Mouse IL17B(Interleukin 17B) ELISA Kit

Mouse IL17B(Interleukin 17B) ELISA Kit

To Order Contact us below: 

    Mouse Interleukin 17B (IL17B) ELISA Kit
    RDR-IL17B-Mu-48Tests 48 Tests
    EUR 470

    Mouse Interleukin 17B (IL17B) ELISA Kit
    RDR-IL17B-Mu-96Tests 96 Tests
    EUR 651

    Mouse Interleukin 17B (IL17B) ELISA Kit
    RD-IL17B-Mu-48Tests 48 Tests
    EUR 450

    Mouse Interleukin 17B (IL17B) ELISA Kit
    RD-IL17B-Mu-96Tests 96 Tests
    EUR 622

    Human Interleukin 17B (IL17B) ELISA Kit
    DLR-IL17B-Hu-48T 48T
    EUR 444
    • Should the Human Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

    Human Interleukin 17B (IL17B) ELISA Kit
    DLR-IL17B-Hu-96T 96T
    EUR 573
    • Should the Human Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

    Rat Interleukin 17B (IL17B) ELISA Kit
    DLR-IL17B-Ra-48T 48T
    EUR 475
    • Should the Rat Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

    Rat Interleukin 17B (IL17B) ELISA Kit
    DLR-IL17B-Ra-96T 96T
    EUR 616
    • Should the Rat Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

    Human Interleukin 17B (IL17B) ELISA Kit
    RDR-IL17B-Hu-48Tests 48 Tests
    EUR 458

    Human Interleukin 17B (IL17B) ELISA Kit
    RDR-IL17B-Hu-96Tests 96 Tests
    EUR 633

    Rat Interleukin 17B (IL17B) ELISA Kit
    RDR-IL17B-Ra-48Tests 48 Tests
    EUR 495

    Rat Interleukin 17B (IL17B) ELISA Kit
    RDR-IL17B-Ra-96Tests 96 Tests
    EUR 685

    Human Interleukin 17B (IL17B) ELISA Kit
    RD-IL17B-Hu-48Tests 48 Tests
    EUR 439

    Human Interleukin 17B (IL17B) ELISA Kit
    RD-IL17B-Hu-96Tests 96 Tests
    EUR 606

    Rat Interleukin 17B (IL17B) ELISA Kit
    RD-IL17B-Ra-48Tests 48 Tests
    EUR 473

    Rat Interleukin 17B (IL17B) ELISA Kit
    RD-IL17B-Ra-96Tests 96 Tests
    EUR 655

    Mouse Interleukin 17B (IL17B) ELISA Kit
    20-abx154238
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Il17b/ Interleukin-17B ELISA Kit
    E0754Mo 1 Kit
    EUR 546

    Mouse Interleukin- 17B, Il17b ELISA KIT
    ELI-06754m 96 Tests
    EUR 865

    Mouse Interleukin-17B(IL17B) ELISA kit
    CSB-EL011598MO-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin-17B (IL17B) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Mouse Interleukin-17B(IL17B) ELISA kit
    1-CSB-EL011598MO
    • EUR 703.00
    • EUR 4843.00
    • EUR 2570.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin-17B(IL17B) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Mouse Interleukin 17B (IL17B) ELISA Kit
    abx574963-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Mouse Interleukin 17B (IL17B) ELISA Kit
    SEB700Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4626.78
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Mouse Interleukin 17B (IL17B) ELISA Kit
    SEB700Mu-1x48wellstestplate 1x48-wells test plate
    EUR 468.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Mouse Interleukin 17B (IL17B) ELISA Kit
    SEB700Mu-1x96wellstestplate 1x96-wells test plate
    EUR 626.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Mouse Interleukin 17B (IL17B) ELISA Kit
    SEB700Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2520.06
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Mouse Interleukin 17B (IL17B) ELISA Kit
    4-SEB700Mu
    • EUR 4677.00
    • EUR 2471.00
    • EUR 627.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20
    • Cytokine Zcyto7
    • Neuronal interleukin-17-related factor
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Mouse Interleukin 17B ELISA Kit (IL17B)
    RK02934 96 Tests
    EUR 521

    Mouse Interleukin 17B (IL17B) Protein
    20-abx653985
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Mouse Interleukin 17B (IL17B) Protein
    20-abx653986
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Mouse Interleukin 17B (IL17B) CLIA Kit
    20-abx190529
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Interleukin 17B (IL17B)CLIA Kit
    SCB700Mu-10x96wellstestplate 10x96-wells test plate
    EUR 5804.88
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Mouse Interleukin 17B (IL17B)CLIA Kit
    SCB700Mu-1x48wellstestplate 1x48-wells test plate
    EUR 565.7
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Mouse Interleukin 17B (IL17B)CLIA Kit
    SCB700Mu-1x96wellstestplate 1x96-wells test plate
    EUR 765.28
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Mouse Interleukin 17B (IL17B)CLIA Kit
    SCB700Mu-5x96wellstestplate 5x96-wells test plate
    EUR 3143.76
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Mouse Interleukin 17B (IL17B) CLIA Kit
    4-SCB700Mu
    • EUR 5855.00
    • EUR 3144.00
    • EUR 766.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 17B Clia kit. Alternative names of the recognized antigen: IL-20
    • Cytokine Zcyto7
    • Neuronal interleukin-17-related factor
    Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Mouse Interleukin 17B (IL17B)Serum, plasma and other biological fluids

    ELISA kit for Mouse IL17B (Interleukin 17B)
    ELK4007 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 17B (IL17B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki
    • Show more
    Description: A sandwich ELISA kit for detection of Interleukin 17B from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Active Interleukin 17B (IL17B)
    4-APB700Hu01
    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9UHF5
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 22.1kDa
    • Isoelectric Point: 9.7
    Description: Recombinant Human Interleukin 17B expressed in: E.coli

    Interleukin 17B (IL17B) Antibody
    20-abx216191
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Interleukin 17B (IL17B) Antibody
    20-abx177117
    • EUR 1177.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Interleukin 17B (IL17B) Antibody
    20-abx177118
    • EUR 1177.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Interleukin 17B (IL17B) Antibody
    20-abx101512
    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Interleukin 17B (IL17B) Antibody
    20-abx101513
    • EUR 439.00
    • EUR 133.00
    • EUR 1247.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Interleukin 17B (IL17B) Antibody
    abx038115-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Interleukin 17B (IL17B) Antibody
    20-abx173104
    • EUR 815.00
    • EUR 425.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Interleukin 17B (IL17B) Antibody
    20-abx173105
    • EUR 871.00
    • EUR 453.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Interleukin 17B (IL17B) Antibody
    abx234226-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Interleukin 17B (IL17B) Antibody
    20-abx330118
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Recombinant Interleukin 17B (IL17B)
    4-RPB700Hu01
    • EUR 458.40
    • EUR 226.00
    • EUR 1444.00
    • EUR 548.00
    • EUR 996.00
    • EUR 370.00
    • EUR 3460.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9UHF5
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 22.0kDa
    • Isoelectric Point: 9.7
    Description: Recombinant Human Interleukin 17B expressed in: E.coli

    Recombinant Interleukin 17B (IL17B)
    4-RPB700Ra01
    • EUR 508.58
    • EUR 239.00
    • EUR 1632.16
    • EUR 610.72
    • EUR 1121.44
    • EUR 403.00
    • EUR 3930.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: G3V8K9
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 19.4kDa
    • Isoelectric Point: 9.5
    Description: Recombinant Rat Interleukin 17B expressed in: E.coli

    Rat Interleukin 17B (IL17B) ELISA Kit
    20-abx155721
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Interleukin 17B (IL17B) ELISA Kit
    20-abx152021
    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human IL17B/ Interleukin-17B ELISA Kit
    E1264Hu 1 Kit
    EUR 571

    Human IL17B(Interleukin-17B) ELISA Kit
    EH2104 96T
    EUR 567.6
    • Detection range: 15.6-1000 pg/ml
    • Uniprot ID: Q9UHF5
    • Alias: IL17B/Cytokine Zcyto7/cytokine-like protein ZCYTO7/IL-17Binterleukin-17 beta/IL20/IL-20interleukin-17B/interleukin 17B/interleukin 20/Interleukin-20/MGC138900/MGC138901/neuronal interleukin-1
    • Show more
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

    Human Interleukin- 17B, IL17B ELISA KIT
    ELI-06753h 96 Tests
    EUR 824

    Human Interleukin 17B (IL17B) ELISA Kit
    abx574703-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Interleukin 17B (IL17B) ELISA Kit
    SEB700Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4502.43
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Human Interleukin 17B (IL17B) ELISA Kit
    SEB700Hu-1x48wellstestplate 1x48-wells test plate
    EUR 458.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Human Interleukin 17B (IL17B) ELISA Kit
    SEB700Hu-1x96wellstestplate 1x96-wells test plate
    EUR 612.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Human Interleukin 17B (IL17B) ELISA Kit
    SEB700Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2454.23
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Human Interleukin 17B (IL17B) ELISA Kit
    4-SEB700Hu
    • EUR 4553.00
    • EUR 2405.00
    • EUR 613.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20
    • Cytokine Zcyto7
    • Neuronal interleukin-17-related factor
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Rat Interleukin 17B (IL17B) ELISA Kit
    SEB700Ra-10x96wellstestplate 10x96-wells test plate
    EUR 4875.49
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Rat Interleukin 17B (IL17B) ELISA Kit
    SEB700Ra-1x48wellstestplate 1x48-wells test plate
    EUR 489.16
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Rat Interleukin 17B (IL17B) ELISA Kit
    SEB700Ra-1x96wellstestplate 1x96-wells test plate
    EUR 655.94
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Rat Interleukin 17B (IL17B) ELISA Kit
    SEB700Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2651.73
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Rat Interleukin 17B (IL17B) ELISA Kit
    4-SEB700Ra
    • EUR 4926.00
    • EUR 2602.00
    • EUR 656.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20
    • Cytokine Zcyto7
    • Neuronal interleukin-17-related factor
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Rat Interleukin 17B ELISA Kit (IL17B)
    RK03755 96 Tests
    EUR 521

    Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
    MEB700Mu-10x96wellstestplate 10x96-wells test plate
    EUR 5523.45
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 17B (IL17B).

    Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
    MEB700Mu-1x48wellstestplate 1x48-wells test plate
    EUR 542.52
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 17B (IL17B).

    Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
    MEB700Mu-1x96wellstestplate 1x96-wells test plate
    EUR 732.17
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 17B (IL17B).

    Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
    MEB700Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2994.77
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 17B (IL17B).

    Mini Samples Mouse Interleukin 17B (IL17B) ELISA Kit
    4-MEB700Mu
    • EUR 5574.00
    • EUR 2945.00
    • EUR 733.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20
    • Cytokine Zcyto7
    • Neuronal interleukin-17-related factor
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 17B (IL17B) in samples from n/a with no significant corss-reactivity with analogues from other species.

    ELISA kit for Human IL17B (Interleukin 17B)
    ELK2702 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 17B (IL17B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki
    • Show more
    Description: A sandwich ELISA kit for detection of Interleukin 17B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Rat IL17B (Interleukin 17B)
    ELK5674 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 17B (IL17B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki
    • Show more
    Description: A sandwich ELISA kit for detection of Interleukin 17B from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Interleukin 17B (IL17B) CLIA Kit
    20-abx190244
    • EUR 7911.00
    • EUR 4215.00
    • EUR 973.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Rat Interleukin 17B (IL17B) CLIA Kit
    20-abx190699
    • EUR 8443.00
    • EUR 4497.00
    • EUR 1036.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Rat Interleukin 17B (IL17B)CLIA Kit
    SCB700Ra-10x96wellstestplate 10x96-wells test plate
    EUR 6119.04
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Rat Interleukin 17B (IL17B)CLIA Kit
    SCB700Ra-1x48wellstestplate 1x48-wells test plate
    EUR 591.57
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Rat Interleukin 17B (IL17B)CLIA Kit
    SCB700Ra-1x96wellstestplate 1x96-wells test plate
    EUR 802.24
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Rat Interleukin 17B (IL17B)CLIA Kit
    SCB700Ra-5x96wellstestplate 5x96-wells test plate
    EUR 3310.08
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Rat Interleukin 17B (IL17B) CLIA Kit
    4-SCB700Ra
    • EUR 6170.00
    • EUR 3311.00
    • EUR 803.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 17B Clia kit. Alternative names of the recognized antigen: IL-20
    • Cytokine Zcyto7
    • Neuronal interleukin-17-related factor
    Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Rat Interleukin 17B (IL17B)Serum, plasma and other biological fluids

    Human Interleukin 17B (IL17B)CLIA Kit
    SCB700Hu-10x96wellstestplate 10x96-wells test plate
    EUR 5647.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Human Interleukin 17B (IL17B)CLIA Kit
    SCB700Hu-1x48wellstestplate 1x48-wells test plate
    EUR 552.76
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Human Interleukin 17B (IL17B)CLIA Kit
    SCB700Hu-1x96wellstestplate 1x96-wells test plate
    EUR 746.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Human Interleukin 17B (IL17B)CLIA Kit
    SCB700Hu-5x96wellstestplate 5x96-wells test plate
    EUR 3060.6
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

    Human Interleukin 17B (IL17B) CLIA Kit
    4-SCB700Hu
    • EUR 5698.00
    • EUR 3061.00
    • EUR 747.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 17B Clia kit. Alternative names of the recognized antigen: IL-20
    • Cytokine Zcyto7
    • Neuronal interleukin-17-related factor
    Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B)Serum, plasma and other biological fluids

    Rat Interleukin 17B (IL17B) Protein
    20-abx067473
    • EUR 704.00
    • EUR 286.00
    • EUR 2193.00
    • EUR 843.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Human Interleukin 17B (IL17B) Protein
    20-abx067475
    • EUR 648.00
    • EUR 272.00
    • EUR 1943.00
    • EUR 759.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Interleukin 17B (IL17B) Protein (Active)
    20-abx651382
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Interleukin 17B (IL17B) Polyclonal Antibody (Human)
    4-PAB700Hu01
    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Gln21~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B)

    Interleukin 17B (IL17B) Polyclonal Antibody (Rat)
    4-PAB700Ra01
    • EUR 251.00
    • EUR 2589.00
    • EUR 643.00
    • EUR 317.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Arg23~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B)

    Interleukin 17B (IL17B) Polyclonal Antibody (Human), APC
    4-PAB700Hu01-APC
    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Gln21~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with APC.

    Interleukin 17B (IL17B) Polyclonal Antibody (Human), Biotinylated
    4-PAB700Hu01-Biotin
    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Gln21~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with Biotin.

    Interleukin 17B (IL17B) Polyclonal Antibody (Human), Cy3
    4-PAB700Hu01-Cy3
    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Gln21~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with Cy3.

    Interleukin 17B (IL17B) Polyclonal Antibody (Human), FITC
    4-PAB700Hu01-FITC
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Gln21~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with FITC.

    Interleukin 17B (IL17B) Polyclonal Antibody (Human), HRP
    4-PAB700Hu01-HRP
    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Gln21~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with HRP.

    Interleukin 17B (IL17B) Polyclonal Antibody (Human), PE
    4-PAB700Hu01-PE
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Gln21~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with PE.

    Interleukin 17B (IL17B) Polyclonal Antibody (Rat), APC
    4-PAB700Ra01-APC
    • EUR 352.00
    • EUR 3383.00
    • EUR 939.00
    • EUR 450.00
    • EUR 223.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Arg23~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with APC.

    Interleukin 17B (IL17B) Polyclonal Antibody (Rat), Biotinylated
    4-PAB700Ra01-Biotin
    • EUR 316.00
    • EUR 2539.00
    • EUR 747.00
    • EUR 388.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Arg23~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with Biotin.

    Interleukin 17B (IL17B) Polyclonal Antibody (Rat), Cy3
    4-PAB700Ra01-Cy3
    • EUR 428.00
    • EUR 4469.00
    • EUR 1211.00
    • EUR 559.00
    • EUR 255.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Arg23~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with Cy3.

    Interleukin 17B (IL17B) Polyclonal Antibody (Rat), FITC
    4-PAB700Ra01-FITC
    • EUR 302.00
    • EUR 2726.00
    • EUR 771.00
    • EUR 380.00
    • EUR 198.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Arg23~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with FITC.

    Interleukin 17B (IL17B) Polyclonal Antibody (Rat), HRP
    4-PAB700Ra01-HRP
    • EUR 322.00
    • EUR 2948.00
    • EUR 830.00
    • EUR 407.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Arg23~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with HRP.

    Interleukin 17B (IL17B) Polyclonal Antibody (Rat), PE
    4-PAB700Ra01-PE
    • EUR 302.00
    • EUR 2726.00
    • EUR 771.00
    • EUR 380.00
    • EUR 198.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Arg23~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with PE.

    Mouse Interleukin 17B(IL-17B)ELISA Kit
    QY-E20839 96T
    EUR 361

    Interleukin 17B (IL17B) Polyclonal Antibody (Human), APC-Cy7
    4-PAB700Hu01-APC-Cy7
    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Gln21~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B). This antibody is labeled with APC-Cy7.

    Interleukin 17B (IL17B) Polyclonal Antibody (Rat), APC-Cy7
    4-PAB700Ra01-APC-Cy7
    • EUR 585.00
    • EUR 6646.00
    • EUR 1759.00
    • EUR 781.00
    • EUR 326.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL17B (Arg23~Phe180)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B). This antibody is labeled with APC-Cy7.

    IL17B Human, Interleukin-17B Human Recombinant Protein, Sf9
    PROTQ9UHF5-2 Regular: 5ug
    EUR 317
    Description: IL17B Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 169 amino acids (21-180a.a.) and having a molecular mass of 19.2kDa (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). IL17B is expressed with a 6 amino acid His-tag at C-Terminus and purified by proprietary chromatographic techniques.

    IL17B Human, Interleukin-17B Human Recombinant Protein, His Tag
    PROTQ9UHF5 Regular: 25ug
    EUR 317
    Description: IL17B Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 185 amino acids (21-180) and having a molecular mass of 20kDa.;IL17B is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    Human Interleukin 17B,IL-17B ELISA Kit
    201-12-2166 96 tests
    EUR 440
    • This Interleukin 17B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Interleukin 17B(IL-17B)ELISA Kit
    QY-E04321 96T
    EUR 361

    Rat Interleukin 17B(IL-17B)ELISA Kit
    QY-E10619 96T
    EUR 361

    ELISA kit for Mouse Interleukin-17B
    EK4288 96 tests
    EUR 469
    Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Interleukin-17B in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Interleukin-17B
    EK4287 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-17B in samples from serum, plasma, tissue homogenates and other biological fluids.

    IL-17B Interleukin 17B Human Recombinant Protein
    PROTQ9UHF5-1 Regular: 25ug
    EUR 317
    Description: Interleukin-17B Human Recombinant produced in E.Coli is a homodimeric, non-disulfide-linked polypeptide chain containing a total of 322 amino acids (2 chains of 161aa) and having a molecular mass of 36.5kDa. The IL-17B is purified by proprietary chromatographic techniques.

    IL17B ELISA Kit (Mouse) (OKAN04722)
    OKAN04722 96 Wells
    EUR 792
    Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.8 pg/mL

    IL17B ELISA Kit (Mouse) (OKCD07611)
    OKCD07611 96 Wells
    EUR 818
    Description: Description of target: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.8pg/mL

    IL17B ELISA Kit (Mouse) (OKEH03000)
    OKEH03000 96 Wells
    EUR 544
    Description: Description of target: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.69 pg/mL

    Recombinant Human Interleukin-17B/IL-17B (C-Fc)
    CB78-10ug 10ug
    EUR 141
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Interleukin-17B/IL-17B (C-Fc)
    CB78-1mg 1mg
    EUR 1877
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Interleukin-17B/IL-17B (C-Fc)
    CB78-500ug 500ug
    EUR 1328
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Interleukin-17B/IL-17B (C-Fc)
    CB78-50ug 50ug
    EUR 303
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human IL17B/ IL-17B Protein, Untagged, E.coli-100ug
    QP10305-ec-100ug 100ug
    EUR 988

    Recombinant Human IL17B/ IL-17B Protein, Untagged, E.coli-250ug
    QP10305-ec-250ug 250ug
    EUR 1731

    Recombinant Human IL17B/ IL-17B Protein, Untagged, E.coli-25ug
    QP10305-ec-25ug 25ug
    EUR 290

    Recombinant Human IL17B/ IL-17B Protein, Untagged, E.coli-5ug
    QP10305-ec-5ug 5ug
    EUR 154

    Human IL17B ELISA Kit
    ELA-E2103h 96 Tests
    EUR 824

    IL17B ELISA KIT|Human
    EF006182 96 Tests
    EUR 689

    IL17B Chemi-Luminescent ELISA Kit (Mouse) (OKCD03622)
    OKCD03622 96 Wells
    EUR 1027
    Description: Description of target: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

    Human Interleukin17B (IL17B) ELISA Kit
    CSB-E15918h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitative sandwich ELISA kit for measuring Human Interleukin17B (IL17B) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Interleukin17B (IL17B) ELISA Kit
    1-CSB-E15918h
    • EUR 703.00
    • EUR 4843.00
    • EUR 2570.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitative sandwich ELISA kit for measuring Human Interleukin17B (IL17B) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    IL17B ELISA Kit (Rat) (OKCD00176)
    OKCD00176 96 Wells
    EUR 857
    Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.4 pg/mL

    IL17B ELISA Kit (Human) (OKCD07610)
    OKCD07610 96 Wells
    EUR 936
    Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202

    Mouse IL17B shRNA Plasmid
    20-abx974610
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    IL17B protein
    30R-AI110 25 ug
    EUR 273
    Description: Purified recombinant Human IL17B protein

    IL17B Antibody
    45629-100ul 100ul
    EUR 252

    IL17B Antibody
    45629-50ul 50ul
    EUR 187

    IL17B Antibody
    1-CSB-PA648539
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
    Description: A polyclonal antibody against IL17B. Recognizes IL17B from Human, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

    IL17B Antibody
    DF8979 200ul
    EUR 304
    Description: IL17B Antibody detects endogenous levels of total IL17B.

    IL17B antibody
    70R-IR035 50 ug
    EUR 273
    Description: Affinity purified Rabbit polyclonal IL17B antibody

    IL17B Protein
    20-abx260754
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 25 ug
    • 5 ug
    • Shipped within 5-10 working days.

    IL17B Protein
    20-abx260760
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 25 ug
    • 5 ug
    • Shipped within 5-10 working days.

    IL17B siRNA
    20-abx920420
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    IL17B siRNA
    20-abx920421
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    IL17B Antibody
    ABD8979 100 ug
    EUR 438

    anti-IL17B
    YF-PA18411 100 ug
    EUR 403
    Description: Rabbit polyclonal to IL17B

    anti-IL17B
    YF-PA26051 50 ul
    EUR 334
    Description: Mouse polyclonal to IL17B

    Il17b ORF Vector (Mouse) (pORF)
    ORF047816 1.0 ug DNA
    EUR 506

    IL17B Chemi-Luminescent ELISA Kit (Rat) (OKCD03620)
    OKCD03620 96 Wells
    EUR 1066
    Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

    IL17B Chemi-Luminescent ELISA Kit (Human) (OKCD03621)
    OKCD03621 96 Wells
    EUR 988
    Description: Description of target: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

    IL17B ELISA Kit (Human) : 96 Wells (OKEH02787)
    OKEH02787 96 Wells
    EUR 662
    Description: Description of target: The protein encoded by this gene is a T cell-derived cytokine that shares sequence similarity with IL17. This cytokine was reported to stimulate the release of TNF alpha (TNF) and IL1 beta (IL1B) from a monocytic cell line. Immunohistochemical analysis of several nerve tissues indicated that this cytokine is primarily localized to neuronal cell bodies. Alternative splicing results in multiple splice variants. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

    pET- 17b
    PVT0056 2 ug
    EUR 241

    Mouse A- kinase anchor protein 17B, Akap17b ELISA KIT
    ELI-24148m 96 Tests
    EUR 865

    Mouse Serine/threonine- protein kinase 17B, Stk17b ELISA KIT
    ELI-53296m 96 Tests
    EUR 865

    Mouse Serine/threonine-Protein Kinase 17B (STK17B) ELISA Kit
    abx556142-96tests 96 tests
    EUR 668
    • Shipped within 1-3 weeks.

    Anti-IL17B Antibody
    A10846-2 100ug/vial
    EUR 294

    Anti-IL17B Antibody
    A10846-3 100ug/vial
    EUR 294

    IL17B Blocking Peptide
    DF8979-BP 1mg
    EUR 195

    IL17B Conjugated Antibody
    C45629 100ul
    EUR 397

    IL17B cloning plasmid
    CSB-CL890693HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 543
    • Sequence: ATGGACTGGCCTCACAACCTGCTGTTTCTTCTTACCATTTCCATCTTCCTGGGGCTGGGCCAGCCCAGGAGCCCCAAAAGCAAGAGGAAGGGGCAAGGGCGGCCTGGGCCCCTGGCCCCTGGCCCTCACCAGGTGCCACTGGACCTGGTGTCACGGATGAAACCGTATGCCCGCAT
    • Show more
    Description: A cloning plasmid for the IL17B gene.

    Mouse IL17B(Interleukin 17B) ELISA Kit