Transcriptome evaluation of leaf tissue from Bermudagrass

master-sistemisanitari-medicinenonconvenzionali

Extraction of high-quality tissue-specific RNA from London aircraft timber (Platanusacerifolia), allowing the development of a feminine inflorescence cDNA library

 

  • The London aircraft tree (PlatanusacerifoliaWilld.) has international significance as an city landscaping tree and is the topic of genetic-improvement applications for productive sterility, illness and/or insect resistance. Molecular evaluation methods are essential to such applications, however could also be impeded by particular difficulties encountered throughout nucleic acid isolation.

 

  • An in depth RNA isolation and purification protocol, primarily based on established cetyltrimethyl-ammonium bromide (CTAB) extraction methods mixed with further purification steps utilizing butanol and the ionic detergent CTAB, which overcomes these issues within the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are sure to soluble polyvinylpyrrolidone after which separated out by way of LiCl precipitation of the RNA.

 

  • Subsequently, protein- and carbohydrate-contaminants are eliminated by chloroform partitioning adopted by LiCl-mediated precipitation. The ensuing isolates of RNA have been discovered to be of enough high quality for profitable use in reverse transcription PCR evaluation.

 

  • Moreover, RNA isolates from feminine inflorescences have been used for the development of a cDNA library. This library was discovered to include a number of full-length cDNA clones of MADS-box genes, according to the library being consultant of inflorescence expression profiles.
master-sistemisanitari-medicinenonconvenzionali

master-sistemisanitari-medicinenonconvenzionali

LILRB2 Antibody

1-CSB-PA943186
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

LILRB2 Antibody

DF9604 200ul
EUR 304
Description: LILRB2 Antibody detects endogenous levels of total LILRB2.

LILRB2 Antibody

1-CSB-PA013000LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:20-1:200

LILRB2 siRNA

20-abx922560
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LILRB2 Antibody

ABD9604 100 ug
EUR 438

anti-LILRB2

YF-PA16864 50 ul
EUR 363
Description: Mouse polyclonal to LILRB2

anti-LILRB2

YF-PA16865 50 ug
EUR 363
Description: Mouse polyclonal to LILRB2

anti-LILRB2

YF-PA16866 100 ug
EUR 403
Description: Rabbit polyclonal to LILRB2

LILRB2 Rabbit pAb

A10135-100ul 100 ul
EUR 308

LILRB2 Rabbit pAb

A10135-200ul 200 ul
EUR 459

LILRB2 Rabbit pAb

A10135-20ul 20 ul
EUR 183

LILRB2 Rabbit pAb

A10135-50ul 50 ul
EUR 223

LILRB2 Rabbit pAb

A12157-100ul 100 ul
EUR 308

LILRB2 Rabbit pAb

A12157-200ul 200 ul
EUR 459

LILRB2 Rabbit pAb

A12157-20ul 20 ul
EUR 183

LILRB2 Rabbit pAb

A12157-50ul 50 ul
EUR 223

LILRB2 Blocking Peptide

DF9604-BP 1mg
EUR 195

LILRB2 Conjugated Antibody

C35791 100ul
EUR 397

LILRB2 cloning plasmid

CSB-CL839793HU-10ug 10ug
EUR 612
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1797
  • Sequence: atgacccccatcgtcacagtcctgatctgtctcgggctgagtctgggccccaggacccacgtgcagacagggaccatccccaagcccaccctgtgggctgagccagactctgtgatcacccaggggagtcccgtcaccctcagttgtcaggggagccttgaagcccaggagtacc
  • Show more
Description: A cloning plasmid for the LILRB2 gene.

pDONR223-LILRB2 Plasmid

PVTB00316 2 ug
EUR 356

Anti-LILRB2 antibody

STJ112174 100 µl
EUR 277
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 antibody

STJ114050 100 µl
EUR 277
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 (1D4)

YF-MA17235 100 ug
EUR 363
Description: Mouse monoclonal to LILRB2

Human LILRB2 ELISA KIT

ELI-27802h 96 Tests
EUR 824

Human LILRB2 ELISA Kit

ELA-E7745h 96 Tests
EUR 824

LILRB2 ELISA KIT|Human

EF006426 96 Tests
EUR 689

LILRB2 Polyclonal Conjugated Antibody

C41960 100ul
EUR 397

LILRB2 Antibody, HRP conjugated

1-CSB-PA013000LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LILRB2 Antibody, FITC conjugated

1-CSB-PA013000LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LILRB2 Antibody, Biotin conjugated

1-CSB-PA013000LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LILRB2 shRNA Plasmid

20-abx956969
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LILRB2 Recombinant Protein (Human)

RP017797 100 ug Ask for price

Human CellExp? LILRB2, human recombinant

P1147-10
EUR 131

Human CellExp? LILRB2, human recombinant

P1147-50
EUR 403

LILRB2 ORF Vector (Human) (pORF)

ORF005933 1.0 ug DNA
EUR 95

LILRB2 ELISA Kit (Human) (OKEH01827)

OKEH01827 96 Wells
EUR 727
Description: Description of target: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Recombinant Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)

4-RPB153Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8N423
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.4kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 expressed in: E.coli

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

Polyclonal LILRB2 antibody - C-terminal region

APR01570G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LILRB2 - C-terminal region. This antibody is tested and proven to work in the following applications:

LILRB2 sgRNA CRISPR Lentivector set (Human)

K1215401 3 x 1.0 ug
EUR 339

Recombinant Human LILRB2/CD85d/ILT4 Protein

RP00262 10 μg
EUR 149

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1215402 1.0 ug DNA
EUR 154

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1215403 1.0 ug DNA
EUR 154

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1215404 1.0 ug DNA
EUR 154

LILRB2 Protein Vector (Human) (pPB-C-His)

PV023729 500 ng
EUR 329

LILRB2 Protein Vector (Human) (pPB-N-His)

PV023730 500 ng
EUR 329

LILRB2 Protein Vector (Human) (pPM-C-HA)

PV023731 500 ng
EUR 329

LILRB2 Protein Vector (Human) (pPM-C-His)

PV023732 500 ng
EUR 329

LILRB2 3'UTR GFP Stable Cell Line

TU062462 1.0 ml
EUR 1394

LILRB2 3'UTR Luciferase Stable Cell Line

TU012462 1.0 ml
EUR 1394

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

Transcriptome evaluation of leaf tissue from Bermudagrass (Cynodondactylon) utilizing a normalised cDNA library

 

A normalised cDNA library was constructed from Bermudagrass to achieve perception into the transcriptome of Cynodondactylon L. A complete of 15 588 high-high quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Analysis Gene Indices clustering instruments to provide a unigene set.

 

A complete of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation process was efficient. A big-scale comparative genomic evaluation of the unigenes was carried out utilizing publicly obtainable instruments, reminiscent of BLAST, InterProScan and Gene Ontology. The unigenes have been additionally subjected to a seek for EST-derived easy sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), that are helpful as DNA markers.

 

Though the candidate EST-SSRs and CISPs discovered within the current examine should be empirically examined, they’re anticipated to be helpful as DNA markers for a lot of functions, together with comparative genomic research of grass species, by advantage of their vital similarities to EST sequences from different grasses. Thus, data of Cynodon ESTs will empower turfgrass analysis by offering homologues for genes which are thought to confer vital features in different crops.

 

Lengthy-read cDNA Sequencing Allows a ‘Gene-Like’ Transcript Annotation of Transposable Parts

 

  • Transcript-based annotations of genes facilitate each genome-wide analyses and detailed single locus analysis. In distinction, transposable factor (TE) annotations are rudimentary, consisting of knowledge solely on TE location and sort. The repetitiveness and restricted annotation of TEs prevents the power to tell apart between doubtlessly useful expressed parts and degraded copies.

 

  • To enhance genome-wide TE bioinformatics, we carried out long-read sequencing of cDNAs from Arabidopsis thaliana strains poor in a number of layers of TE repression. These uniquely-mapping transcripts have been used to establish the set of TEs capable of generate polyadenylated RNAs and create a brand new transcript-based annotation of TEs that we have now layered upon the present high-quality neighborhood normal annotation.

 

  • We used this annotation to cut back the bioinformatic complexity related to multi-mapping reads from short-read RNA-seq experiments, and we present that this enchancment is expanded in a TE-rich genome reminiscent of maize. Our TE annotation additionally allows the testing of particular standing hypotheses within the TE discipline.

 

  • We display that incorrect TE splicing doesn’t set off small RNA manufacturing, and the cell extra strongly targets DNA methylation to TEs which have the potential to make mRNAs. This work supplies a brand new transcript-based TE annotation for Arabidopsis and maize, which serves as a blueprint to cut back the bioinformatic complexity related to repetitive TEs in any organism.

 

GTPBP8 siRNA
20-abx918914
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GTPBP8 siRNA
20-abx918915
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GTPBP8 Polyclonal Antibody
29768-100ul 100ul
EUR 252
GTPBP8 Polyclonal Antibody
29768-50ul 50ul
EUR 187
GTPBP8 Rabbit pAb
A16189-100ul 100 ul
EUR 308
GTPBP8 Rabbit pAb
A16189-200ul 200 ul
EUR 459
GTPBP8 Rabbit pAb
A16189-20ul 20 ul
EUR 183
GTPBP8 Rabbit pAb
A16189-50ul 50 ul
EUR 223
GTPBP8 cloning plasmid
CSB-CL818697HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
GTPBP8 cloning plasmid
CSB-CL818697HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 855
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
Anti-GTPBP8 antibody
STJ118642 100 µl
EUR 277
Rat GTPBP8 shRNA Plasmid
20-abx990090
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GTPBP8 shRNA Plasmid
20-abx975375
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GTPBP8 Polyclonal Conjugated Antibody
C29768 100ul
EUR 397
Human GTPBP8 shRNA Plasmid
20-abx959177
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GTPBP8 Recombinant Protein (Human)
RP014239 100 ug Ask for price
GTPBP8 Recombinant Protein (Human)
RP014242 100 ug Ask for price
GTPBP8 Recombinant Protein (Rat)
RP203999 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140480 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140483 100 ug Ask for price
Gtpbp8 ORF Vector (Rat) (pORF)
ORF068001 1.0 ug DNA
EUR 506
GTPBP8 ORF Vector (Human) (pORF)
ORF004747 1.0 ug DNA
EUR 95
GTPBP8 ORF Vector (Human) (pORF)
ORF004748 1.0 ug DNA
EUR 95
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046828 1.0 ug DNA
EUR 506
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046829 1.0 ug DNA
EUR 506
cDNA Synthesis SuperMix
20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
Evo? cDNA Kit
M1164-100
EUR 294
Evo? cDNA Kit
M1164-25
EUR 234
Novo? cDNA Kit
M1165-100
EUR 354
Novo? cDNA Kit
M1165-25
EUR 267
Evo? cDNA Supermix
M1168-100
EUR 381
Evo? cDNA Supermix
M1168-25
EUR 267
Novo? cDNA Supermix
M1169-100
EUR 441
Novo? cDNA Supermix
M1169-25
EUR 289
Gtpbp8 sgRNA CRISPR Lentivector set (Rat)
K7385901 3 x 1.0 ug
EUR 339
Gtpbp8 sgRNA CRISPR Lentivector set (Mouse)
K4112501 3 x 1.0 ug
EUR 339
GTPBP8 sgRNA CRISPR Lentivector set (Human)
K0919501 3 x 1.0 ug
EUR 339
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA Probe Diluent Solution
AR0063 5mL
EUR 106
cDNA from Arteriosclerosis: Aorta
C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Artery
C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Arteriosclerosis: Artery
C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Vein
C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Colon
C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Heart
C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Heart
C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Kidney
C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Kidney
C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Liver
C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Asthma: Lung
C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Bronchitis: Lung
C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Emphysema: Lung
C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Pneumonia: Lung
C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Lung
C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Pancreas
C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Spleen
C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: stomach
C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Tetro cDNA Synthesis Kit
BIO-65042 30 Reactions Ask for price
Tetro cDNA Synthesis Kit
BIO-65043 100 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053 50 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053/S Sample Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65054 250 Reactions Ask for price
OneScriptPlus cDNA Synthesis Kit
G235 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis Kit
G236 100 x 20 ul reactions
EUR 169
OneScriptPlus cDNA Synthesis SuperMix
G453 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis SuperMix
G454 100 x 20 ul reactions
EUR 169
circRNA cDNA Synthesis Kit
G627 25 rxn (20 ul/rxn)
EUR 309
Human eNOS cDNA probe
eNOS51-D-2 2 ug
EUR 445
Novo? Transcriptome cDNA Kit
M1167-100
EUR 952
Novo? Transcriptome cDNA Kit
M1167-25
EUR 441
Plant Tissue cDNA: Arabidopsis
PC34-310 10 rxn
EUR 415
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7385902 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7385903 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7385904 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4112502 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4112503 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4112504 1.0 ug DNA
EUR 154
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0919502 1.0 ug DNA
EUR 154
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0919503 1.0 ug DNA
EUR 154
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0919504 1.0 ug DNA
EUR 154
GTPBP8 Protein Vector (Rat) (pPB-C-His)
PV272002 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPB-N-His)
PV272003 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPM-C-HA)
PV272004 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPM-C-His)
PV272005 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPB-C-His)
PV187310 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPB-N-His)
PV187311 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPM-C-HA)
PV187312 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPM-C-His)
PV187313 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPB-C-His)
PV187314 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPB-N-His)
PV187315 500 ng
EUR 603