Human NXPH1(Neurexophilin 1) ELISA Kit

Human NXPH1(Neurexophilin 1) ELISA Kit

To Order Contact us below: 

Human Neurexophilin 1 (NXPH1) ELISA Kit
RD-NXPH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Neurexophilin 1 (NXPH1) ELISA Kit
RDR-NXPH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Neurexophilin 1 (NXPH1) ELISA Kit
RDR-NXPH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Neurexophilin- 1, NXPH1 ELISA KIT
ELI-38246h	Lifescience Market	96 Tests	EUR 824

Human Neurexophilin 1 (NXPH1) ELISA Kit
20-abx152490	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Neurexophilin 1 (NXPH1) ELISA Kit
SEC672Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit
SEC672Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit
SEC672Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit
SEC672Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit
4-SEC672Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neurexophilin 1 elisa. Alternative names of the recognized antigen: NPH1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurexophilin 1 (NXPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Neurexophilin 1(NXPH1)ELISA Kit
QY-E01643	Qayee Biotechnology	96T	EUR 361

NXPH1 Human, Neurexophilin 1 Human Recombinant Protein, Sf9
PROTP58417-1	BosterBio	Regular: 10ug	EUR 317
Description: NXPH1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 259 amino acids (22-271) and having a molecular mass of 29.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;NXPH1 is fused to 9 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.

Mouse Neurexophilin- 1, Nxph1 ELISA KIT
ELI-15133m	Lifescience Market	96 Tests	EUR 865

Bovine Neurexophilin- 1, NXPH1 ELISA KIT
ELI-46103b	Lifescience Market	96 Tests	EUR 928

Mouse Neurexophilin-1 (NXPH1) ELISA Kit
abx390007-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Neurexophilin-1 (NXPH1) ELISA Kit
abx391681-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Neurexophilin-1 (NXPH1) Antibody
20-abx119118	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Neurexophilin 1 (NXPH1) Antibody
20-abx128337	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neurexophilin-1 (NXPH1) Antibody
abx034416-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody
abx034416-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody
20-abx008168	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Neurexophilin 1 (NXPH1) Antibody
20-abx173756	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Neurexophilin 1 (NXPH1) Antibody
20-abx328647	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody
abx235945-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Neurexophilin-1 (NXPH1) Antibody
20-abx301878	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Neurexophilin 1 (NXPH1)
4-RPC672Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P58417 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 58.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Neurexophilin 1 expressed in: E.coli

ELISA kit for Human NXPH1 (Neurexophilin 1)
ELK3869	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurexophilin 1 (NXPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurexophi Show more
Description: A sandwich ELISA kit for detection of Neurexophilin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neurexophilin 1 (NXPH1) CLIA Kit
20-abx493828	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Neurexophilin 1 (NXPH1) Protein
20-abx166767	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nxph1 ELISA Kit| Rat Neurexophilin-1 ELISA Kit
EF019041	Lifescience Market	96 Tests	EUR 689

Nxph1 ELISA Kit| Mouse Neurexophilin-1 ELISA Kit
EF015646	Lifescience Market	96 Tests	EUR 689

NXPH1 ELISA Kit| Bovine Neurexophilin-1 ELISA Kit
EF011654	Lifescience Market	96 Tests	EUR 689

Neurexophilin-1 (NXPH1) Antibody (HRP)
20-abx317064	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody (FITC)
20-abx317065	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody (Biotin)
20-abx317066	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-NXPH1/Neurexophilin 1 Antibody
A12696	BosterBio	100ul	EUR 397
Description: Anti-NXPH1 Antibody

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human)
4-PAC672Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NXPH1 (Ala22~Gly271) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1)

NXPH1 Neurexophilin 1 Human Recombinant Protein
PROTP58417	BosterBio	Regular: 20ug	EUR 317
Description: NXPH1 Human Recombinant produced in E. coli is. a single polypeptide chain containing 273 amino acids (22-271) and having a molecular mass of 31kDa. NXPH1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)
C495-10ug	Novoprotein	10ug	EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)
C495-1mg	Novoprotein	1mg	EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)
C495-500ug	Novoprotein	500ug	EUR 1115
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)
C495-50ug	Novoprotein	50ug	EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC
4-PAC672Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NXPH1 (Ala22~Gly271) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Biotinylated
4-PAC672Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NXPH1 (Ala22~Gly271) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Biotin.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Cy3
4-PAC672Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NXPH1 (Ala22~Gly271) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Cy3.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), FITC
4-PAC672Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NXPH1 (Ala22~Gly271) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with FITC.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), HRP
4-PAC672Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NXPH1 (Ala22~Gly271) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with HRP.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), PE
4-PAC672Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NXPH1 (Ala22~Gly271) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with PE.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC-Cy7
4-PAC672Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NXPH1 (Ala22~Gly271) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Nxph1/ Rat Nxph1 ELISA Kit
ELI-22436r	Lifescience Market	96 Tests	EUR 886

NXPH1 ELISA KIT|Human
EF001409	Lifescience Market	96 Tests	EUR 689

Anti-Neurexophilin-3 Antibody
A14597-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Neurexophilin-3 Antibody (NXPH3) detection.tested for WB in Human, Mouse, Rat.

NXPH1 ELISA Kit (Human) (OKCD00346)
OKCD00346	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May be signaling molecules that resemble neuropeptides and that act by binding to alpha-neurexins and possibly other receptors.Curated ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.062 ng/mL

NXPH1 ELISA Kit (Human) (OKDD00444)
OKDD00444	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene is a member of the neurexophilin family and encodes a secreted protein with a variable N-terminal domain, a highly conserved, N-glycosylated central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Neurexophilin 1 Protein
20-abx261262	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human Neurexophilin- 4, NXPH4 ELISA KIT
ELI-22438h	Lifescience Market	96 Tests	EUR 824

Human Neurexophilin- 3, NXPH3 ELISA KIT
ELI-22577h	Lifescience Market	96 Tests	EUR 824

Human Neurexophilin- 2, NXPH2 ELISA KIT
ELI-44563h	Lifescience Market	96 Tests	EUR 824

Human Neurexophilin 4(NXPH4)ELISA Kit
QY-E01640	Qayee Biotechnology	96T	EUR 361

Human Neurexophilin 3(NXPH3)ELISA Kit
QY-E01641	Qayee Biotechnology	96T	EUR 361

Human Neurexophilin 2(NXPH2)ELISA Kit
QY-E01642	Qayee Biotechnology	96T	EUR 361

Neurexophilin-1 Polyclonal Antibody
ES5710-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-1 Polyclonal Antibody
ES5710-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-1 Polyclonal Antibody
ABP54711-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Neurexophilin-1 Polyclonal Antibody
ABP54711-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Neurexophilin-1 Polyclonal Antibody
ABP54711-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Anti-Neurexophilin-1 antibody
STJ94423	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Neurexophilin-1.

Mouse Neurexophilin- 2, Nxph2 ELISA KIT
ELI-22437m	Lifescience Market	96 Tests	EUR 865

Mouse Neurexophilin- 3, Nxph3 ELISA KIT
ELI-22578m	Lifescience Market	96 Tests	EUR 865

Bovine Neurexophilin- 2, NXPH2 ELISA KIT
ELI-36800b	Lifescience Market	96 Tests	EUR 928

NXPH1 siRNA
20-abx903719	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NXPH1 siRNA
20-abx926696	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NXPH1 siRNA
20-abx926697	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NXPH1 antibody
70R-50970	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal NXPH1 antibody

NXPH1 antibody
70R-9330	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal NXPH1 antibody

NXPH1 Antibody
ABD4230	Lifescience Market	100 ug	EUR 438

NXPH1 Antibody
DF4230	Affbiotech	200ul	EUR 304
Description: NXPH1 Antibody detects endogenous levels of total NXPH1.

NXPH1 Antibody
1-CSB-PA009085	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

NXPH1 Antibody
1-CSB-PA016227LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human Neurexophilin-2 (NXPH2)
1-CSB-MP016228HU	Cusabio	EUR 293.00 EUR 963.00 EUR 409.00 EUR 717.00	100ug 1MG 200ug 500ug
MW: 31.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neurexophilin-2(NXPH2) expressed in Mammalian cell

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human NXPH1 shRNA Plasmid
20-abx959332	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NXPH1 Recombinant Protein (Human)
RP021991	ABM	100 ug	Ask for price

Neurexophilin 4 antibody
70R-4049	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Neurexophilin 4 antibody raised against the N terminal of NXPH4

Neurexophilin 3 antibody
70R-4470	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the N terminal of NXPH3

Neurexophilin 3 antibody
70R-4471	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the middle region of NXPH3

anti-Neurexophilin 3
YF-PA17541	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Neurexophilin 3

NXPH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1471602	ABM	1.0 ug DNA	EUR 154

NXPH1 cloning plasmid
CSB-CL016227HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 816 Sequence: atgcaggctgcgtgctggtacgtgcttttcctcctgcagcccaccgtctacttggtcacatgtgccaatttaacgaacggtggaaagtcagaacttctgaaatcaggaagcagcaaatccacactaaagcacatatggacagaaagcagcaaagacttgtctatcagccgactcct Show more
Description: A cloning plasmid for the NXPH1 gene.

anti- NXPH1 antibody
FNab05945	FN Test	100µg	EUR 548.75
Immunogen: neurexophilin 1 Uniprot ID: P58417 Gene ID: 30010 Research Area: Neuroscience
Description: Antibody raised against NXPH1

NXPH1 Blocking Peptide
20-abx063845	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Nxph1 Blocking Peptide
33R-5184	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Nxph1 antibody, catalog no. 70R-9330

NXPH1 Blocking Peptide
DF4230-BP	Affbiotech	1mg	EUR 195

Anti-NXPH1 antibody
PAab05945	Lifescience Market	100 ug	EUR 386

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

NXPH1 ORF Vector (Human) (pORF)
ORF007331	ABM	1.0 ug DNA	EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Neurexophilin-3 Polyclonal Antibody
ES2927-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Neurexophilin-3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-3 Polyclonal Antibody
ES2927-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Neurexophilin-3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-4 Polyclonal Antibody
ES2928-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Neurexophilin-4 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-4 Polyclonal Antibody
ES2928-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Neurexophilin-4 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin 3 (NXPH3) Antibody
20-abx133519	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody
20-abx008273	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody
abx026137-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody
abx026137-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody
20-abx014651	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody
20-abx014652	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody
abx029138-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody
abx029138-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neurexophilin-3 Polyclonal Antibody
ABP51928-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

Neurexophilin-3 Polyclonal Antibody
ABP51928-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

Neurexophilin-3 Polyclonal Antibody
ABP51928-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

Neurexophilin-4 Polyclonal Antibody
ABP51929-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

Neurexophilin-4 Polyclonal Antibody
ABP51929-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

Neurexophilin-4 Polyclonal Antibody
ABP51929-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270 Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

Neurexophilin 3 (NXPH3) Antibody
20-abx328392	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody
20-abx217298	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody
20-abx330186	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody
abx331086-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody
abx332816-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody
20-abx301241	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neurexophilin 4 Blocking Peptide
33R-6369	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH4 antibody, catalog no. 70R-4049

Neurexophilin 3 Blocking Peptide
33R-6733	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4471

Neurexophilin 3 Blocking Peptide
33R-7840	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4470

Anti-Neurexophilin-3 antibody
STJ94424	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Neurexophilin-3.

Anti-Neurexophilin-4 antibody
STJ94425	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Neurexophilin-4.

Anti-Neurexophilin 3 (4C8)
YF-MA17693	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Neurexophilin 3

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Rat NXPH1 shRNA Plasmid
20-abx985072	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NXPH1 protein (His tag)
80R-3672	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant NXPH1 protein (His tag)

Mouse NXPH1 shRNA Plasmid
20-abx971846	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NXPH1 Antibody, HRP conjugated
1-CSB-PA016227LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NXPH1 Antibody, FITC conjugated
1-CSB-PA016227LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NXPH1 Antibody, Biotin conjugated
1-CSB-PA016227LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NXPH1 Recombinant Protein (Rat)
RP214922	ABM	100 ug	Ask for price

NXPH1 Recombinant Protein (Mouse)
RP155579	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Nxph1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4768802	ABM	1.0 ug DNA	EUR 154

Human NXPH1(Neurexophilin 1) ELISA Kit