Human NXPH1(Neurexophilin 1) ELISA Kit

Human NXPH1(Neurexophilin 1) ELISA Kit

To Order Contact us below: 

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    RDR-NXPH1-Hu-96Tests 96 Tests
    EUR 756

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    RD-NXPH1-Hu-48Tests 48 Tests
    EUR 521

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    RD-NXPH1-Hu-96Tests 96 Tests
    EUR 723

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Neurexophilin- 1, NXPH1 ELISA KIT

    ELI-38246h 96 Tests
    EUR 824

    Human Neurexophilin 1(NXPH1)ELISA Kit

    QY-E01643 96T
    EUR 361

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    SEC672Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    SEC672Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    SEC672Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    SEC672Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

    Human Neurexophilin 1 (NXPH1) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Neurexophilin 1 elisa. Alternative names of the recognized antigen: NPH1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurexophilin 1 (NXPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    NXPH1 Human, Neurexophilin 1 Human Recombinant Protein, Sf9

    PROTP58417-1 Regular: 10ug
    EUR 317
    Description: NXPH1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 259 amino acids (22-271) and having a molecular mass of 29.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;NXPH1 is fused to 9 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.

    Mouse Neurexophilin- 1, Nxph1 ELISA KIT

    ELI-15133m 96 Tests
    EUR 865

    Bovine Neurexophilin- 1, NXPH1 ELISA KIT

    ELI-46103b 96 Tests
    EUR 928

    Rat Neurexophilin-1 (NXPH1) ELISA Kit

    abx391681-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Neurexophilin-1 (NXPH1) ELISA Kit

    abx390007-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Neurexophilin-1 (NXPH1) Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Neurexophilin-1 (NXPH1) Antibody

    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.

    Neurexophilin 1 (NXPH1) Antibody

    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Neurexophilin 1 (NXPH1) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Neurexophilin-1 (NXPH1) Antibody

    abx034416-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Neurexophilin-1 (NXPH1) Antibody

    abx034416-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Neurexophilin-1 (NXPH1) Antibody

    abx235945-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Neurexophilin 1 (NXPH1) Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neurexophilin-1 (NXPH1) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Recombinant Neurexophilin 1 (NXPH1)

    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P58417
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 58.6kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Neurexophilin 1 expressed in: E.coli

    ELISA kit for Human NXPH1 (Neurexophilin 1)

    ELK3869 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurexophilin 1 (NXPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurexophi
    • Show more
    Description: A sandwich ELISA kit for detection of Neurexophilin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Neurexophilin 1 (NXPH1) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Neurexophilin 1 (NXPH1) Protein

    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Nxph1 ELISA Kit| Rat Neurexophilin-1 ELISA Kit

    EF019041 96 Tests
    EUR 689

    Nxph1 ELISA Kit| Mouse Neurexophilin-1 ELISA Kit

    EF015646 96 Tests
    EUR 689

    NXPH1 ELISA Kit| Bovine Neurexophilin-1 ELISA Kit

    EF011654 96 Tests
    EUR 689

    Anti-NXPH1/Neurexophilin 1 Antibody

    A12696 100ul
    EUR 397
    Description: Anti-NXPH1 Antibody

    Neurexophilin-1 (NXPH1) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neurexophilin-1 (NXPH1) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neurexophilin-1 (NXPH1) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human)

    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1)

    NXPH1 Neurexophilin 1 Human Recombinant Protein

    PROTP58417 Regular: 20ug
    EUR 317
    Description: NXPH1 Human Recombinant produced in E. coli is. a single polypeptide chain containing 273 amino acids (22-271) and having a molecular mass of 31kDa. NXPH1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

    C495-10ug 10ug
    EUR 141
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

    Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

    C495-1mg 1mg
    EUR 1674
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

    Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

    C495-500ug 500ug
    EUR 1115
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

    Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

    C495-50ug 50ug
    EUR 303
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

    Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC

    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC.

    Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Biotinylated

    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Biotin.

    Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Cy3

    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Cy3.

    Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), FITC

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with FITC.

    Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), HRP

    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with HRP.

    Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), PE

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with PE.

    Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC-Cy7

    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC-Cy7.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Nxph1/ Rat Nxph1 ELISA Kit

    ELI-22436r 96 Tests
    EUR 886


    EF001409 96 Tests
    EUR 689

    Anti-Neurexophilin-3 Antibody

    A14597-1 100ul
    EUR 397
    Description: Rabbit Polyclonal Antibody for Neurexophilin-3 Antibody (NXPH3) detection.tested for WB in Human, Mouse, Rat.

    NXPH1 ELISA Kit (Human) (OKCD00346)

    OKCD00346 96 Wells
    EUR 831
    Description: Description of target: May be signaling molecules that resemble neuropeptides and that act by binding to alpha-neurexins and possibly other receptors.Curated ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.062 ng/mL

    NXPH1 ELISA Kit (Human) (OKDD00444)

    OKDD00444 96 Wells
    EUR 975
    Description: Description of target: This gene is a member of the neurexophilin family and encodes a secreted protein with a variable N-terminal domain, a highly conserved, N-glycosylated central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

    Neurexophilin 1 Protein

    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Human Neurexophilin- 4, NXPH4 ELISA KIT

    ELI-22438h 96 Tests
    EUR 824

    Human Neurexophilin- 3, NXPH3 ELISA KIT

    ELI-22577h 96 Tests
    EUR 824

    Human Neurexophilin- 2, NXPH2 ELISA KIT

    ELI-44563h 96 Tests
    EUR 824

    Human Neurexophilin 4(NXPH4)ELISA Kit

    QY-E01640 96T
    EUR 361

    Human Neurexophilin 3(NXPH3)ELISA Kit

    QY-E01641 96T
    EUR 361

    Human Neurexophilin 2(NXPH2)ELISA Kit

    QY-E01642 96T
    EUR 361

    Neurexophilin-1 Polyclonal Antibody

    ABP54711-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

    Neurexophilin-1 Polyclonal Antibody

    ABP54711-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

    Neurexophilin-1 Polyclonal Antibody

    ABP54711-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

    Neurexophilin-1 Polyclonal Antibody

    ES5710-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Neurexophilin-1 Polyclonal Antibody

    ES5710-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Anti-Neurexophilin-1 antibody

    STJ94423 200 µl
    EUR 197
    Description: Rabbit polyclonal to Neurexophilin-1.

    Mouse Neurexophilin- 2, Nxph2 ELISA KIT

    ELI-22437m 96 Tests
    EUR 865

    Mouse Neurexophilin- 3, Nxph3 ELISA KIT

    ELI-22578m 96 Tests
    EUR 865

    Bovine Neurexophilin- 2, NXPH2 ELISA KIT

    ELI-36800b 96 Tests
    EUR 928

    NXPH1 Antibody

    DF4230 200ul
    EUR 304
    Description: NXPH1 Antibody detects endogenous levels of total NXPH1.

    NXPH1 Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    NXPH1 antibody

    70R-50970 100 ul
    EUR 244
    Description: Purified Polyclonal NXPH1 antibody

    NXPH1 antibody

    70R-9330 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal NXPH1 antibody

    NXPH1 Antibody

    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

    NXPH1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NXPH1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NXPH1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NXPH1 Antibody

    ABD4230 100 ug
    EUR 438

    Human Neurexophilin-2 (NXPH2)

    • EUR 293.00
    • EUR 963.00
    • EUR 409.00
    • EUR 717.00
    • 100ug
    • 1MG
    • 200ug
    • 500ug
    • MW: 31.5 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Neurexophilin-2(NXPH2) expressed in Mammalian cell

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    Human NXPH1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    NXPH1 Recombinant Protein (Human)

    RP021991 100 ug Ask for price

    Neurexophilin 4 antibody

    70R-4049 50 ug
    EUR 467
    Description: Rabbit polyclonal Neurexophilin 4 antibody raised against the N terminal of NXPH4

    Neurexophilin 3 antibody

    70R-4470 50 ug
    EUR 467
    Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the N terminal of NXPH3

    Neurexophilin 3 antibody

    70R-4471 50 ug
    EUR 467
    Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the middle region of NXPH3

    anti-Neurexophilin 3

    YF-PA17541 50 ug
    EUR 363
    Description: Mouse polyclonal to Neurexophilin 3

    NXPH1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1471602 1.0 ug DNA
    EUR 154

    Nxph1 Blocking Peptide

    33R-5184 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Nxph1 antibody, catalog no. 70R-9330

    NXPH1 Blocking Peptide

    DF4230-BP 1mg
    EUR 195

    NXPH1 Blocking Peptide

    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    NXPH1 cloning plasmid

    CSB-CL016227HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 816
    • Sequence: atgcaggctgcgtgctggtacgtgcttttcctcctgcagcccaccgtctacttggtcacatgtgccaatttaacgaacggtggaaagtcagaacttctgaaatcaggaagcagcaaatccacactaaagcacatatggacagaaagcagcaaagacttgtctatcagccgactcct
    • Show more
    Description: A cloning plasmid for the NXPH1 gene.

    anti- NXPH1 antibody

    FNab05945 100µg
    EUR 548.75
    • Immunogen: neurexophilin 1
    • Uniprot ID: P58417
    • Gene ID: 30010
    • Research Area: Neuroscience
    Description: Antibody raised against NXPH1

    Anti-NXPH1 antibody

    PAab05945 100 ug
    EUR 386

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    NXPH1 ORF Vector (Human) (pORF)

    ORF007331 1.0 ug DNA
    EUR 95

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools


    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Neurexophilin 3 Blocking Peptide

    33R-7840 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4470

    Neurexophilin 4 Blocking Peptide

    33R-6369 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH4 antibody, catalog no. 70R-4049

    Neurexophilin 3 Blocking Peptide

    33R-6733 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4471

    Neurexophilin-2 (NXPH2) Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Neurexophilin 4 (NXPH4) Antibody

    abx026137-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Neurexophilin 4 (NXPH4) Antibody

    abx026137-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Neurexophilin-2 (NXPH2) Antibody

    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neurexophilin 3 (NXPH3) Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Neurexophilin 3 (NXPH3) Antibody

    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.

    Neurexophilin 4 (NXPH4) Antibody

    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.

    Neurexophilin 3 (NXPH3) Antibody

    abx029138-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Neurexophilin 3 (NXPH3) Antibody

    abx029138-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Neurexophilin 4 (NXPH4) Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neurexophilin 3 (NXPH3) Antibody

    abx331086-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.

    Neurexophilin 3 (NXPH3) Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neurexophilin 4 (NXPH4) Antibody

    abx332816-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.

    Neurexophilin-2 (NXPH2) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neurexophilin-3 Polyclonal Antibody

    ABP51928-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

    Neurexophilin-3 Polyclonal Antibody

    ABP51928-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

    Neurexophilin-3 Polyclonal Antibody

    ABP51928-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

    Neurexophilin-4 Polyclonal Antibody

    ABP51929-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

    Neurexophilin-4 Polyclonal Antibody

    ABP51929-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

    Neurexophilin-4 Polyclonal Antibody

    ABP51929-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
    • Applications tips:
    Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

    Neurexophilin-3 Polyclonal Antibody

    ES2927-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Neurexophilin-3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Neurexophilin-3 Polyclonal Antibody

    ES2927-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Neurexophilin-3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Neurexophilin-4 Polyclonal Antibody

    ES2928-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Neurexophilin-4 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Neurexophilin-4 Polyclonal Antibody

    ES2928-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Neurexophilin-4 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Anti-Neurexophilin-3 antibody

    STJ94424 200 µl
    EUR 197
    Description: Rabbit polyclonal to Neurexophilin-3.

    Anti-Neurexophilin-4 antibody

    STJ94425 200 µl
    EUR 197
    Description: Rabbit polyclonal to Neurexophilin-4.

    Anti-Neurexophilin 3 (4C8)

    YF-MA17693 100 ug
    EUR 363
    Description: Mouse monoclonal to Neurexophilin 3

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    Human Hexokinase-1 AssayMax ELISA Kit

    EH3101-1 96 Well Plate
    EUR 477

    Human Complexin-1 AssayMax ELISA Kit

    EC3505-1 96 Well Plate
    EUR 417

    Human Glutaredoxin-1 AssayMax ELISA Kit

    EG2153-1 96 Well Plate
    EUR 417

    NXPH1 Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    NXPH1 Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    NXPH1 Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    NXPH1 protein (His tag)

    80R-3672 100 ug
    EUR 327
    Description: Purified recombinant NXPH1 protein (His tag)

    Mouse NXPH1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat NXPH1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    NXPH1 Recombinant Protein (Mouse)

    RP155579 100 ug Ask for price

    NXPH1 Recombinant Protein (Rat)

    RP214922 100 ug Ask for price

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Nxph1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4768802 1.0 ug DNA
    EUR 154

    Human NXPH1(Neurexophilin 1) ELISA Kit