax Toxin Receptor 1 (ANTXR1) Antibody
20-abx320127	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Anthrax toxin receptor 1 (ANTXR1) Antibody
20-abx214246	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Anthrax toxin receptor 1 (ANTXR1) Antibody
20-abx241731	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mouse Anthrax toxin receptor 1 (Antxr1)
1-CSB-YP001832MO	Cusabio	EUR 586.00 EUR 299.00 EUR 2172.00 EUR 900.00 EUR 1442.00 EUR 382.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 34.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in Yeast

Mouse Anthrax toxin receptor 1 (Antxr1)
1-CSB-MP001832MO	Cusabio	EUR 319.00 EUR 1081.00 EUR 451.00 EUR 801.00	100ug 1MG 200ug 500ug
MW: 36.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in Mammalian cell

Mouse Anthrax toxin receptor 1 (Antxr1)
1-CSB-EP001832MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 36.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Anthrax toxin receptor 1(Antxr1),partial expressed in E.coli

Antxr1 ELISA Kit| Rat Anthrax toxin receptor 1 ELISA Kit
EF018329	Lifescience Market	96 Tests	EUR 689

Antxr1 ELISA Kit| Mouse Anthrax toxin receptor 1 ELISA Kit
EF014212	Lifescience Market	96 Tests	EUR 689

Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit
E05A1540-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit
E05A1540-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Anthrax toxin receptor like(ANTXRL) ELISA kit
E05A1540-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Anthrax toxin receptor like(ANTXRL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anthrax toxin receptor 1 protein Control/blocking peptide # 2
ATR12-P	Alpha Diagnostics	100 ug	EUR 164

Anti-TEM8 / Anthrax Toxin Receptor 1 antibody
STJ70589	St John's Laboratory	100 µg	EUR 359

Rabbit Anti-human Anthrax Toxin Receptor 1 (ATR1), aff pure IgG # 2
ATR12-A	Alpha Diagnostics	100 ug	EUR 482

Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)
CA34-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)
CA34-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)
CA34-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Anthrax Toxin Receptor 1/ANTXR1/TEM8 (C-6His)
CA34-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Human Anthrax toxin receptor (ATR1) protein Control/blocking peptide # 1
ATR11-P	Alpha Diagnostics	100 ug	EUR 164

Human Anthrax toxin receptor 3 protein Control/blocking peptide # 1
ATR31-P	Alpha Diagnostics	100 ug	EUR 164

Polyclonal Goat Anti-TEM8 / Anthrax Toxin Receptor 1 Antibody
AMM05379G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TEM8 / Anthrax Toxin Receptor 1 . This antibody is tested and proven to work in the following applications:

Rabbit Anti-human Anthrax Toxin Receptor 3, aff pure IgG #1
ATR31-A	Alpha Diagnostics	100 ug	EUR 482

ANTXR2 ELISA KIT|Human
EF007798	Lifescience Market	96 Tests	EUR 689

Purified Recombinant Anthrax toxin Edema Factor protein
EF25-R	Alpha Diagnostics	50 ug	EUR 712

Rabbit Anti-human Anthrax Toxin Receptor 1 (ATR1), aff pure IgG # 1
ATR11-A	Alpha Diagnostics	100 ug	EUR 482

Human ANTXR2 PicoKine ELISA Kit
EK2108	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human ANTXR2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

ANTXR2 ELISA Kit (Human) (OKCD00961)
OKCD00961	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Necessary for cellular interactions with laminin and the extracellular matrix.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Differential gene expression during capillary morphogenesis in 3D collagen matrices: regulated expression of genes involved in basement membrane matrix assembly, cell cycle progression, cellular differentiation and G-protein signaling."_x005F_x005F_x000D_Bell S.E., Mavila A., Salazar R., Bayless K.J., Kanagala S., Maxwell S.A., Davis G.E._x005F_x005F_x000D_J. Cell Sci. 114:2755-2773(2001) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 2), FUNCTION, VARIANT PRO-357.Ref.15"Mutations in capillary morphogenesis gene-2 result in the allelic disorders juvenile hyaline fibromatosis and infantile systemic hyalinosis."_x005F_x005F_x000D_Dowling O., Difeo A., Ramirez M.C., Tukel T., Narla G., Bonafe L., Kayserili H., Yuksel-Apak M., Paller A.S., Norton K., Teebi A.S., Grum-Tokars V., Martin G.S., Davis G.E., Glucksman M.J., Martignetti J.A._x005F_x005F_x000D_Am. J. Hum. Genet. 73:957-966(2003) [PubMed] [Europe PMC] [Abstract]Cited for: VARIANTS HFS ASP-105; THR-189 AND ARG-329, FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.119 ng/mL

ANTXR2 ELISA Kit (Human) (OKBB01474)
OKBB01474	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Anthrax toxin receptor 2 is a protein that in humans is encoded by the ANTXR2 gene. It is mapped to 4q21.21. This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

ANTXR2 ELISA Kit (Human) (OKEH07748)
OKEH07748	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.153ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

T-2 Toxin ELISA Kit
E4748-100	Biovision		EUR 620

T-2 Toxin ELISA kit
55R-2237	Fitzgerald	1 kit	EUR 739
Description: T-2 Toxin ELISA kit for use in research laboratory

Tumor Endothelial Marker 8 (TEM8) / Anthrax Toxin Receptor 1; Clone TEM8/589 (Concentrate)
RA0365-C.1	ScyTek Laboratories	0.1 ml	EUR 125

Tumor Endothelial Marker 8 (TEM8) / Anthrax Toxin Receptor 1; Clone TEM8/589 (Concentrate)
RA0365-C.5	ScyTek Laboratories	0.5 ml	EUR 300

ANTXR2 ELISA Kit (Mouse) (OKEI00581)
OKEI00581	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Necessary for cellular interactions with laminin and the extracellular matrix.By similarity ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

ANTXR2, human recombinant
P1042-10	Biovision		EUR 164

ANTXR2, human recombinant
P1042-50	Biovision		EUR 588

T-2 Toxin (T2) ELISA Kit
abx364879-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

RealScreen Anthrax IgG ELISA Kit
EL001-096	GenDepot	96T	EUR 1144

Mouse Monoclonal anti-Clostridium difficile toxin A IgG (Clone #2)
CDTA12-M-2	Alpha Diagnostics	100 ug	EUR 482

Mouse Monoclonal anti-Clostridium difficile toxin B IgG (Clone #2)
CDTB12-M-2	Alpha Diagnostics	100 ug	EUR 482

ANTXR2 siRNA
20-abx907655	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ANTXR2 siRNA
20-abx907656	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Antxr2 antibody
70R-8864	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Antxr2 antibody

ANTXR2 antibody
70R-15731	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ANTXR2 antibody

ANTXR2 Antibody
1-CSB-PA001833ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ANTXR2. Recognizes ANTXR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ANTXR2 Antibody
1-CSB-PA001833GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ANTXR2. Recognizes ANTXR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

anti-ANTXR2
YF-PA22017	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to ANTXR2

anti-ANTXR2
YF-PA22018	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ANTXR2

T-2 and HT-2 Toxin ELISA Kit
abx157113-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Purified Recombinant Anthrax toxin Edema Factor (EF) protein control for WB
EF12-C	Alpha Diagnostics	100 ul	EUR 286

T-2 Toxin
AG057	Unibiotest	1 mg	EUR 438

T-2 Toxin
AT057	Unibiotest	1mg	EUR 1114

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ANTXR2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0096803	ABM	1.0 ug DNA	EUR 154

Human ANTXR2 shRNA Plasmid
20-abx964580	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ANTXR2 Recombinant Protein (Human)
RP001336	ABM	100 ug	Ask for price

Human Pertussiu Toxin(PT)ELISA Kit
GA-E1816HM-48T	GenAsia Biotech	48T	EUR 289

Human Pertussiu Toxin(PT)ELISA Kit
GA-E1816HM-96T	GenAsia Biotech	96T	EUR 466

Human Pertussis Toxin (PT) ELISA Kit
abx052424-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Human Pertussiu Toxin,PT ELISA Kit
201-12-1800	SunredBio	96 tests	EUR 440
This Pertussiu Toxin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Pertussiu Toxin(PT)ELISA Kit
QY-E04230	Qayee Biotechnology	96T	EUR 361

Anti-VEGF Receptor 2/KDR Antibody
A00901-2	BosterBio	100ug/vial	EUR 334

Anti-Adiponectin Receptor 2 (mouse) Antibody
A02218-2	BosterBio	200ug	EUR 498
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.

RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9
PROTQ99969-2	BosterBio	Regular: 5ug	EUR 317
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

anti- ANTXR2 antibody
FNab00451	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: anthrax toxin receptor 2 Uniprot ID: P58335 Gene ID: 118429 Research Area: Immunology
Description: Antibody raised against ANTXR2

ANTXR2 Rabbit pAb
A6526-100ul	Abclonal	100 ul	EUR 308

ANTXR2 Rabbit pAb
A6526-200ul	Abclonal	200 ul	EUR 459

ANTXR2 Rabbit pAb
A6526-20ul	Abclonal	20 ul	EUR 183

ANTXR2 Rabbit pAb
A6526-50ul	Abclonal	50 ul	EUR 223

Antxr2 Blocking Peptide
33R-3429	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Antxr2 antibody, catalog no. 70R-8864

ANTXR2 Polyclonal Antibody
30720-100ul	SAB	100ul	EUR 252

ANTXR2 Polyclonal Antibody
30720-50ul	SAB	50ul	EUR 187

ANTXR2 cloning plasmid
CSB-CL001833HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 459 Sequence: atgtggtggttttggcccctttgctgcaaagtggttattaaggatcctccaccaccacccccccctgcaccaaaagaggaggaagaagaacctttgcctactaaaaagtggccaactgtggatgcttcctattatggtggtcgaggggttggaggaattaaaagaatggaggttcg Show more
Description: A cloning plasmid for the ANTXR2 gene.

ANTXR2, mouse recombinant
P1043-10	Biovision		EUR 316

Anti-ANTXR2 antibody
PAab00451	Lifescience Market	100 ug	EUR 355

Anti-ANTXR2 antibody
STJ28609	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene.

TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein
PROTP20333-2	BosterBio	Regular: 20ug	EUR 317
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.

Human Multidrug and toxin extrusion protein 2, SLC47A2 ELISA KIT
ELI-53017h	Lifescience Market	96 Tests	EUR 824

T-2 Toxin [HRP]
DAGA-013H	Creative Diagnostics	1mg	EUR 1105

T-2 Toxin [KLH]
DAGA-015K	Creative Diagnostics	1mg	EUR 1014

T-2 Toxin [BSA]
DAGHZ07	Creative Diagnostics	1mg	EUR 780

T-2 Toxin Standard
SD012	Unibiotest	0.5ug/mL	EUR 607

HT-2 Toxin Standard
SD014	Unibiotest	0.5ug/mL	EUR 607

ANTXR2 ORF Vector (Human) (pORF)
ORF000446	ABM	1.0 ug DNA	EUR 95

Antxr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3356203	ABM	1.0 ug DNA	EUR 154

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Ras-Related C3 Botulinum Toxin Substrate 2 (RAC2) ELISA Kit
abx382652-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Anthrax LF Antibody
20-abx137198	Abbexa	EUR 1177.00 EUR 1887.00	200 ul 400 ul
Shipped within 5-10 working days.

Anthrax LF Antibody
abx137198-600l	Abbexa	600 µl	EUR 2221
Shipped within 5-10 working days.

Anthrax protective Antigen
30R-AA014	Fitzgerald	100 ug	EUR 970
Description: Purified recombinant Bacillus Anthrax protective Antigen

Anthrax PA Antibody
24269-100ul	SAB	100ul	EUR 390

E. coli Shiga toxin 2 PCR kit
PCR-VH108-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of E. coli Shiga toxin 2

E. coli Shiga toxin 2 PCR kit
PCR-VH108-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of E. coli Shiga toxin 2

Human ANTXR2(Anthrax Toxin Receptor 2) ELISA Kit