Human SULF1(Sulfatase 1) ELISA Kit

Human SULF1(Sulfatase 1) ELISA Kit

To Order Contact us below: 

Human Sulfatase 1 (SULF1) ELISA Kit

RDR-SULF1-Hu-96Tests 96 Tests
EUR 756

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

DLR-SULF1-Mu-48T 48T
EUR 508
  • Should the Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Extracellular Sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

DLR-SULF1-Mu-96T 96T
EUR 661
  • Should the Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Extracellular Sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

RD-SULF1-Mu-48Tests 48 Tests
EUR 511

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

RD-SULF1-Mu-96Tests 96 Tests
EUR 709

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

RDR-SULF1-Mu-48Tests 48 Tests
EUR 534

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

RDR-SULF1-Mu-96Tests 96 Tests
EUR 742

Human Sulfatase 1 (SULF1) ELISA Kit

20-abx153188
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sulfatase 1 (SULF1) ELISA Kit

abx573979-96tests 96 tests
EUR 825
  • Shipped within 20 working days.

Human Sulfatase 1(SULF1)ELISA Kit

QY-E02238 96T
EUR 361

Human Sulfatase 1 (SULF1) ELISA Kit

SEH108Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

SEH108Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

SEH108Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

SEH108Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

4-SEH108Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfatase 1 elisa. Alternative names of the recognized antigen: HSULF-1
  • Extracellular sulfatase Sulf-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 1 (SULF1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Sulfatase 1 (SULF1) ELISA Kit

abx547930-96tests 96 tests
EUR 668
  • Shipped within 1-2 months.

Mouse Sulfatase 1 (SULF1) ELISA Kit

20-abx390674
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

ELISA kit for Human SULF1 (Sulfatase 1)

ELK4163 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 1 (SULF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 1 (S
  • Show more
Description: A sandwich ELISA kit for detection of Sulfatase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Sulfatase 1 (SULF1) Antibody

20-abx213685
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sulfatase 1 (SULF1) Antibody

20-abx101037
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sulfatase 1 (SULF1) Antibody

20-abx174655
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sulfatase 1 (SULF1) Antibody

20-abx313584
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Sulfatase 1 (SULF1)

4-RPH108Hu01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8IWU6
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 61.1kDa
  • Isoelectric Point: 8.3
Description: Recombinant Human Sulfatase 1 expressed in: E.coli

Human Sulfatase 1 (SULF1) CLIA Kit

20-abx190329
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sulfatase 1 (SULF1)CLIA Kit

SCH108Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1)CLIA Kit

SCH108Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1)CLIA Kit

SCH108Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1)CLIA Kit

SCH108Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) CLIA Kit

4-SCH108Hu
  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfatase 1 Clia kit. Alternative names of the recognized antigen: HSULF-1
  • Extracellular sulfatase Sulf-1
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1)Serum, plasma, tissue homogenates and other biological fluids

Human Sulfatase 1 (SULF1) Protein

20-abx069184
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Extracellular sulfatase Sulf-1(SULF1) ELISA kit

CSB-EL022930HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Extracellular sulfatase Sulf-1(SULF1) ELISA kit

1-CSB-EL022930HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Extracellular sulfatase Sulf-1(SULF1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human SULF1/ Extracellular sulfatase Sulf-1 ELISA Kit

E2422Hu 1 Kit
EUR 605

Human SULF1(Extracellular sulfatase Sulf-1)ELISA Kit

EH15391 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Extracellular sulfatase Sulf- 1, SULF1 ELISA KIT

ELI-46210h 96 Tests
EUR 824

Sulfatase 1 (SULF1) Antibody (HRP)

20-abx313585
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sulfatase 1 (SULF1) Antibody (FITC)

20-abx313586
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sulfatase 1 (SULF1) Antibody (Biotin)

20-abx313587
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human)

4-PAH108Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF1 (Pro609~Gly871)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1)

Mouse Extracellular sulfatase Sulf- 1, Sulf1 ELISA KIT

ELI-29909m 96 Tests
EUR 865

ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)

KTE60400-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)

KTE60400-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)

KTE60400-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), APC

4-PAH108Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF1 (Pro609~Gly871)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with APC.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), Biotinylated

4-PAH108Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF1 (Pro609~Gly871)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with Biotin.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), Cy3

4-PAH108Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF1 (Pro609~Gly871)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with Cy3.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), FITC

4-PAH108Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF1 (Pro609~Gly871)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with FITC.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), HRP

4-PAH108Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF1 (Pro609~Gly871)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with HRP.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), PE

4-PAH108Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF1 (Pro609~Gly871)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with PE.

Sulf1 ELISA Kit| Rat Extracellular sulfatase Sulf-1 ELISA Kit

EF019389 96 Tests
EUR 689

Sulf1 ELISA Kit| Mouse Extracellular sulfatase Sulf-1 ELISA Kit

EF016317 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), APC-Cy7

4-PAH108Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF1 (Pro609~Gly871)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with APC-Cy7.

Sulf1/ Rat Sulf1 ELISA Kit

ELI-46211r 96 Tests
EUR 886

SULF1 ELISA KIT|Human

EF005626 96 Tests
EUR 689

Human Iduronate sulfatase ELISA kit

E01I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate sulfatase ELISA kit

E01I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate sulfatase ELISA kit

E01I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase ELISA Kit

QY-E05306 96T
EUR 361

Anti-Steroid sulfatase/STS Antibody

A01198-1 100ug/vial
EUR 294

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

DLR-SUMF1-Hu-48T 48T
EUR 517
  • Should the Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from tissue homogenates or other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

DLR-SUMF1-Hu-96T 96T
EUR 673
  • Should the Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from tissue homogenates or other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

20-abx153191
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sulfatase- modifying factor 1, SUMF1 ELISA KIT

ELI-29982h 96 Tests
EUR 824

Human Sulfatase Modifying Factor 1(SUMF1)ELISA Kit

QY-E02237 96T
EUR 361

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

RD-SUMF1-Hu-48Tests 48 Tests
EUR 521

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

RD-SUMF1-Hu-96Tests 96 Tests
EUR 723

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

SEC879Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

SEC879Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

SEC879Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

SEC879Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

4-SEC879Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfatase Modifying Factor 1 elisa. Alternative names of the recognized antigen: FGE
  • C-alpha-formylglycine-generating enzyme 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

RDR-SUMF1-Hu-48Tests 48 Tests
EUR 544

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

RDR-SUMF1-Hu-96Tests 96 Tests
EUR 756

SULF1 Antibody

40377-100ul 100ul
EUR 252

SULF1 Antibody

1-CSB-PA814217LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULF1. Recognizes SULF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

SULF1 Antibody

1-CSB-PA260604
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SULF1. Recognizes SULF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

SULF1 siRNA

20-abx905369
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SULF1 siRNA

20-abx935632
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SULF1 siRNA

20-abx935633
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human iduronate sulfatase,IDS ELISA Kit

201-12-0731 96 tests
EUR 440
  • This iduronate sulfatase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

DLR-SULF2-Hu-48T 48T
EUR 517
  • Should the Human Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

DLR-SULF2-Hu-96T 96T
EUR 673
  • Should the Human Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human aryl sulfatase A ELISA kit

E01A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase A ELISA kit

E01A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase A ELISA kit

E01A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sulfatase 2 (SULF2) ELISA Kit

20-abx153189
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sulfatase 2 (SULF2) ELISA Kit

abx253890-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Steryl-sulfatase (STS) ELISA Kit

abx251845-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human Steryl-sulfatase

EK4979 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Steryl-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human STS(Steryl-sulfatase) ELISA Kit

EH2478 96T
EUR 567.6
  • Detection range: 1.56-100 ng/ml
  • Uniprot ID: P08842
  • Alias: STS/Steryl-sulfate sulfohydrolase/Arylsulfatase C(ASC)/Steroid sulfatase/ARSC1
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human STS/ Steryl-sulfatase ELISA Kit

E2419Hu 1 Kit
EUR 605

Human Steryl- sulfatase, STS ELISA KIT

ELI-52169h 96 Tests
EUR 824

Human iduronate sulfatase,IDS ELISA Kit

CN-04541H1 96T
EUR 448

Human iduronate sulfatase,IDS ELISA Kit

CN-04541H2 48T
EUR 297

Human iduronate sulfatase, IDS ELISA Kit

CSB-E09471h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human iduronate sulfatase, IDS ELISA Kit

1-CSB-E09471h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Sulfatase 2 (SULF2) ELISA Kit

abx573928-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human iduronate sulfatase(IDS)ELISA Kit

GA-E0747HM-48T 48T
EUR 289

Human iduronate sulfatase(IDS)ELISA Kit

GA-E0747HM-96T 96T
EUR 466

Human iduronate sulfatase(IDS)ELISA Kit

QY-E04351 96T
EUR 361

Human Sulfatase 2 ELISA Kit (SULF2)

RK02346 96 Tests
EUR 521

Human Sulfatase 2 (SULF2) ELISA Kit

RD-SULF2-Hu-48Tests 48 Tests
EUR 521

Human Sulfatase 2 (SULF2) ELISA Kit

RD-SULF2-Hu-96Tests 96 Tests
EUR 723

Human Sulfatase 2 (SULF2) ELISA Kit

RDR-SULF2-Hu-48Tests 48 Tests
EUR 544

Human Sulfatase 2 (SULF2) ELISA Kit

RDR-SULF2-Hu-96Tests 96 Tests
EUR 756

Human Sulfatase 2 (SULF2) ELISA Kit

SEH107Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

SEH107Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

SEH107Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

SEH107Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

4-SEH107Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfatase 2 elisa. Alternative names of the recognized antigen: HSULF-2
  • Extracellular sulfatase Sulf-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

anti-Sulfatase 1

YF-PA17790 50 ug
EUR 363
Description: Mouse polyclonal to Sulfatase 1

anti-Sulfatase 1

YF-PA17791 100 ug
EUR 403
Description: Rabbit polyclonal to Sulfatase 1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

ELISA kit for Human SUMF1 (Sulfatase Modifying Factor 1)

ELK3331 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase Modifying Factor 1 (SUMF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Sulfatase Modifying Factor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)

KTE60403-48T 48T
EUR 332
  • Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)

KTE60403-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)

KTE60403-96T 96T
EUR 539
  • Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human SULF1 shRNA Plasmid

20-abx958091
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat Iduronate sulfatase ELISA kit

E02I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit

E02I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit

E02I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit

E04I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit

E04I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit

E04I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit

E03I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit

E03I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit

E03I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit

E06I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit

E06I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit

E06I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit

E09I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit

E09I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit

E09I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit

E08I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit

E08I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit

E08I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit

E07I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit

E07I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit

E07I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SULF1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2312002 1.0 ug DNA
EUR 154

Human aryl sulfatase A,ASA ELISA Kit

201-12-0728 96 tests
EUR 440
  • This aryl sulfatase A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

DLR-IDS-Hu-48T 48T
EUR 517
  • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

DLR-IDS-Hu-96T 96T
EUR 673
  • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit

E01G0081-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit

E01G0081-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit

E01G0081-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

20-abx151901
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Iduronate 2-Sulfatase (IDS) ELISA Kit

abx253725-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Iduronate 2-sulfatase

EK1482 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Iduronate 2-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IDS/ Iduronate 2-sulfatase ELISA Kit

E1209Hu 1 Kit
EUR 571

Human IDS(Iduronate 2-sulfatase) ELISA Kit

EH0767 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P22304
  • Alias: IDS/SIDS/MPS2/S/Alpha-L-iduronate sulfate sulfatase/iduronate 2-sulfatase/iduronate 2-sulfatase 14 kDa chain/iduronate 2-sulfatase 42 kDa chain/idursulfase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human SULF2 (Sulfatase 2)

ELK3437 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 2 (SULF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 2 (S
  • Show more
Description: A sandwich ELISA kit for detection of Sulfatase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human aryl sulfatase A,ASA ELISA Kit

CN-04535H1 96T
EUR 439

Human aryl sulfatase A,ASA ELISA Kit

CN-04535H2 48T
EUR 290

Human aryl sulfatase A(ASA)ELISA Kit

GA-E0744HM-48T 48T
EUR 289

Human aryl sulfatase A(ASA)ELISA Kit

GA-E0744HM-96T 96T
EUR 466

ELISA kit for Human Steryl-sulfatase (STS)

KTE60396-48T 48T
EUR 332
  • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Steryl-sulfatase (STS)

KTE60396-5platesof96wells 5 plates of 96 wells
EUR 2115
  • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Steryl-sulfatase (STS)

KTE60396-96T 96T
EUR 539
  • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human aryl sulfatase A(ARSA)ELISA Kit

QY-E03645 96T
EUR 361

Human Iduronate-2-Sulfatase ELISA Kit (IDS)

RK01625 96 Tests
EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RDR-IDS-Hu-48Tests 48 Tests
EUR 544

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RDR-IDS-Hu-96Tests 96 Tests
EUR 756

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RD-IDS-Hu-48Tests 48 Tests
EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RD-IDS-Hu-96Tests 96 Tests
EUR 723

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

4-SEH833Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Iduronate-2-Sulfatase elisa. Alternative names of the recognized antigen: MPS2
  • SIDS
  • Hunter Syndrome
  • Idursulfase
  • Alpha-L-iduronate sulfate sulfatase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sulfatase- modifying factor 1, Sumf1 ELISA KIT

ELI-52629m 96 Tests
EUR 865

Bovine Sulfatase- modifying factor 1, SUMF1 ELISA KIT

ELI-46212b 96 Tests
EUR 928

Mouse Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

abx390675-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Sumf1 ELISA Kit| Mouse Sulfatase-modifying factor 1 ELISA Kit

EF016318 96 Tests
EUR 689

SUMF1 ELISA Kit| Bovine Sulfatase-modifying factor 1 ELISA Kit

EF011943 96 Tests
EUR 689

SULF1 Rabbit pAb

A13797-100ul 100 ul
EUR 308

SULF1 Rabbit pAb

A13797-200ul 200 ul
EUR 459

SULF1 Rabbit pAb

A13797-20ul 20 ul
EUR 183

SULF1 Rabbit pAb

A13797-50ul 50 ul
EUR 223

SULF1 Conjugated Antibody

C40377 100ul
EUR 397

SULF1 cloning plasmid

CSB-CL814217HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1935
  • Sequence: atgtgctatggaactcctagttataactatgcaccaaatatggataaacactggattatgcagtacacaggaccaatgctgcccatccacatggaatttacaaacattctacagcgcaaaaggctccagactttgatgtcagtggatgattctgtggagaggctgtataacatgc
  • Show more
Description: A cloning plasmid for the SULF1 gene.

Anti-SULF1 antibody

STJ115741 100 µl
EUR 277
Description: This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants.

Anti-Sulfatase 1 (1A4)

YF-MA11397 200 ul
EUR 363
Description: Mouse monoclonal to Sulfatase 1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Human Sulfatase Modifying Factor 1 (SUMF1) CLIA Kit

20-abx493949
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

SULF1 ORF Vector (Human) (pORF)

ORF010196 1.0 ug DNA
EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Mouse Sulfatase 2 (SULF2) ELISA Kit

DLR-SULF2-Mu-48T 48T
EUR 527
  • Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit

DLR-SULF2-Mu-96T 96T
EUR 688
  • Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse aryl sulfatase A ELISA kit

E03A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit

E03A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit

E03A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit

E02A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit

E02A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit

E02A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit aryl sulfatase A ELISA kit

E04A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit aryl sulfatase A ELISA kit

E04A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit aryl sulfatase A ELISA kit

E04A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit

E05I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit

E05I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit

E05I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit

E06A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit

E06A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit

E06A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfatase 2 (SULF2) ELISA Kit

20-abx154718
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit

abx254754-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Monkey aryl sulfatase A ELISA kit

E09A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey aryl sulfatase A ELISA kit

E09A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey aryl sulfatase A ELISA kit

E09A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sts/ Steryl-sulfatase ELISA Kit

E0952Ra 1 Kit
EUR 646

Dog aryl sulfatase A ELISA kit

E08A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog aryl sulfatase A ELISA kit

E08A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog aryl sulfatase A ELISA kit

E08A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig aryl sulfatase A ELISA kit

E07A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig aryl sulfatase A ELISA kit

E07A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig aryl sulfatase A ELISA kit

E07A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Steryl- sulfatase, Sts ELISA KIT

ELI-53369m 96 Tests
EUR 865

Rat iduronate sulfatase,IDS ELISA Kit

CN-02004R1 96T
EUR 468

Rat iduronate sulfatase,IDS ELISA Kit

CN-02004R2 48T
EUR 318

Mouse Steryl-sulfatase (STS) ELISA Kit

abx521168-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Steryl-sulfatase (STS) ELISA Kit

abx521169-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Iduronate Sulfatase (IDS) ELISA Kit

abx570921-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit

abx573406-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat iduronate sulfatase(IDS)ELISA Kit

GA-E0115RT-48T 48T
EUR 317

Rat iduronate sulfatase(IDS)ELISA Kit

GA-E0115RT-96T 96T
EUR 496

Rat iduronate sulfatase(IDS)ELISA Kit

QY-E11538 96T
EUR 361

Mouse Sulfatase 2 (SULF2) ELISA Kit

RD-SULF2-Mu-48Tests 48 Tests
EUR 533

Mouse Sulfatase 2 (SULF2) ELISA Kit

RD-SULF2-Mu-96Tests 96 Tests
EUR 740

Mouse iduronate sulfatase(IDS)ELISA Kit

QY-E20773 96T
EUR 361

Mouse Sulfatase 2 (SULF2) ELISA Kit

RDR-SULF2-Mu-48Tests 48 Tests
EUR 557

Mouse Sulfatase 2 (SULF2) ELISA Kit

RDR-SULF2-Mu-96Tests 96 Tests
EUR 774

Mouse Sulfatase 2 (SULF2) ELISA Kit

SEH107Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit

SEH107Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human SULF1(Sulfatase 1) ELISA Kit