Human CPA4(Carboxypeptidase A4) ELISA Kit

Human CPA4(Carboxypeptidase A4) ELISA Kit

To Order Contact us below: 

    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RD-CPA4-Hu-96Tests 96 Tests
    EUR 723
    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Carboxypeptidase A4, CPA4 ELISA KIT
    ELI-49172h 96 Tests
    EUR 824
    Human Carboxypeptidase A4(CPA4)ELISA Kit
    QY-E01348 96T
    EUR 361
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    SEF317Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    SEF317Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    SEF317Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    SEF317Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase A4 elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase A4 (CPA4) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Carboxypeptidase A4 (CPA4) Antibody
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Carboxypeptidase A4 (CPA4) Antibody
    abx145278-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Carboxypeptidase A4 (CPA4) Antibody
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Carboxypeptidase A4 (CPA4) Antibody
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Carboxypeptidase A4 (CPA4) Antibody
    abx033337-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Carboxypeptidase A4 (CPA4) Antibody
    abx033337-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Recombinant Carboxypeptidase A4 (CPA4)
    • EUR 474.53
    • EUR 230.00
    • EUR 1504.48
    • EUR 568.16
    • EUR 1036.32
    • EUR 380.00
    • EUR 3611.20
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9UI42
    • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 44.9kDa
    • Isoelectric Point: 6
    Description: Recombinant Human Carboxypeptidase A4 expressed in: E.coli
    Rat Carboxypeptidase A4(CPA4) ELISA kit
    E02C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Carboxypeptidase A4(CPA4) ELISA kit
    E02C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Carboxypeptidase A4(CPA4) ELISA kit
    E02C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Carboxypeptidase A4(CPA4) ELISA kit
    E03C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Carboxypeptidase A4(CPA4) ELISA kit
    E03C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Carboxypeptidase A4(CPA4) ELISA kit
    E03C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Carboxypeptidase A4(CPA4) ELISA kit
    E06C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Carboxypeptidase A4(CPA4) ELISA kit
    E06C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Carboxypeptidase A4(CPA4) ELISA kit
    E06C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Carboxypeptidase A4(CPA4) ELISA kit
    E04C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Carboxypeptidase A4(CPA4) ELISA kit
    E04C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Carboxypeptidase A4(CPA4) ELISA kit
    E04C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Carboxypeptidase A4(CPA4) ELISA kit
    E09C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Carboxypeptidase A4(CPA4) ELISA kit
    E09C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Carboxypeptidase A4(CPA4) ELISA kit
    E09C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Carboxypeptidase A4(CPA4) ELISA kit
    E08C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Carboxypeptidase A4(CPA4) ELISA kit
    E08C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Carboxypeptidase A4(CPA4) ELISA kit
    E08C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Carboxypeptidase A4(CPA4) ELISA kit
    E07C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Carboxypeptidase A4(CPA4) ELISA kit
    E07C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Carboxypeptidase A4(CPA4) ELISA kit
    E07C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Carboxypeptidase A4, Cpa4 ELISA KIT
    ELI-33530m 96 Tests
    EUR 865
    Human Carboxypeptidase A4 (CPA4) Protein
    • EUR 662.00
    • EUR 272.00
    • EUR 2026.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Carboxypeptidase A4 (CPA4) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human CPA4 (Carboxypeptidase A4)
    ELK4126 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase A4 (CPA4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy
    • Show more
    Description: A sandwich ELISA kit for detection of Carboxypeptidase A4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Guinea pig Carboxypeptidase A4(CPA4) ELISA kit
    E05C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Carboxypeptidase A4(CPA4) ELISA kit
    E05C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Carboxypeptidase A4(CPA4) ELISA kit
    E05C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human)
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPA4 (Lys55~Tyr421)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4)
    CPA4 Carboxypeptidase A4 Human Recombinant Protein
    PROTQ9UI42 Regular: 10ug
    EUR 317
    Description: CPA4 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 413 amino acids (17-421a.a.) and having a molecular mass of 46.6kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa)._x000D_ CPA4 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
    Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPA4 (Lys55~Tyr421)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with APC.
    Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), Biotinylated
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPA4 (Lys55~Tyr421)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with Biotin.
    Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPA4 (Lys55~Tyr421)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with Cy3.
    Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPA4 (Lys55~Tyr421)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with FITC.
    Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPA4 (Lys55~Tyr421)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with HRP.
    Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPA4 (Lys55~Tyr421)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with PE.
    Recombinant Mouse Carboxypeptidase A4/CPA4 (C-6His)
    CJ13-10ug 10ug
    EUR 202
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol, pH8.0.
    Recombinant Mouse Carboxypeptidase A4/CPA4 (C-6His)
    CJ13-1mg 1mg
    EUR 2486
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol, pH8.0.
    Recombinant Mouse Carboxypeptidase A4/CPA4 (C-6His)
    CJ13-500ug 500ug
    EUR 1613
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol, pH8.0.
    Recombinant Mouse Carboxypeptidase A4/CPA4 (C-6His)
    CJ13-50ug 50ug
    EUR 496
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl,10% Glycerol, pH8.0.
    Carboxypeptidase A4 (CPA4) Polyclonal Antibody (Human), APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPA4 (Lys55~Tyr421)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase A4 (CPA4). This antibody is labeled with APC-Cy7.
    Carboxypeptidase A4, human recombinant
    EUR 164
    Carboxypeptidase A4, human recombinant
    EUR 588
    CPA4 ELISA Kit (Human) (OKCD08770)
    OKCD08770 96 Wells
    EUR 975
    Description: Description of target: This gene is a member of the carboxypeptidase A/B subfamily, and it is located in a cluster with three other family members on chromosome 7. Carboxypeptidases are zinc-containing exopeptidases that catalyze the release of carboxy-terminal amino acids, and are synthesized as zymogens that are activated by proteolytic cleavage. This gene could be involved in the histone hyperacetylation pathway. It is imprinted and may be a strong candidate gene for prostate cancer aggressiveness.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL
    CPA4 ELISA Kit (Human) (OKDD00203)
    OKDD00203 96 Wells
    EUR 975
    Description: Description of target: This gene is a member of the carboxypeptidase A/B subfamily, and it is located in a cluster with three other family members on chromosome 7. Carboxypeptidases are zinc-containing exopeptidases that catalyze the release of carboxy-terminal amino acids, and are synthesized as zymogens that are activated by proteolytic cleavage. This gene could be involved in the histone hyperacetylation pathway. It is imprinted and may be a strong candidate gene for prostate cancer aggressiveness.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL
    Human apoprotein A4,apo-A4 ELISA Kit
    201-12-1429 96 tests
    EUR 440
    • This apoprotein A4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human apoprotein A4(apo-A4)ELISA Kit
    GA-E1445HM-48T 48T
    EUR 289
    Human apoprotein A4(apo-A4)ELISA Kit
    GA-E1445HM-96T 96T
    EUR 466
    Human apoprotein A4(apo-A4)ELISA Kit
    QY-E00336 96T
    EUR 394
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    CPA4 Antibody
    45848-100ul 100ul
    EUR 252
    CPA4 Antibody
    45848-50ul 50ul
    EUR 187
    CPA4 Antibody
    DF9336 200ul
    EUR 304
    Description: CPA4 Antibody detects endogenous levels of total CPA4.
    CPA4 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CPA4 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CPA4 Antibody
    ABD9336 100 ug
    EUR 438
    ELISA kit for Human Annexin A4 (ANX-A4)
    KTE62440-48T 48T
    EUR 354
    • Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along ex
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Annexin A4 (ANX-A4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Annexin A4 (ANX-A4)
    KTE62440-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along ex
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Annexin A4 (ANX-A4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Annexin A4 (ANX-A4)
    KTE62440-96T 96T
    EUR 572
    • Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along ex
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Annexin A4 (ANX-A4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Human Carboxypeptidase B1 ELISA kit
    E01C0730-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase B1 ELISA kit
    E01C0730-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase B1 ELISA kit
    E01C0730-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Carboxypeptidase A1 ELISA KIT|Human
    EF008381 96 Tests
    EUR 689
    Carboxypeptidase A2 ELISA KIT|Human
    EF008382 96 Tests
    EUR 689
    Carboxypeptidase A3 ELISA KIT|Human
    EF008383 96 Tests
    EUR 689
    Carboxypeptidase A5 ELISA KIT|Human
    EF008384 96 Tests
    EUR 689
    Carboxypeptidase A6 ELISA KIT|Human
    EF008385 96 Tests
    EUR 689
    Human CPA4 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    CPA4 Recombinant Protein (Human)
    RP007831 100 ug Ask for price
    Human Apolipoprotein A4 ELISA kit
    E01A0511-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Apolipoprotein A4 ELISA kit
    E01A0511-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Apolipoprotein A4 ELISA kit
    E01A0511-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Leukotriene A4 ELISA kit
    E01L0035-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Leukotriene A4 ELISA kit
    E01L0035-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Leukotriene A4 ELISA kit
    E01L0035-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Lipoxin A4 ELISA kit
    E01L0275-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Lipoxin A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Lipoxin A4 ELISA kit
    E01L0275-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Lipoxin A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Lipoxin A4 ELISA kit
    E01L0275-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Lipoxin A4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Lipoxin A4 ELISA Kit
    ELA-E1452h 96 Tests
    EUR 824
    Recombinant Carboxypeptidase A4 Protein (Gly 17-Tyr 421) [His]
    VAng-1163Lsx-1mg 1 mg
    EUR 6099
    Description: Human Carboxypeptidase A4 (CPA4), His tag, is expressed in HEK 293 cells. (Uniprot ID: AAH52289)
    Recombinant Carboxypeptidase A4 Protein (Gly 17-Tyr 421) [His]
    VAng-1163Lsx-50g 50 µg
    EUR 916
    Description: Human Carboxypeptidase A4 (CPA4), His tag, is expressed in HEK 293 cells. (Uniprot ID: AAH52289)
    CPA4 Blocking Peptide
    DF9336-BP 1mg
    EUR 195
    CPA4 Conjugated Antibody
    C45848 100ul
    EUR 397
    CPA4 cloning plasmid
    CSB-CL005878HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1266
    • Sequence: atgaggtggatactgttcattggggcccttattgggtccagcatctgtggccaagaaaaattttttggggaccaagttttgaggattaatgtcagaaatggagacgagatcagcaaattgagtcaactagtgaattcaaacaacttgaagctcaatttctggaaatctccctcct
    • Show more
    Description: A cloning plasmid for the CPA4 gene.
    CPA4 Rabbit pAb
    A17701-100ul 100 ul
    EUR 308
    CPA4 Rabbit pAb
    A17701-200ul 200 ul
    EUR 459
    CPA4 Rabbit pAb
    A17701-20ul 20 ul
    EUR 183
    CPA4 Rabbit pAb
    A17701-50ul 50 ul
    EUR 223
    Anti-CPA4 antibody
    STJ119744 100 µl
    EUR 277
    Description: This gene is a member of the carboxypeptidase A/B subfamily, and it is located in a cluster with three other family members on chromosome 7. Carboxypeptidases are zinc-containing exopeptidases that catalyze the release of carboxy-terminal amino acids, and are synthesized as zymogens that are activated by proteolytic cleavage. This gene could be involved in the histone hyperacetylation pathway. It is imprinted and may be a strong candidate gene for prostate cancer aggressiveness. [provided by RefSeq, Jul 2008]
    Anti-CPA4 (1F4)
    YF-MA18444 100 ug
    EUR 363
    Description: Mouse monoclonal to CPA4
    Lipoxin A4 ELISA Kit
    E4788-100 96 assays
    EUR 581
    Human Carboxypeptidase N1 (CPN1)ELISA Kit
    201-12-2436 96 tests
    EUR 440
    • This Carboxypeptidase N1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Carboxypeptidase N2 (CPN2)ELISA Kit
    201-12-2437 96 tests
    EUR 440
    • This Carboxypeptidase N2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Carboxypeptidase E (CPE) ELISA Kit
    DLR-CPE-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Carboxypeptidase E (CPE) ELISA Kit
    DLR-CPE-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Carboxypeptidase M (CPM) ELISA Kit
    DLR-CPM-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase M (CPM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase M (CPM) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Carboxypeptidase M (CPM) ELISA Kit
    DLR-CPM-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase M (CPM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase M (CPM) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    DLR-CPN1-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    DLR-CPN1-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    DLR-CPZ-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    DLR-CPZ-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
    Human CPA2/ Carboxypeptidase A2 ELISA Kit
    E0543Hu 1 Kit
    EUR 571
    Human CPB2/ Carboxypeptidase B2 ELISA Kit
    E0545Hu 1 Kit
    EUR 571
    Human CPM/ Carboxypeptidase M ELISA Kit
    E0547Hu 1 Kit
    EUR 571
    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A6(CPA6) ELISA kit
    E01C1994-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A6(CPA6) ELISA kit
    E01C1994-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human CPA4(Carboxypeptidase A4) ELISA Kit