Human SELENBP1(Selenium Binding Protein 1) ELISA Kit

Human SELENBP1(Selenium Binding Protein 1) ELISA Kit

To Order Contact us below: 

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
RDR-SELENBP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
RDR-SELENBP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
20-abx153044	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx251418-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human SELENBP1/ Selenium-binding protein 1 ELISA Kit
E2229Hu	Sunlong	1 Kit	EUR 571

Human SELENBP1(Selenium-binding protein 1) ELISA Kit
EH2088	FN Test	96T	EUR 567.6
Detection range: 31.25-2000 pg/ml Uniprot ID: Q13228 Alias: SELENBP1/SBP/SBP56/SP56/56 kDa selenium-binding protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml

Human Selenium- binding protein 1, SELENBP1 ELISA KIT
ELI-06660h	Lifescience Market	96 Tests	EUR 824

Human selenium binding protein 1(SELENBP1) ELISA Kit
CSB-E13947h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human selenium binding protein 1(SELENBP1) ELISA Kit
1-CSB-E13947h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1(SELENBP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx572666-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Selenium Binding Protein 1(SELENBP1)ELISA Kit
QY-E01003	Qayee Biotechnology	96T	EUR 361

Human Selenium Binding Protein 1 ELISA Kit (SELENBP1)
RK02256	Abclonal	96 Tests	EUR 521

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
SEG326Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
SEG326Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
SEG326Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
SEG326Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
4-SEG326Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Selenium Binding Protein 1 elisa. Alternative names of the recognized antigen: LPSB SP56 hSBP hSP56 SBP56 56 kDa selenium-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Selenium Binding Protein 1 (SELENBP1) Protein
20-abx069015	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Selenium Binding Protein 1 (SELENBP1) Antibody
20-abx103200	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody
abx117070-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody
abx122246-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Selenium-Binding Protein 1 (SELENBP1) Antibody
20-abx141601	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Selenium Binding Protein 1 (SELENBP1) Antibody
20-abx174498	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Selenium-Binding Protein 1 (SELENBP1) Antibody
20-abx001134	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Selenium Binding Protein 1 (SELENBP1)
4-RPG326Hu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q13228 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Selenium Binding Protein 1 expressed in: E.coli

Bovine Selenium- binding protein 1, SELENBP1 ELISA KIT
ELI-06662b	Lifescience Market	96 Tests	EUR 928

Mouse Selenium- binding protein 1, Selenbp1 ELISA KIT
ELI-06663m	Lifescience Market	96 Tests	EUR 865

Cow Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx519321-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx519323-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Selenium-binding protein 1 (SELENBP1) ELISA Kit
abx519324-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Selenium Binding Protein 1 (SELENBP1) CLIA Kit
20-abx495160	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human SELENBP1 (Selenium Binding Protein 1)
ELK3850	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Selenium Binding Protein 1 (SELENBP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Selenium Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)
KTE60720-48T	Abbkine	48T	EUR 354
protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)
KTE60720-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Selenium binding protein 1 (SELENBP1)
KTE60720-96T	Abbkine	96T	EUR 572
protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel Show more
Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Anti-Selenium Binding Protein 1/SELENBP1 Antibody
PA2216	BosterBio	100ug/vial	EUR 334

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human)
4-PAG326Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1)

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC
4-PAG326Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Biotinylated
4-PAG326Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Biotin.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Cy3
4-PAG326Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Cy3.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), FITC
4-PAG326Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with FITC.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), HRP
4-PAG326Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with HRP.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), PE
4-PAG326Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with PE.

Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC-Cy7
4-PAG326Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SELENBP1 (Thr46~Ser286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC-Cy7.

ELISA kit for Human Selenium-binding protein 1
EK4255	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Selenium-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Selenium-binding protein 1 (SBP1) ELISA Kit
abx259308-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Rat Selenium-binding protein 1 (SBP1) ELISA Kit
abx259346-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse SBP1(Selenium-binding protein 1) ELISA Kit
EM1864	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Rat SBP1(Selenium-binding protein 1) ELISA Kit
ER1856	FN Test	96T	EUR 567.6
Detection range: 78.125-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.875pg/ml

Selenbp1/ Rat Selenbp1 ELISA Kit
ELI-06661r	Lifescience Market	96 Tests	EUR 886

Mouse Selenium- binding protein 2, Selenbp2 ELISA KIT
ELI-53194m	Lifescience Market	96 Tests	EUR 865

Human SELENBP1 ELISA Kit
ELA-E2076h	Lifescience Market	96 Tests	EUR 824

SELENBP1 ELISA KIT|Human
EF006170	Lifescience Market	96 Tests	EUR 689

Monoclonal Selenium Binding Protein 1 Antibody (clone 3D4), Clone: 3D4
AMR09861G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human Selenium Binding Protein 1 (clone 3D4). The antibodies are raised in Mouse and are from clone 3D4. This antibody is applicable in WB and IHC-P

SELENBP1 Recombinant Protein (Human)
RP027949	ABM	100 ug	Ask for price

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
ER1005-1	AssayPro	96 Well Plate	EUR 417

Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
ER2005-1	AssayPro	96 Well Plate	EUR 396

Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit
EC2202-1	AssayPro	96 Well Plate	EUR 417

Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
ER3005-1	AssayPro	96 Well Plate	EUR 396

SELENBP1 antibody
70R-2556	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SELENBP1 antibody raised against the N terminal of SELENBP1

SELENBP1 antibody
70R-3071	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SELENBP1 antibody raised against the C terminal of SELENBP1

SELENBP1 antibody
38221-100ul	SAB	100ul	EUR 252

SELENBP1 Antibody
DF6354	Affbiotech	200ul	EUR 304
Description: SELENBP1 Antibody detects endogenous levels of total SELENBP1.

SELENBP1 Antibody
CSB-PA020976KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SELENBP1 Antibody
CSB-PA020976KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SELENBP1 siRNA
20-abx904844	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SELENBP1 siRNA
20-abx932808	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SELENBP1 siRNA
20-abx932809	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SELENBP1 Antibody
ABD6354	Lifescience Market	100 ug	EUR 438

Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit
EF2702-1	AssayPro	96 Well Plate	EUR 417

Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit
EF2705-1	AssayPro	96 Well Plate	EUR 417

ULBP1 Human, UL16 Binding Protein 1 Human Recombinant Protein, Sf9
PROTQ9BZM6-1	BosterBio	Regular: 10ug	EUR 317
Description: ULBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216) and having a molecular mass of 23.4kDa (Molecular size on SDS-PAGE will appear at approximately 20-40kDa).;ULBP1 is fused to a 6 amino acid IgG His-Tag at C-terminus and purified by proprietary chromatographic techniques.

RLBP1 Human, Retinaldehyde Binding Protein 1 Human Recombinant Protein, sf9
PROTP12271-1	BosterBio	Regular: 10ug	EUR 317
Description: RLBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 326 amino acids (1-317) and having a molecular mass of 37.5kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;RLBP1 is fused to 6 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

FABP1 Fatty Acid Binding Protein-1 Human Recombinant Protein
PROTP07148-1	BosterBio	Regular: 10ug	EUR 317
Description: FABP1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 127 amino acids and having a total molecular mass of 14.2kDa (calculated).

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

SELENBP1 Recombinant Protein (Rat)
RP227957	ABM	100 ug	Ask for price

SELENBP1 Recombinant Protein (Mouse)
RP170645	ABM	100 ug	Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human SELENBP1 shRNA Plasmid
20-abx955932	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
EG3801-1	AssayPro	96 Well Plate	EUR 396

Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
EG3811-1	AssayPro	96 Well Plate	EUR 417

Canine Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
ECR3005-1	AssayPro	96 Well Plate	EUR 396

Mouse Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
EMR3005-1	AssayPro	96 Well Plate	EUR 417

SELENBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2115402	ABM	1.0 ug DNA	EUR 154

SELENBP1 Blocking Peptide
33R-4604	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-3071

SELENBP1 Blocking Peptide
33R-5778	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-2556

SELENBP1 Blocking Peptide
DF6354-BP	Affbiotech	1mg	EUR 195

Mouse Selenbp1 Antibody
abx030957-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Selenbp1 Antibody
abx030957-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SELENBP1 Conjugated Antibody
C38221	SAB	100ul	EUR 397

SELENBP1 cloning plasmid
CSB-CL618766HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1419 Sequence: atggctacgaaatgtgggaattgtggacccggctactccacccctctggaggccatgaaaggacccagggaagagatcgtctacctgccctgcatttaccgaaacacaggcactgaggccccagattatctggccactgtggatgttgaccccaagtctccccagtattgccagg Show more
Description: A cloning plasmid for the SELENBP1 gene.

Anti-SELENBP1 antibody
STJ25468	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

AZGP1 Alpha-2-Glycoprotein 1 Zinc-Binding Human Recombinant Protein
PROTP25311-1	BosterBio	Regular: 20ug	EUR 317
Description: AZGP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (21-298 a.a) and having a molecular mass of 34.5kDa.;AZGP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

ELISA kit for Human O-phosphoseryl-tRNA (Sec) selenium transferase
EK2630	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human O-phosphoseryl-tRNA (Sec) selenium transferase in samples from serum, plasma, tissue homogenates and other biological fluids.

TARDBP (1-414) Human, TAR DNA Binding Protein (1-414 a.a.) Human Recombinant Protein, His Tag
PROTQ13148-1	BosterBio	Regular: 20ug	EUR 317
Description: TARDBP Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 450 amino acids (1-414 a.a) and having a total molecular mass of 48.8 kDa. TARDBP is fused to a 36 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

SELENBP1 ORF Vector (Human) (pORF)
ORF009317	ABM	1.0 ug DNA	EUR 95

Human TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit
abx385467-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Calcineurin Binding Protein 1 ELISA kit
E01C0536-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcineurin Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GATA Binding Protein 1 ELISA kit
E01G0084-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human GATA Binding Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UL16 Binding protein 1 ELISA kit
E01U0022-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human UL16 Binding protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SELENBP1(Selenium Binding Protein 1) ELISA Kit