Human SELENBP1(Selenium Binding Protein 1) ELISA Kit

Human SELENBP1(Selenium Binding Protein 1) ELISA Kit

To Order Contact us below: 

    Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
    RDR-SELENBP1-Hu-48Tests 48 Tests
    EUR 544
    Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
    RDR-SELENBP1-Hu-96Tests 96 Tests
    EUR 756
    Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Selenium-binding protein 1 (SELENBP1) ELISA Kit
    abx251418-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.
    Human SELENBP1/ Selenium-binding protein 1 ELISA Kit
    E2229Hu 1 Kit
    EUR 571
    Human SELENBP1(Selenium-binding protein 1) ELISA Kit
    EH2088 96T
    EUR 567.6
    • Detection range: 31.25-2000 pg/ml
    • Uniprot ID: Q13228
    • Alias: SELENBP1/SBP/SBP56/SP56/56 kDa selenium-binding protein
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml
    Human Selenium- binding protein 1, SELENBP1 ELISA KIT
    ELI-06660h 96 Tests
    EUR 824
    Human selenium binding protein 1(SELENBP1) ELISA Kit
    CSB-E13947h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1 (SELENBP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human selenium binding protein 1(SELENBP1) ELISA Kit
    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human selenium binding protein 1(SELENBP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Selenium-binding protein 1 (SELENBP1) ELISA Kit
    abx572666-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
    SEG326Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.
    Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
    SEG326Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.
    Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
    SEG326Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.
    Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
    SEG326Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Selenium Binding Protein 1 (SELENBP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Selenium Binding Protein 1 (SELENBP1) in serum, plasma, tissue homogenates and other biological fluids.
    Human Selenium Binding Protein 1 (SELENBP1) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Selenium Binding Protein 1 elisa. Alternative names of the recognized antigen: LPSB
    • SP56
    • hSBP
    • hSP56
    • SBP56
    • 56 kDa selenium-binding protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Selenium Binding Protein 1 (SELENBP1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Selenium Binding Protein 1(SELENBP1)ELISA Kit
    QY-E01003 96T
    EUR 361
    Human Selenium Binding Protein 1 ELISA Kit (SELENBP1)
    RK02256 96 Tests
    EUR 521
    Human Selenium Binding Protein 1 (SELENBP1) Protein
    • EUR 718.00
    • EUR 286.00
    • EUR 2221.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.
    Selenium Binding Protein 1 (SELENBP1) Antibody
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Selenium-Binding Protein 1 (SELENBP1) Antibody
    abx117070-100ug 100 ug
    EUR 467
    • Shipped within 5-10 working days.
    Selenium-Binding Protein 1 (SELENBP1) Antibody
    abx122246-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Selenium-Binding Protein 1 (SELENBP1) Antibody
    • EUR 370.00
    • EUR 606.00
    • EUR 300.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Selenium Binding Protein 1 (SELENBP1) Antibody
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Selenium-Binding Protein 1 (SELENBP1) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Recombinant Selenium Binding Protein 1 (SELENBP1)
    • EUR 512.16
    • EUR 240.00
    • EUR 1645.60
    • EUR 615.20
    • EUR 1130.40
    • EUR 406.00
    • EUR 3964.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q13228
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 28.3kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Selenium Binding Protein 1 expressed in: E.coli
    Bovine Selenium- binding protein 1, SELENBP1 ELISA KIT
    ELI-06662b 96 Tests
    EUR 928
    Mouse Selenium- binding protein 1, Selenbp1 ELISA KIT
    ELI-06663m 96 Tests
    EUR 865
    Cow Selenium-binding protein 1 (SELENBP1) ELISA Kit
    abx519321-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Selenium-binding protein 1 (SELENBP1) ELISA Kit
    abx519323-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Rat Selenium-binding protein 1 (SELENBP1) ELISA Kit
    abx519324-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Selenium Binding Protein 1 (SELENBP1) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human SELENBP1 (Selenium Binding Protein 1)
    ELK3850 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Selenium Binding Protein 1 (SELENBP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
    • Show more
    Description: A sandwich ELISA kit for detection of Selenium Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Selenium binding protein 1 (SELENBP1)
    KTE60720-48T 48T
    EUR 354
    • protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Selenium binding protein 1 (SELENBP1)
    KTE60720-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Selenium binding protein 1 (SELENBP1)
    KTE60720-96T 96T
    EUR 572
    • protein belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of sel
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Selenium binding protein 1 (SELENBP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Anti-Selenium Binding Protein 1/SELENBP1 Antibody
    PA2216 100ug/vial
    EUR 334
    Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human)
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1)
    Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC.
    Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Biotinylated
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Biotin.
    Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with Cy3.
    Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with FITC.
    Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with HRP.
    Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with PE.
    Selenium Binding Protein 1 (SELENBP1) Polyclonal Antibody (Human), APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SELENBP1 (Thr46~Ser286)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Selenium Binding Protein 1 (SELENBP1). This antibody is labeled with APC-Cy7.
    ELISA kit for Human Selenium-binding protein 1
    EK4255 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Selenium-binding protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Mouse Selenium-binding protein 1 (SBP1) ELISA Kit
    abx259308-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.
    Rat Selenium-binding protein 1 (SBP1) ELISA Kit
    abx259346-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.
    Mouse SBP1(Selenium-binding protein 1) ELISA Kit
    EM1864 96T
    EUR 567.6
    • Detection range: 78-5000 pg/ml
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml
    Rat SBP1(Selenium-binding protein 1) ELISA Kit
    ER1856 96T
    EUR 567.6
    • Detection range: 78.125-5000 pg/ml
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.875pg/ml
    Selenbp1/ Rat Selenbp1 ELISA Kit
    ELI-06661r 96 Tests
    EUR 886
    Mouse Selenium- binding protein 2, Selenbp2 ELISA KIT
    ELI-53194m 96 Tests
    EUR 865
    Human SELENBP1 ELISA Kit
    ELA-E2076h 96 Tests
    EUR 824
    EF006170 96 Tests
    EUR 689
    SELENBP1 ELISA Kit (Human) (OKEH01473)
    OKEH01473 96 Wells
    EUR 662
    Description: Description of target: This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15 ng/mL
    SELENBP1 ELISA Kit (Human) (OKCD08914)
    OKCD08914 96 Wells
    EUR 975
    Description: Description of target: SELENBP1 belongs to the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. It has been proposed that the effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL
    SELENBP1 ELISA Kit (Human) (OKAN05628)
    OKAN05628 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL
    Monoclonal Selenium Binding Protein 1 Antibody (clone 3D4), Clone: 3D4
    AMR09861G 0.05ml
    EUR 484
    Description: A Monoclonal antibody against Human Selenium Binding Protein 1 (clone 3D4). The antibodies are raised in Mouse and are from clone 3D4. This antibody is applicable in WB and IHC-P
    SELENBP1 Recombinant Protein (Human)
    RP027949 100 ug Ask for price
    SELENBP1 ELISA Kit (Bovine) (OKCA02170)
    OKCA02170 96 Wells
    EUR 930
    Description: Description of target: Selenium-binding protein which may be involved in the sensing of reactive xenobiotics in the cytoplasm. May be involved in intra-Golgi protein transport.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.8 pg/mL
    Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
    ER1005-1 96 Well Plate
    EUR 417
    Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
    ER2005-1 96 Well Plate
    EUR 396
    SELENBP1 antibody
    70R-2556 50 ug
    EUR 467
    Description: Rabbit polyclonal SELENBP1 antibody raised against the N terminal of SELENBP1
    SELENBP1 antibody
    70R-3071 50 ug
    EUR 467
    Description: Rabbit polyclonal SELENBP1 antibody raised against the C terminal of SELENBP1
    SELENBP1 antibody
    38221-100ul 100ul
    EUR 252
    SELENBP1 Antibody
    DF6354 200ul
    EUR 304
    Description: SELENBP1 Antibody detects endogenous levels of total SELENBP1.
    SELENBP1 Antibody
    EUR 335
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
    SELENBP1 Antibody
    CSB-PA020976KA01HU-100ul 100ul
    EUR 389
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against SELENBP1. Recognizes SELENBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    SELENBP1 Antibody
    ABD6354 100 ug
    EUR 438
    Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit
    EC2202-1 96 Well Plate
    EUR 417
    Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
    ER3005-1 96 Well Plate
    EUR 396
    ULBP1 Human, UL16 Binding Protein 1 Human Recombinant Protein, Sf9
    PROTQ9BZM6-1 Regular: 10ug
    EUR 317
    Description: ULBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 200 amino acids (26-216) and having a molecular mass of 23.4kDa (Molecular size on SDS-PAGE will appear at approximately 20-40kDa).;ULBP1 is fused to a 6 amino acid IgG His-Tag at C-terminus and purified by proprietary chromatographic techniques.
    RLBP1 Human, Retinaldehyde Binding Protein 1 Human Recombinant Protein, sf9
    PROTP12271-1 Regular: 10ug
    EUR 317
    Description: RLBP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 326 amino acids (1-317) and having a molecular mass of 37.5kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;RLBP1 is fused to 6 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.
    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes
    SELENBP1 Recombinant Protein (Rat)
    RP227957 100 ug Ask for price
    SELENBP1 Recombinant Protein (Mouse)
    RP170645 100 ug Ask for price
    FABP1 Fatty Acid Binding Protein-1 Human Recombinant Protein
    PROTP07148-1 Regular: 10ug
    EUR 317
    Description: FABP1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 127 amino acids and having a total molecular mass of 14.2kDa (calculated).
    mRNAExpress mRNA Synthesis kit (5 reactions)
    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products
    Human SELENBP1 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit
    EF2702-1 96 Well Plate
    EUR 417
    Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit
    EF2705-1 96 Well Plate
    EUR 417
    SELENBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K2115402 1.0 ug DNA
    EUR 154
    Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
    EG3801-1 96 Well Plate
    EUR 396
    Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
    EG3811-1 96 Well Plate
    EUR 417
    SELENBP1 Blocking Peptide
    33R-4604 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-3071
    SELENBP1 Blocking Peptide
    33R-5778 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SELENBP1 antibody, catalog no. 70R-2556
    SELENBP1 Blocking Peptide
    DF6354-BP 1mg
    EUR 195
    Mouse Selenbp1 Antibody
    abx030957-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Mouse Selenbp1 Antibody
    abx030957-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    SELENBP1 Conjugated Antibody
    C38221 100ul
    EUR 397
    SELENBP1 cloning plasmid
    CSB-CL618766HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1419
    • Sequence: atggctacgaaatgtgggaattgtggacccggctactccacccctctggaggccatgaaaggacccagggaagagatcgtctacctgccctgcatttaccgaaacacaggcactgaggccccagattatctggccactgtggatgttgaccccaagtctccccagtattgccagg
    • Show more
    Description: A cloning plasmid for the SELENBP1 gene.

    Human SELENBP1(Selenium Binding Protein 1) ELISA Kit