Mouse IL17B(Interleukin 17B) ELISA Kit

Mouse IL17B(Interleukin 17B) ELISA Kit

To Order Contact us below: 

Mouse Interleukin 17B (IL17B) ELISA Kit
RD-IL17B-Mu-48Tests	Reddot Biotech	48 Tests	EUR 450

Mouse Interleukin 17B (IL17B) ELISA Kit
RD-IL17B-Mu-96Tests	Reddot Biotech	96 Tests	EUR 622

Mouse Interleukin 17B (IL17B) ELISA Kit
RDR-IL17B-Mu-48Tests	Reddot Biotech	48 Tests	EUR 470

Mouse Interleukin 17B (IL17B) ELISA Kit
RDR-IL17B-Mu-96Tests	Reddot Biotech	96 Tests	EUR 651

Human Interleukin 17B (IL17B) ELISA Kit
DLR-IL17B-Hu-48T	DL Develop	48T	EUR 444
Should the Human Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit
DLR-IL17B-Hu-96T	DL Develop	96T	EUR 573
Should the Human Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit
DLR-IL17B-Ra-48T	DL Develop	48T	EUR 475
Should the Rat Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit
DLR-IL17B-Ra-96T	DL Develop	96T	EUR 616
Should the Rat Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit
RD-IL17B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 439

Human Interleukin 17B (IL17B) ELISA Kit
RD-IL17B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 606

Rat Interleukin 17B (IL17B) ELISA Kit
RD-IL17B-Ra-48Tests	Reddot Biotech	48 Tests	EUR 473

Rat Interleukin 17B (IL17B) ELISA Kit
RD-IL17B-Ra-96Tests	Reddot Biotech	96 Tests	EUR 655

Human Interleukin 17B (IL17B) ELISA Kit
RDR-IL17B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 458

Human Interleukin 17B (IL17B) ELISA Kit
RDR-IL17B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 633

Rat Interleukin 17B (IL17B) ELISA Kit
RDR-IL17B-Ra-48Tests	Reddot Biotech	48 Tests	EUR 495

Rat Interleukin 17B (IL17B) ELISA Kit
RDR-IL17B-Ra-96Tests	Reddot Biotech	96 Tests	EUR 685

Mouse Interleukin 17B (IL17B) ELISA Kit
abx574963-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Il17b/ Interleukin-17B ELISA Kit
E0754Mo	Sunlong	1 Kit	EUR 546

Mouse Interleukin- 17B, Il17b ELISA KIT
ELI-06754m	Lifescience Market	96 Tests	EUR 865

Mouse Interleukin 17B (IL17B) ELISA Kit
20-abx154238	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Interleukin-17B(IL17B) ELISA kit
CSB-EL011598MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin-17B (IL17B) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin-17B(IL17B) ELISA kit
1-CSB-EL011598MO	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin-17B(IL17B) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Interleukin 17B (IL17B) ELISA Kit
SEB700Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit
SEB700Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit
SEB700Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit
SEB700Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit
4-SEB700Mu	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20 Cytokine Zcyto7 Neuronal interleukin-17-related factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Interleukin 17B ELISA Kit (IL17B)
RK02934	Abclonal	96 Tests	EUR 521

Mouse Interleukin 17B (IL17B) Protein
20-abx653985	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Interleukin 17B (IL17B) Protein
20-abx653986	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Interleukin 17B (IL17B) CLIA Kit
20-abx190529	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Interleukin 17B (IL17B)CLIA Kit
SCB700Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5804.88
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B)CLIA Kit
SCB700Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 565.7
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B)CLIA Kit
SCB700Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 765.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B)CLIA Kit
SCB700Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3143.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) CLIA Kit
4-SCB700Mu	Cloud-Clone	EUR 5855.00 EUR 3144.00 EUR 766.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 17B Clia kit. Alternative names of the recognized antigen: IL-20 Cytokine Zcyto7 Neuronal interleukin-17-related factor
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B)Serum, plasma and other biological fluids

ELISA kit for Mouse IL17B (Interleukin 17B)
ELK4007	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 17B (IL17B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki Show more
Description: A sandwich ELISA kit for detection of Interleukin 17B from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Active Interleukin 17B (IL17B)
4-APB700Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UHF5 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.1kDa Isoelectric Point: 9.7
Description: Recombinant Human Interleukin 17B expressed in: E.coli

Interleukin 17B (IL17B) Antibody
20-abx101512	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 17B (IL17B) Antibody
20-abx101513	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 17B (IL17B) Antibody
abx038115-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Interleukin 17B (IL17B) Antibody
20-abx173104	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Interleukin 17B (IL17B) Antibody
20-abx173105	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

Interleukin 17B (IL17B) Antibody
20-abx177117	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Interleukin 17B (IL17B) Antibody
20-abx177118	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Interleukin 17B (IL17B) Antibody
20-abx216191	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Interleukin 17B (IL17B) Antibody
20-abx330118	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Interleukin 17B (IL17B) Antibody
abx234226-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Recombinant Interleukin 17B (IL17B)
4-RPB700Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UHF5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.0kDa Isoelectric Point: 9.7
Description: Recombinant Human Interleukin 17B expressed in: E.coli

Recombinant Interleukin 17B (IL17B)
4-RPB700Ra01	Cloud-Clone	EUR 508.58 EUR 239.00 EUR 1632.16 EUR 610.72 EUR 1121.44 EUR 403.00 EUR 3930.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: G3V8K9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: 9.5
Description: Recombinant Rat Interleukin 17B expressed in: E.coli

Human Interleukin 17B (IL17B) ELISA Kit
abx574703-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human IL17B/ Interleukin-17B ELISA Kit
E1264Hu	Sunlong	1 Kit	EUR 571

Human IL17B(Interleukin-17B) ELISA Kit
EH2104	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: Q9UHF5 Alias: IL17B/Cytokine Zcyto7/cytokine-like protein ZCYTO7/IL-17Binterleukin-17 beta/IL20/IL-20interleukin-17B/interleukin 17B/interleukin 20/Interleukin-20/MGC138900/MGC138901/neuronal interleukin-1 Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin- 17B, IL17B ELISA KIT
ELI-06753h	Lifescience Market	96 Tests	EUR 824

Rat Interleukin 17B (IL17B) ELISA Kit
20-abx155721	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 17B (IL17B) ELISA Kit
20-abx152021	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 17B (IL17B) ELISA Kit
SEB700Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit
SEB700Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit
SEB700Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit
SEB700Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit
4-SEB700Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20 Cytokine Zcyto7 Neuronal interleukin-17-related factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Interleukin 17B (IL17B) ELISA Kit
SEB700Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4875.49
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit
SEB700Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 489.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit
SEB700Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 655.94
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit
SEB700Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2651.73
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit
4-SEB700Ra	Cloud-Clone	EUR 4926.00 EUR 2602.00 EUR 656.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20 Cytokine Zcyto7 Neuronal interleukin-17-related factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Interleukin 17B ELISA Kit (IL17B)
RK03755	Abclonal	96 Tests	EUR 521

Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
MEB700Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5523.45
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 17B (IL17B).

Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
MEB700Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 542.52
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 17B (IL17B).

Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
MEB700Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 732.17
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 17B (IL17B).

Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
MEB700Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2994.77
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 17B (IL17B).

Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
4-MEB700Mu	Cloud-Clone	EUR 5574.00 EUR 2945.00 EUR 733.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20 Cytokine Zcyto7 Neuronal interleukin-17-related factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 17B (IL17B) in samples from n/a with no significant corss-reactivity with analogues from other species.

ELISA kit for Human IL17B (Interleukin 17B)
ELK2702	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 17B (IL17B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki Show more
Description: A sandwich ELISA kit for detection of Interleukin 17B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat IL17B (Interleukin 17B)
ELK5674	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 17B (IL17B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki Show more
Description: A sandwich ELISA kit for detection of Interleukin 17B from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Interleukin 17B (IL17B) CLIA Kit
20-abx190244	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Interleukin 17B (IL17B) CLIA Kit
20-abx190699	Abbexa	EUR 8443.00 EUR 4497.00 EUR 1036.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 17B (IL17B)CLIA Kit
SCB700Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B)CLIA Kit
SCB700Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B)CLIA Kit
SCB700Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B)CLIA Kit
SCB700Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) CLIA Kit
4-SCB700Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 17B Clia kit. Alternative names of the recognized antigen: IL-20 Cytokine Zcyto7 Neuronal interleukin-17-related factor
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B)Serum, plasma and other biological fluids

Rat Interleukin 17B (IL17B)CLIA Kit
SCB700Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 6119.04
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B)CLIA Kit
SCB700Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 591.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B)CLIA Kit
SCB700Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 802.24
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B)CLIA Kit
SCB700Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3310.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) CLIA Kit
4-SCB700Ra	Cloud-Clone	EUR 6170.00 EUR 3311.00 EUR 803.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 17B Clia kit. Alternative names of the recognized antigen: IL-20 Cytokine Zcyto7 Neuronal interleukin-17-related factor
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B)Serum, plasma and other biological fluids

Rat Interleukin 17B (IL17B) Protein
20-abx067473	Abbexa	EUR 704.00 EUR 286.00 EUR 2193.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Interleukin 17B (IL17B) Protein
20-abx067475	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Interleukin 17B (IL17B) Protein (Active)
20-abx651382	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 17B (IL17B) Polyclonal Antibody (Human)
4-PAB700Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Gln21~Phe180) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B)

Interleukin 17B (IL17B) Polyclonal Antibody (Rat)
4-PAB700Ra01	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Arg23~Phe180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B)

Interleukin 17B (IL17B) Polyclonal Antibody (Human), APC
4-PAB700Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Gln21~Phe180) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with APC.

Interleukin 17B (IL17B) Polyclonal Antibody (Human), Biotinylated
4-PAB700Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Gln21~Phe180) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with Biotin.

Interleukin 17B (IL17B) Polyclonal Antibody (Human), Cy3
4-PAB700Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Gln21~Phe180) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with Cy3.

Interleukin 17B (IL17B) Polyclonal Antibody (Human), FITC
4-PAB700Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Gln21~Phe180) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with FITC.

Interleukin 17B (IL17B) Polyclonal Antibody (Human), HRP
4-PAB700Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Gln21~Phe180) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with HRP.

Interleukin 17B (IL17B) Polyclonal Antibody (Human), PE
4-PAB700Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Gln21~Phe180) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with PE.

Interleukin 17B (IL17B) Polyclonal Antibody (Rat), APC
4-PAB700Ra01-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Arg23~Phe180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with APC.

Interleukin 17B (IL17B) Polyclonal Antibody (Rat), Biotinylated
4-PAB700Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Arg23~Phe180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with Biotin.

Interleukin 17B (IL17B) Polyclonal Antibody (Rat), Cy3
4-PAB700Ra01-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Arg23~Phe180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with Cy3.

Interleukin 17B (IL17B) Polyclonal Antibody (Rat), FITC
4-PAB700Ra01-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Arg23~Phe180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with FITC.

Interleukin 17B (IL17B) Polyclonal Antibody (Rat), HRP
4-PAB700Ra01-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Arg23~Phe180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with HRP.

Interleukin 17B (IL17B) Polyclonal Antibody (Rat), PE
4-PAB700Ra01-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Arg23~Phe180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with PE.

Mouse Interleukin 17B(IL-17B)ELISA Kit
QY-E20839	Qayee Biotechnology	96T	EUR 361

IL17B Human, Interleukin-17B Human Recombinant Protein, Sf9
PROTQ9UHF5-2	BosterBio	Regular: 5ug	EUR 317
Description: IL17B Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 169 amino acids (21-180a.a.) and having a molecular mass of 19.2kDa (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). IL17B is expressed with a 6 amino acid His-tag at C-Terminus and purified by proprietary chromatographic techniques.

Interleukin 17B (IL17B) Polyclonal Antibody (Human), APC-Cy7
4-PAB700Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Gln21~Phe180) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with APC-Cy7.

Interleukin 17B (IL17B) Polyclonal Antibody (Rat), APC-Cy7
4-PAB700Ra01-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL17B (Arg23~Phe180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with APC-Cy7.

IL17B Human, Interleukin-17B Human Recombinant Protein, His Tag
PROTQ9UHF5	BosterBio	Regular: 25ug	EUR 317
Description: IL17B Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 185 amino acids (21-180) and having a molecular mass of 20kDa.;IL17B is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Interleukin 17B,IL-17B ELISA Kit
201-12-2166	SunredBio	96 tests	EUR 440
This Interleukin 17B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 17B(IL-17B)ELISA Kit
QY-E04321	Qayee Biotechnology	96T	EUR 361

Rat Interleukin 17B(IL-17B)ELISA Kit
QY-E10619	Qayee Biotechnology	96T	EUR 361

ELISA kit for Mouse Interleukin-17B
EK4288	SAB	96 tests	EUR 469
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Interleukin-17B in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Interleukin-17B
EK4287	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-17B in samples from serum, plasma, tissue homogenates and other biological fluids.

IL-17B Interleukin 17B Human Recombinant Protein
PROTQ9UHF5-1	BosterBio	Regular: 25ug	EUR 317
Description: Interleukin-17B Human Recombinant produced in E.Coli is a homodimeric, non-disulfide-linked polypeptide chain containing a total of 322 amino acids (2 chains of 161aa) and having a molecular mass of 36.5kDa. The IL-17B is purified by proprietary chromatographic techniques.

IL17B ELISA Kit (Mouse) (OKAN04722)
OKAN04722	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.8 pg/mL

IL17B ELISA Kit (Mouse) (OKCD07611)
OKCD07611	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.8pg/mL

IL17B ELISA Kit (Mouse) (OKEH03000)
OKEH03000	Aviva Systems Biology	96 Wells	EUR 544
Description: Description of target: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.69 pg/mL

Recombinant Human Interleukin-17B/IL-17B (C-Fc)
CB78-10ug	Novoprotein	10ug	EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-17B/IL-17B (C-Fc)
CB78-1mg	Novoprotein	1mg	EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-17B/IL-17B (C-Fc)
CB78-500ug	Novoprotein	500ug	EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Interleukin-17B/IL-17B (C-Fc)
CB78-50ug	Novoprotein	50ug	EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human IL17B/ IL-17B Protein, Untagged, E.coli-100ug
QP10305-ec-100ug	EnQuireBio	100ug	EUR 988

Recombinant Human IL17B/ IL-17B Protein, Untagged, E.coli-250ug
QP10305-ec-250ug	EnQuireBio	250ug	EUR 1731

Recombinant Human IL17B/ IL-17B Protein, Untagged, E.coli-25ug
QP10305-ec-25ug	EnQuireBio	25ug	EUR 290

Recombinant Human IL17B/ IL-17B Protein, Untagged, E.coli-5ug
QP10305-ec-5ug	EnQuireBio	5ug	EUR 154

Human IL17B ELISA Kit
ELA-E2103h	Lifescience Market	96 Tests	EUR 824

IL17B ELISA KIT|Human
EF006182	Lifescience Market	96 Tests	EUR 689

IL17B Chemi-Luminescent ELISA Kit (Mouse) (OKCD03622)
OKCD03622	Aviva Systems Biology	96 Wells	EUR 1027
Description: Description of target: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Human Interleukin17B (IL17B) ELISA Kit
CSB-E15918h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin17B (IL17B) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin17B (IL17B) ELISA Kit
1-CSB-E15918h	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin17B (IL17B) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

IL17B ELISA Kit (Rat) (OKCD00176)
OKCD00176	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.4 pg/mL

IL17B ELISA Kit (Human) (OKCD07610)
OKCD07610	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse IL17B shRNA Plasmid
20-abx974610	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IL17B Antibody
ABD8979	Lifescience Market	100 ug	EUR 438

IL17B Protein
20-abx260754	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

IL17B Protein
20-abx260760	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

IL17B siRNA
20-abx920420	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IL17B siRNA
20-abx920421	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IL17B antibody
70R-IR035	Fitzgerald	50 ug	EUR 273
Description: Affinity purified Rabbit polyclonal IL17B antibody

IL17B Antibody
45629-100ul	SAB	100ul	EUR 252

IL17B Antibody
45629-50ul	SAB	50ul	EUR 187

IL17B protein
30R-AI110	Fitzgerald	25 ug	EUR 273
Description: Purified recombinant Human IL17B protein

IL17B Antibody
DF8979	Affbiotech	200ul	EUR 304
Description: IL17B Antibody detects endogenous levels of total IL17B.

IL17B Antibody
1-CSB-PA648539	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against IL17B. Recognizes IL17B from Human, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

anti-IL17B
YF-PA18411	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to IL17B

anti-IL17B
YF-PA26051	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to IL17B

Il17b ORF Vector (Mouse) (pORF)
ORF047816	ABM	1.0 ug DNA	EUR 506

IL17B Chemi-Luminescent ELISA Kit (Rat) (OKCD03620)
OKCD03620	Aviva Systems Biology	96 Wells	EUR 1066
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

IL17B Chemi-Luminescent ELISA Kit (Human) (OKCD03621)
OKCD03621	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

IL17B ELISA Kit (Human) : 96 Wells (OKEH02787)
OKEH02787	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The protein encoded by this gene is a T cell-derived cytokine that shares sequence similarity with IL17. This cytokine was reported to stimulate the release of TNF alpha (TNF) and IL1 beta (IL1B) from a monocytic cell line. Immunohistochemical analysis of several nerve tissues indicated that this cytokine is primarily localized to neuronal cell bodies. Alternative splicing results in multiple splice variants. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

pET- 17b
PVT0056	Lifescience Market	2 ug	EUR 241

Mouse Serine/threonine-Protein Kinase 17B (STK17B) ELISA Kit
abx556142-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse A- kinase anchor protein 17B, Akap17b ELISA KIT
ELI-24148m	Lifescience Market	96 Tests	EUR 865

Mouse Serine/threonine- protein kinase 17B, Stk17b ELISA KIT
ELI-53296m	Lifescience Market	96 Tests	EUR 865

IL17B Conjugated Antibody
C45629	SAB	100ul	EUR 397

Anti-IL17B Antibody
A10846-2	BosterBio	100ug/vial	EUR 294

Anti-IL17B Antibody
A10846-3	BosterBio	100ug/vial	EUR 294

IL17B Blocking Peptide
DF8979-BP	Affbiotech	1mg	EUR 195

IL17B cloning plasmid
CSB-CL890693HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 543 Sequence: ATGGACTGGCCTCACAACCTGCTGTTTCTTCTTACCATTTCCATCTTCCTGGGGCTGGGCCAGCCCAGGAGCCCCAAAAGCAAGAGGAAGGGGCAAGGGCGGCCTGGGCCCCTGGCCCCTGGCCCTCACCAGGTGCCACTGGACCTGGTGTCACGGATGAAACCGTATGCCCGCAT Show more
Description: A cloning plasmid for the IL17B gene.

Mouse IL17B(Interleukin 17B) ELISA Kit