Human TNS3(Tensin 3) ELISA Kit

Human TNS3(Tensin 3) ELISA Kit

To Order Contact us below: 

    Human Tensin 3 (TNS3) ELISA Kit
    RDR-TNS3-Hu-96Tests 96 Tests
    EUR 756
    Human Tensin 3 (TNS3) ELISA Kit
    RD-TNS3-Hu-48Tests 48 Tests
    EUR 521
    Human Tensin 3 (TNS3) ELISA Kit
    RD-TNS3-Hu-96Tests 96 Tests
    EUR 723
    Human Tensin 3 (TNS3) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Tensin- 3, TNS3 ELISA KIT
    ELI-16205h 96 Tests
    EUR 824
    Human Tensin 3(TNS3)ELISA Kit
    QY-E00275 96T
    EUR 361
    Human Tensin 3 (TNS3) ELISA Kit
    SEF819Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.
    Human Tensin 3 (TNS3) ELISA Kit
    SEF819Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.
    Human Tensin 3 (TNS3) ELISA Kit
    SEF819Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.
    Human Tensin 3 (TNS3) ELISA Kit
    SEF819Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tensin 3 (TNS3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tensin 3 (TNS3) in serum, plasma, tissue homogenates and other biological fluids.
    Human Tensin 3 (TNS3) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Tensin 3 elisa. Alternative names of the recognized antigen: TENS1
    • TEM6
    • TPP
    • Tumor Endothelial Marker 6
    • Tensin-Like SH2 Domain-Containing 1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tensin 3 (TNS3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Mouse Tensin- 3, Tns3 ELISA KIT
    ELI-46578m 96 Tests
    EUR 865
    Tensin 3 (TNS3) Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Tensin 3 (TNS3) Antibody
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Tensin-3 (TNS3) Antibody
    abx145305-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Tensin 3 (TNS3) Antibody
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Tensin-3 (TNS3) Antibody
    abx238847-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Tensin-3 (TNS3) Antibody
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Tensin 3 (TNS3) Antibody
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Recombinant Tensin 3 (TNS3)
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q68CZ2
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 37.6kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Tensin 3 expressed in: E.coli
    ELISA kit for Human TNS3 (Tensin 3)
    ELK4136 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tensin 3 (TNS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tensin 3 (TNS3). N
    • Show more
    Description: A sandwich ELISA kit for detection of Tensin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Tensin-3 (TNS3)
    KTE60173-48T 48T
    EUR 332
    • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Tensin-3 (TNS3)
    KTE60173-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Tensin-3 (TNS3)
    KTE60173-96T 96T
    EUR 539
    • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Human Tensin 3 (TNS3) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Human Tensin 3 (TNS3) Protein
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    ELISA kit for Mouse Tensin-3 (TNS3)
    KTE70085-48T 48T
    EUR 332
    • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Tensin-3 (TNS3)
    KTE70085-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Tensin-3 (TNS3)
    KTE70085-96T 96T
    EUR 539
    • Tensin-3 formed a complex with focal adhesion kinase and p130Cas (BCAR1) in human breast carcinoma cells. Addition of EGF to these cells induced dephosphorylation of FAK and p130Cas, leading to dissociation of the tensin-3/FAK/p130Cas complex and enh
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Tensin-3 (TNS3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Tensin 3 (TNS3) Polyclonal Antibody (Human)
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TNS3 (Met1~Thr301)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3)
    Tensin 3 (TNS3) Polyclonal Antibody (Human), APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TNS3 (Met1~Thr301)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with APC.
    Tensin 3 (TNS3) Polyclonal Antibody (Human), Biotinylated
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TNS3 (Met1~Thr301)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with Biotin.
    Tensin 3 (TNS3) Polyclonal Antibody (Human), Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TNS3 (Met1~Thr301)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with Cy3.
    Tensin 3 (TNS3) Polyclonal Antibody (Human), FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TNS3 (Met1~Thr301)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with FITC.
    Tensin 3 (TNS3) Polyclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TNS3 (Met1~Thr301)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with HRP.
    Tensin 3 (TNS3) Polyclonal Antibody (Human), PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TNS3 (Met1~Thr301)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with PE.
    Tensin 3 (TNS3) Polyclonal Antibody (Human), APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TNS3 (Met1~Thr301)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tensin 3 (TNS3). This antibody is labeled with APC-Cy7.
    TNS3 ELISA KIT|Human
    EF003729 96 Tests
    EUR 689
    TNS3 ELISA Kit (Human) (OKCD00479)
    OKCD00479 96 Wells
    EUR 831
    Description: Description of target: May play a role in actin remodeling. Involved in the dissociation of the integrin-tensin-actin complex. EGF activates TNS4 and down-regulates TNS3 which results in capping the tail of ITGB1. Seems to be involved in mammary cell migration. May be involved in cell migration and bone development (By similarity).By similarity1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"A reciprocal tensin-3-cten switch mediates EGF-driven mammary cell migration."_x005F_x005F_x000D_Katz M., Amit I., Citri A., Shay T., Carvalho S., Lavi S., Milanezi F., Lyass L., Amariglio N., Jacob-Hirsch J., Ben-Chetrit N., Tarcic G., Lindzen M., Avraham R., Liao Y.C., Trusk P., Lyass A., Rechavi G. , Spector N.L., Lo S.H., Schmitt F., Bacus S.S., Yarden Y._x005F_x005F_x000D_Nat. Cell Biol. 9:961-969(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INDUCTION, KNOCKDOWN IN MCF10A CELLS. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.052 ng/mL
    TNS3 ELISA Kit (Human) (OKDD00570)
    OKDD00570 96 Wells
    EUR 975
    Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL
    Human Tensin-1(TNS1) ELISA kit
    CSB-EL024032HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Tensin-1 (TNS1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Tensin-1(TNS1) ELISA kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Tensin-1(TNS1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Tensin- 4, TNS4 ELISA KIT
    ELI-16206h 96 Tests
    EUR 824
    Human Tensin-1 (TNS1) ELISA Kit
    abx383857-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Tensin-4 (TNS4) ELISA Kit
    abx383859-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Tensin- 1, TNS1 ELISA KIT
    ELI-40018h 96 Tests
    EUR 824
    Human Tensin 4(TNS4)ELISA Kit
    QY-E00274 96T
    EUR 361
    Human Tensin 2(TNS2)ELISA Kit
    QY-E00276 96T
    EUR 361
    Human Tensin 1(TNS1)ELISA Kit
    QY-E00277 96T
    EUR 361
    TNS3 antibody
    70R-20911 50 ul
    EUR 435
    Description: Rabbit polyclonal TNS3 antibody
    TNS3 Antibody
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
    TNS3 Antibody
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    TNS3 Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against TNS3. Recognizes TNS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    TNS3 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    TNS3 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Chicken Tensin, TNS ELISA KIT
    ELI-46577c 96 Tests
    EUR 928
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Anti-Tensin 3 Antibody
    EUR 370
    Tensin-3 (TENS3) Antibody
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Human TNS3 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    ELISA kit for Human Tensin-4 (TNS4)
    KTE60172-48T 48T
    EUR 332
    • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Tensin-4 (TNS4)
    KTE60172-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Tensin-4 (TNS4)
    KTE60172-96T 96T
    EUR 539
    • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Tensin-1 (TNS1)
    KTE60174-48T 48T
    EUR 332
    • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Tensin-1 (TNS1)
    KTE60174-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Tensin-1 (TNS1)
    KTE60174-96T 96T
    EUR 539
    • Tensin-1 is a protein localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecu
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tensin-1 (TNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    TNS3 sgRNA CRISPR Lentivector (Human) (Target 3)
    K2421704 1.0 ug DNA
    EUR 154
    TNS3 Polyclonal Antibody
    31406-100ul 100ul
    EUR 252
    TNS3 Polyclonal Antibody
    31406-50ul 50ul
    EUR 187
    TNS3 cloning plasmid
    CSB-CL731561HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 753
    • Sequence: atggaggagggccatgggctggacctcacttacatcacggagcgcatcatcgctgtgtccttccctgccggctgctctgaggagtcctacctgcacaacctacaggaggtcacgcgcatgctcaagtccaagcacggggacaactacctggtattaaacctttcagaaaagagata
    • Show more
    Description: A cloning plasmid for the TNS3 gene.
    TNS3 Rabbit pAb
    A7991-100ul 100 ul
    EUR 308
    TNS3 Rabbit pAb
    A7991-200ul 200 ul
    EUR 459
    TNS3 Rabbit pAb
    A7991-20ul 20 ul
    EUR 183
    TNS3 Rabbit pAb
    A7991-50ul 50 ul
    EUR 223
    anti- TNS3 antibody
    FNab08847 100µg
    EUR 548.75
    • Immunogen: tensin 3
    • Uniprot ID: Q68CZ2
    • Gene ID: 64759
    • Research Area: Cancer, Signal Transduction, Metabolism
    Description: Antibody raised against TNS3
    Anti-TNS3 antibody
    PAab08847 100 ug
    EUR 386
    Anti-TNS3 antibody
    STJ117844 100 µl
    EUR 277
    Bovine Tensin- 1, TNS1 ELISA KIT
    ELI-29174b 96 Tests
    EUR 928
    Bovine Tensin- 4, TNS4 ELISA KIT
    ELI-52065b 96 Tests
    EUR 928
    Mouse Tensin- 4, Tns4 ELISA KIT
    ELI-46579m 96 Tests
    EUR 865
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    DLR-PTEN-Hu-48T 48T
    EUR 441
    • Should the Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    DLR-PTEN-Hu-96T 96T
    EUR 570
    • Should the Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    • EUR 6173.00
    • EUR 3291.00
    • EUR 770.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    abx250957-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.
    Human Phosphatase And Tensin Homolog ELISA Kit (PTEN)
    RK02152 96 Tests
    EUR 521
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    RDR-PTEN-Hu-48Tests 48 Tests
    EUR 455
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    RDR-PTEN-Hu-96Tests 96 Tests
    EUR 629
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    RD-PTEN-Hu-48Tests 48 Tests
    EUR 436
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    RD-PTEN-Hu-96Tests 96 Tests
    EUR 601
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    SEF822Hu-10x96wellstestplate 10x96-wells test plate
    EUR 3815.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    SEF822Hu-1x48wellstestplate 1x48-wells test plate
    EUR 401.84
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    SEF822Hu-1x96wellstestplate 1x96-wells test plate
    EUR 531.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    SEF822Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2090.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phosphatase And Tensin Homolog (PTEN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phosphatase And Tensin Homolog (PTEN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Phosphatase And Tensin Homolog (PTEN) ELISA Kit
    • EUR 3866.00
    • EUR 2041.00
    • EUR 532.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Phosphatase And Tensin Homolog elisa. Alternative names of the recognized antigen: BZS
    • MHAM
    • MMAC1
    • PTEN1
    • TEP1
    • Mutated In Multiple Advanced Cancers 1
    • Phosphatidylinositol 3, 4, 5-trisphosphate 3-phosphatase and dual-specificity prot
    • Show more
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phosphatase And Tensin Homolog (PTEN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
    TNS3 ORF Vector (Human) (pORF)
    ORF010839 1.0 ug DNA
    EUR 95
    FSH (Human Follicle-stimulating hormone) ELISA test
    3 96T/Box Ask for price
    • Area of application: Hormone testing
    Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)
    ELISA kit for Rat Tensin-4 (TNS4)
    KTE100052-48T 48T
    EUR 332
    • CTEN was reduced or lost in several prostate cancers and in prostate cancer cell lines.The deduced 715-amino acid protein has a calculated molecular mass of 76.9 kD. The C terminus of CTEN shares 50% and 45% amino acid identity with the C termini of
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Tensin-4 (TNS4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Human TNS3(Tensin 3) ELISA Kit