Human TNS3(Tensin 3) ELISA Kit

Human TNS3(Tensin 3) ELISA Kit

To Order Contact us below: 

Human Tensin 3 (TNS3) ELISA Kit
RDR-TNS3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Tensin 3 (TNS3) ELISA Kit
RD-TNS3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tensin 3 (TNS3) ELISA Kit
RD-TNS3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Tensin- 3, TNS3 ELISA KIT
ELI-16205h	Lifescience Market	96 Tests	EUR 824

Human Tensin 3 (TNS3) ELISA Kit
20-abx153250	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tensin 3(TNS3)ELISA Kit
QY-E00275	Qayee Biotechnology	96T	EUR 361

Human Tensin 3 (TNS3) ELISA Kit
SEF819Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tensin 3 (TNS3) ELISA Kit
SEF819Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tensin 3 (TNS3) ELISA Kit
SEF819Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tensin 3 (TNS3) ELISA Kit
SEF819Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.

Human Tensin 3 (TNS3) ELISA Kit
4-SEF819Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tensin 3 elisa. Alternative names of the recognized antigen: TENS1 TEM6 TPP Tumor Endothelial Marker 6 Tensin-Like SH2 Domain-Containing 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tensin 3 (TNS3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Tensin- 3, Tns3 ELISA KIT
ELI-46578m	Lifescience Market	96 Tests	EUR 865

Tensin 3 (TNS3) Antibody
20-abx116031	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tensin 3 (TNS3) Antibody
20-abx128302	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tensin-3 (TNS3) Antibody
abx145305-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tensin 3 (TNS3) Antibody
20-abx174741	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tensin 3 (TNS3) Antibody
20-abx323142	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tensin-3 (TNS3) Antibody
20-abx321056	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Tensin-3 (TNS3) Antibody
abx238847-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Tensin 3 (TNS3)
4-RPF819Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q68CZ2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Tensin 3 expressed in: E.coli

ELISA kit for Human TNS3 (Tensin 3)
ELK4136	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tensin 3 (TNS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tensin 3 (TNS3). N Show more
Description: A sandwich ELISA kit for detection of Tensin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Tensin-3 (TNS3)
KTE60173-48T	Abbkine	48T	EUR 332
Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-3 (TNS3)
KTE60173-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-3 (TNS3)
KTE60173-96T	Abbkine	96T	EUR 539
Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Tensin 3 (TNS3) CLIA Kit
20-abx495009	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Tensin 3 (TNS3) Protein
20-abx166762	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse Tensin-3 (TNS3)
KTE70085-48T	Abbkine	48T	EUR 332
Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-3 (TNS3)
KTE70085-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-3 (TNS3)
KTE70085-96T	Abbkine	96T	EUR 539
Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tensin 3 (TNS3) Polyclonal Antibody (Human)
4-PAF819Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNS3 (Met1~Thr301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3)

Tensin 3 (TNS3) Polyclonal Antibody (Human), APC
4-PAF819Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNS3 (Met1~Thr301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with APC.

Tensin 3 (TNS3) Polyclonal Antibody (Human), Biotinylated
4-PAF819Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNS3 (Met1~Thr301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with Biotin.

Tensin 3 (TNS3) Polyclonal Antibody (Human), Cy3
4-PAF819Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNS3 (Met1~Thr301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with Cy3.

Tensin 3 (TNS3) Polyclonal Antibody (Human), FITC
4-PAF819Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNS3 (Met1~Thr301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with FITC.

Tensin 3 (TNS3) Polyclonal Antibody (Human), HRP
4-PAF819Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNS3 (Met1~Thr301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with HRP.

Tensin 3 (TNS3) Polyclonal Antibody (Human), PE
4-PAF819Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNS3 (Met1~Thr301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with PE.

Tensin 3 (TNS3) Polyclonal Antibody (Human), APC-Cy7
4-PAF819Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TNS3 (Met1~Thr301) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with APC-Cy7.

TNS3 ELISA KIT|Human
EF003729	Lifescience Market	96 Tests	EUR 689

TNS3 ELISA Kit (Human) (OKCD00479)
OKCD00479	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May play a role in actin remodeling. Involved in the dissociation of the integrin-tensin-actin complex. EGF activates TNS4 and down-regulates TNS3 which results in capping the tail of ITGB1. Seems to be involved in mammary cell migration. May be involved in cell migration and bone development (By similarity).By similarity1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"A reciprocal tensin-3-cten switch mediates EGF-driven mammary cell migration."_x005F_x005F_x000D_Katz M., Amit I., Citri A., Shay T., Carvalho S., Lavi S., Milanezi F., Lyass L., Amariglio N., Jacob-Hirsch J., Ben-Chetrit N., Tarcic G., Lindzen M., Avraham R., Liao Y.C., Trusk P., Lyass A., Rechavi G. , Spector N.L., Lo S.H., Schmitt F., Bacus S.S., Yarden Y._x005F_x005F_x000D_Nat. Cell Biol. 9:961-969(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INDUCTION, KNOCKDOWN IN MCF10A CELLS. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.052 ng/mL

TNS3 ELISA Kit (Human) (OKDD00570)
OKDD00570	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL

Human Tensin- 4, TNS4 ELISA KIT
ELI-16206h	Lifescience Market	96 Tests	EUR 824

Human Tensin- 1, TNS1 ELISA KIT
ELI-40018h	Lifescience Market	96 Tests	EUR 824

Human Tensin-1 (TNS1) ELISA Kit
abx383857-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Tensin-4 (TNS4) ELISA Kit
abx383859-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Tensin-1(TNS1) ELISA kit
CSB-EL024032HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tensin-1 (TNS1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tensin-1(TNS1) ELISA kit
1-CSB-EL024032HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tensin-1(TNS1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tensin 4(TNS4)ELISA Kit
QY-E00274	Qayee Biotechnology	96T	EUR 361

Human Tensin 2(TNS2)ELISA Kit
QY-E00276	Qayee Biotechnology	96T	EUR 361

Human Tensin 1(TNS1)ELISA Kit
QY-E00277	Qayee Biotechnology	96T	EUR 361

TNS3 siRNA
20-abx937705	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TNS3 siRNA
20-abx937706	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TNS3 antibody
70R-20911	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TNS3 antibody

TNS3 Antibody
1-CSB-PA731561ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TNS3 Antibody
1-CSB-PA050061	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

TNS3 Antibody
1-CSB-PA024033GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Chicken Tensin, TNS ELISA KIT
ELI-46577c	Lifescience Market	96 Tests	EUR 928

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Tensin-3 (TENS3) Antibody
20-abx219047	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-Tensin 3 Antibody
A1168-100	Biovision		EUR 370

Human TNS3 shRNA Plasmid
20-abx962067	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ELISA kit for Human Tensin-4 (TNS4)
KTE60172-48T	Abbkine	48T	EUR 332
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-4 (TNS4)
KTE60172-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-4 (TNS4)
KTE60172-96T	Abbkine	96T	EUR 539
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-1 (TNS1)
KTE60174-48T	Abbkine	48T	EUR 332
Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-1 (TNS1)
KTE60174-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tensin-1 (TNS1)
KTE60174-96T	Abbkine	96T	EUR 539
Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu Show more
Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TNS3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2421704	ABM	1.0 ug DNA	EUR 154

anti- TNS3 antibody
FNab08847	FN Test	100µg	EUR 548.75
Immunogen: tensin 3 Uniprot ID: Q68CZ2 Gene ID: 64759 Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against TNS3

TNS3 Rabbit pAb
A7991-100ul	Abclonal	100 ul	EUR 308

TNS3 Rabbit pAb
A7991-200ul	Abclonal	200 ul	EUR 459

TNS3 Rabbit pAb
A7991-20ul	Abclonal	20 ul	EUR 183

TNS3 Rabbit pAb
A7991-50ul	Abclonal	50 ul	EUR 223

TNS3 Polyclonal Antibody
31406-100ul	SAB	100ul	EUR 252

TNS3 Polyclonal Antibody
31406-50ul	SAB	50ul	EUR 187

TNS3 cloning plasmid
CSB-CL731561HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 753 Sequence: atggaggagggccatgggctggacctcacttacatcacggagcgcatcatcgctgtgtccttccctgccggctgctctgaggagtcctacctgcacaacctacaggaggtcacgcgcatgctcaagtccaagcacggggacaactacctggtattaaacctttcagaaaagagata Show more
Description: A cloning plasmid for the TNS3 gene.

Anti-TNS3 antibody
PAab08847	Lifescience Market	100 ug	EUR 386

Anti-TNS3 antibody
STJ117844	St John's Laboratory	100 µl	EUR 277

Bovine Tensin- 4, TNS4 ELISA KIT
ELI-52065b	Lifescience Market	96 Tests	EUR 928

Mouse Tensin- 4, Tns4 ELISA KIT
ELI-46579m	Lifescience Market	96 Tests	EUR 865

Bovine Tensin- 1, TNS1 ELISA KIT
ELI-29174b	Lifescience Market	96 Tests	EUR 928

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
20-abx152881	Abbexa	EUR 6173.00 EUR 3291.00 EUR 770.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
abx250957-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
DLR-PTEN-Hu-48T	DL Develop	48T	EUR 441
Should the Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
DLR-PTEN-Hu-96T	DL Develop	96T	EUR 570
Should the Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Phosphatase And Tensin Homolog ELISA Kit (PTEN)
RK02152	Abclonal	96 Tests	EUR 521

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RD-PTEN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RD-PTEN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RDR-PTEN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 455

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RDR-PTEN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 629

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
SEF822Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 3815.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
SEF822Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 401.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
SEF822Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 531.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
SEF822Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2090.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
4-SEF822Hu	Cloud-Clone	EUR 3866.00 EUR 2041.00 EUR 532.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Phosphatase And Tensin Homolog elisa. Alternative names of the recognized antigen: BZS MHAM MMAC1 PTEN1 TEP1 Mutated In Multiple Advanced Cancers 1 Phosphatidylinositol 3, 4, 5-trisphosphate 3-phosphatase and dual-specificity prot Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

TNS3 ORF Vector (Human) (pORF)
ORF010839	ABM	1.0 ug DNA	EUR 95

FSH (Human Follicle-stimulating hormone) ELISA test
3	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

ELISA kit for Rat Tensin-4 (TNS4)
KTE100052-48T	Abbkine	48T	EUR 332
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tensin-4 (TNS4)
KTE100052-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tensin-4 (TNS4)
KTE100052-96T	Abbkine	96T	EUR 539
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-4 (TNS4)
KTE10015-48T	Abbkine	48T	EUR 354
Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-4 (TNS4)
KTE10015-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-4 (TNS4)
KTE10015-96T	Abbkine	96T	EUR 572
Tensin-4 (TNS4) may be involved in cell migration, cartilage development and in linking signal transduction pathways to the cytoskeleton and may promote apoptosis, via its cleavage by caspase-3.
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-1 (TNS1)
KTE10016-48T	Abbkine	48T	EUR 354
Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu Show more
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-1 (TNS1)
KTE10016-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu Show more
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Tensin-1 (TNS1)
KTE10016-96T	Abbkine	96T	EUR 572
Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu Show more
Description: Quantitative sandwich ELISA for measuring Bovine Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-4 (TNS4)
KTE70084-48T	Abbkine	48T	EUR 332
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-4 (TNS4)
KTE70084-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tensin-4 (TNS4)
KTE70084-96T	Abbkine	96T	EUR 539
CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TNS3 Polyclonal Conjugated Antibody
C31406	SAB	100ul	EUR 397

Mouse TNS3 shRNA Plasmid
20-abx983333	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Tns3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4967904	ABM	1.0 ug DNA	EUR 154

Tns3 3'UTR GFP Stable Cell Line
TU170936	ABM	1.0 ml	Ask for price

TNS3 3'UTR GFP Stable Cell Line
TU076078	ABM	1.0 ml	EUR 4617

Tns3 3'UTR Luciferase Stable Cell Line
TU120936	ABM	1.0 ml	Ask for price

TNS3 3'UTR Luciferase Stable Cell Line
TU026078	ABM	1.0 ml	EUR 4617

ELISA kit for Human PTEN (Phosphatase And Tensin Homolog)
ELK1367	ELK Biotech	1 plate of 96 wells	EUR 372
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phosphatase And Tensin Homolog (PTEN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Phosphatase And Tensin Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Phosphatase and tensin homolog (PTEN)
KTE62888-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatase and tensin homolog (PTEN)
KTE62888-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatase and tensin homolog (PTEN)
KTE62888-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Phosphatase and tensin homolog (PTEN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Transmembrane Phosphoinositide 3-Phosphatase And Tensin Homolog 2 (TPTE2) ELISA Kit
abx383888-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

TNS3 sgRNA CRISPR Lentivector set (Human)
K2421701	ABM	3 x 1.0 ug	EUR 339

Tensin 1 antibody
70R-50500	Fitzgerald	100 ul	EUR 287
Description: Purified Polyclonal Tensin 1 antibody

Tensin- 1 Antibody
ABD8622	Lifescience Market	100 ug	EUR 438

Tensin- 2 Antibody
ABD8623	Lifescience Market	100 ug	EUR 438

Tensin-1 Antibody
45400-100ul	SAB	100ul	EUR 252

Tensin-1 Antibody
45400-50ul	SAB	50ul	EUR 187

Tensin-2 Antibody
45401-100ul	SAB	100ul	EUR 252

Tensin-2 Antibody
45401-50ul	SAB	50ul	EUR 187

Tensin-1 Antibody
DF8622	Affbiotech	200ul	EUR 304
Description: Tensin-1 Antibody detects endogenous levels of total Tensin-1.

Tensin-2 Antibody
DF8623	Affbiotech	200ul	EUR 304
Description: Tensin-2 Antibody detects endogenous levels of total Tensin-2.

anti-Tensin 1
YF-PA15082	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Tensin 1

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Tensin 1 (TNS1) Protein
20-abx650188	Abbexa	EUR 620.00 EUR 272.00 EUR 1887.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dr. P Kit-Solution 3
K2021010-3	Biochain	50 ml	EUR 133
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

PTEN ELISA Kit| Rat Phosphatase and Tensin Homolog ELISA Kit
EF018003	Lifescience Market	96 Tests	EUR 689

Rat PTEN(Phosphatase and Tensin Homolog) ELISA Kit
ER1295	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: PTEN/MMAC1/BZS/EC 3.1.3.16,10q23del/EC 3.1.3.48/EC 3.1.3.67/GLM2/MMAC1/MMAC1 phosphatase and tensin homolog deleted on chromosome 10/MMAC1MGC11227/Mutated in multiple advanced cancers 1/phosphatase and tensin ho Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit
20-abx156022	Abbexa	EUR 6580.00 EUR 3510.00 EUR 817.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit
20-abx154591	Abbexa	EUR 6314.00 EUR 3369.00 EUR 786.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Phosphatase and Tensin Homolog (PTEN) ELISA Kit
abx255961-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit
DLR-PTEN-Mu-48T	DL Develop	48T	EUR 450
Should the Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Phosphatase And Tensin Homolog (PTEN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit
DLR-PTEN-Mu-96T	DL Develop	96T	EUR 582
Should the Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Phosphatase And Tensin Homolog (PTEN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit
DLR-PTEN-Ra-48T	DL Develop	48T	EUR 467
Should the Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phosphatase And Tensin Homolog (PTEN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit
DLR-PTEN-Ra-96T	DL Develop	96T	EUR 605
Should the Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phosphatase And Tensin Homolog (PTEN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RD-PTEN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 446

Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RD-PTEN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 615

Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RD-PTEN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 465

Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RD-PTEN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 643

Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RDR-PTEN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 465

Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RDR-PTEN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 643

Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RDR-PTEN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 486

Rat Phosphatase And Tensin Homolog (PTEN) ELISA Kit
RDR-PTEN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 672

Mouse Phosphatase And Tensin Homolog (PTEN) ELISA Kit
SEF822Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 3919.92
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phosphatase And Tensin Homolog (PTEN) in Tissue homogenates, cell lysates and other biological fluids.

Human TNS3(Tensin 3) ELISA Kit