Human SULF1(Sulfatase 1) ELISA Kit

Human SULF1(Sulfatase 1) ELISA Kit

To Order Contact us below: 

    Human Sulfatase 1 (SULF1) ELISA Kit

    RDR-SULF1-Hu-96Tests 96 Tests
    EUR 756

    Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

    DLR-SULF1-Mu-48T 48T
    EUR 508
    • Should the Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Extracellular Sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

    DLR-SULF1-Mu-96T 96T
    EUR 661
    • Should the Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Extracellular Sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

    RD-SULF1-Mu-48Tests 48 Tests
    EUR 511

    Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

    RD-SULF1-Mu-96Tests 96 Tests
    EUR 709

    Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

    RDR-SULF1-Mu-48Tests 48 Tests
    EUR 534

    Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit

    RDR-SULF1-Mu-96Tests 96 Tests
    EUR 742

    Human Sulfatase 1 (SULF1) ELISA Kit

    20-abx153188
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Sulfatase 1 (SULF1) ELISA Kit

    abx573979-96tests 96 tests
    EUR 825
    • Shipped within 20 working days.

    Human Sulfatase 1(SULF1)ELISA Kit

    QY-E02238 96T
    EUR 361

    Human Sulfatase 1 (SULF1) ELISA Kit

    SEH108Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 1 (SULF1) ELISA Kit

    SEH108Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 1 (SULF1) ELISA Kit

    SEH108Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 1 (SULF1) ELISA Kit

    SEH108Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 1 (SULF1) ELISA Kit

    4-SEH108Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Sulfatase 1 elisa. Alternative names of the recognized antigen: HSULF-1
    • Extracellular sulfatase Sulf-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 1 (SULF1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Rat Sulfatase 1 (SULF1) ELISA Kit

    abx547930-96tests 96 tests
    EUR 668
    • Shipped within 1-2 months.

    Mouse Sulfatase 1 (SULF1) ELISA Kit

    20-abx390674
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    ELISA kit for Human SULF1 (Sulfatase 1)

    ELK4163 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 1 (SULF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 1 (S
    • Show more
    Description: A sandwich ELISA kit for detection of Sulfatase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Sulfatase 1 (SULF1) Antibody

    20-abx213685
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Sulfatase 1 (SULF1) Antibody

    20-abx101037
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Sulfatase 1 (SULF1) Antibody

    20-abx174655
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Sulfatase 1 (SULF1) Antibody

    20-abx313584
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Recombinant Sulfatase 1 (SULF1)

    4-RPH108Hu01
    • EUR 422.56
    • EUR 216.00
    • EUR 1309.60
    • EUR 503.20
    • EUR 906.40
    • EUR 346.00
    • EUR 3124.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q8IWU6
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 61.1kDa
    • Isoelectric Point: 8.3
    Description: Recombinant Human Sulfatase 1 expressed in: E.coli

    Human Sulfatase 1 (SULF1) CLIA Kit

    20-abx190329
    • EUR 7911.00
    • EUR 4215.00
    • EUR 973.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Sulfatase 1 (SULF1)CLIA Kit

    SCH108Hu-10x96wellstestplate 10x96-wells test plate
    EUR 5647.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 1 (SULF1)CLIA Kit

    SCH108Hu-1x48wellstestplate 1x48-wells test plate
    EUR 552.76
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 1 (SULF1)CLIA Kit

    SCH108Hu-1x96wellstestplate 1x96-wells test plate
    EUR 746.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 1 (SULF1)CLIA Kit

    SCH108Hu-5x96wellstestplate 5x96-wells test plate
    EUR 3060.6
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 1 (SULF1) CLIA Kit

    4-SCH108Hu
    • EUR 5698.00
    • EUR 3061.00
    • EUR 747.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Sulfatase 1 Clia kit. Alternative names of the recognized antigen: HSULF-1
    • Extracellular sulfatase Sulf-1
    Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1)Serum, plasma, tissue homogenates and other biological fluids

    Human Sulfatase 1 (SULF1) Protein

    20-abx069184
    • EUR 592.00
    • EUR 258.00
    • EUR 1776.00
    • EUR 704.00
    • EUR 439.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Extracellular sulfatase Sulf-1(SULF1) ELISA kit

    CSB-EL022930HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Extracellular sulfatase Sulf-1(SULF1) ELISA kit

    1-CSB-EL022930HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Extracellular sulfatase Sulf-1(SULF1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human SULF1/ Extracellular sulfatase Sulf-1 ELISA Kit

    E2422Hu 1 Kit
    EUR 605

    Human SULF1(Extracellular sulfatase Sulf-1)ELISA Kit

    EH15391 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Extracellular sulfatase Sulf- 1, SULF1 ELISA KIT

    ELI-46210h 96 Tests
    EUR 824

    Sulfatase 1 (SULF1) Antibody (HRP)

    20-abx313585
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Sulfatase 1 (SULF1) Antibody (FITC)

    20-abx313586
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Sulfatase 1 (SULF1) Antibody (Biotin)

    20-abx313587
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Sulfatase 1 (SULF1) Polyclonal Antibody (Human)

    4-PAH108Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SULF1 (Pro609~Gly871)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1)

    Mouse Extracellular sulfatase Sulf- 1, Sulf1 ELISA KIT

    ELI-29909m 96 Tests
    EUR 865

    ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)

    KTE60400-48T 48T
    EUR 354
    Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)

    KTE60400-5platesof96wells 5 plates of 96 wells
    EUR 2252
    Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)

    KTE60400-96T 96T
    EUR 572
    Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Sulfatase 1 (SULF1) Polyclonal Antibody (Human), APC

    4-PAH108Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SULF1 (Pro609~Gly871)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with APC.

    Sulfatase 1 (SULF1) Polyclonal Antibody (Human), Biotinylated

    4-PAH108Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SULF1 (Pro609~Gly871)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with Biotin.

    Sulfatase 1 (SULF1) Polyclonal Antibody (Human), Cy3

    4-PAH108Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SULF1 (Pro609~Gly871)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with Cy3.

    Sulfatase 1 (SULF1) Polyclonal Antibody (Human), FITC

    4-PAH108Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SULF1 (Pro609~Gly871)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with FITC.

    Sulfatase 1 (SULF1) Polyclonal Antibody (Human), HRP

    4-PAH108Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SULF1 (Pro609~Gly871)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with HRP.

    Sulfatase 1 (SULF1) Polyclonal Antibody (Human), PE

    4-PAH108Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SULF1 (Pro609~Gly871)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with PE.

    Sulf1 ELISA Kit| Rat Extracellular sulfatase Sulf-1 ELISA Kit

    EF019389 96 Tests
    EUR 689

    Sulf1 ELISA Kit| Mouse Extracellular sulfatase Sulf-1 ELISA Kit

    EF016317 96 Tests
    EUR 689

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Sulfatase 1 (SULF1) Polyclonal Antibody (Human), APC-Cy7

    4-PAH108Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SULF1 (Pro609~Gly871)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with APC-Cy7.

    Sulf1/ Rat Sulf1 ELISA Kit

    ELI-46211r 96 Tests
    EUR 886

    SULF1 ELISA KIT|Human

    EF005626 96 Tests
    EUR 689

    SULF1 ELISA Kit (Human) (OKCD00705)

    OKCD00705 96 Wells
    EUR 831
    Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin. Diminishes HSPG (heparan sulfate proteoglycans) sulfation, inhibits signaling by heparin-dependent growth factors, diminishes proliferation, and facilitates apoptosis in response to exogenous stimulation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.71 ng/mL

    SULF1 ELISA Kit (Human) (OKEH07903)

    OKEH07903 96 Wells
    EUR 1092
    Description: Description of target: This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 33 pg/mL

    Human Iduronate sulfatase ELISA kit

    E01I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Iduronate sulfatase ELISA kit

    E01I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Iduronate sulfatase ELISA kit

    E01I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human aryl sulfatase ELISA Kit

    QY-E05306 96T
    EUR 361

    SULF1 ELISA Kit (Rat) (OKEH07904)

    OKEH07904 96 Wells
    EUR 896
    Description: Description of target: displays arylsulfatase and/or hydrolase enzyme activity; may catalyze the desulfation of glycosaminoglycans [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10pg/mL

    Anti-Steroid sulfatase/STS Antibody

    A01198-1 100ug/vial
    EUR 294

    SULF1 Chemi-Luminescent ELISA Kit (Human) (OKCD03931)

    OKCD03931 96 Wells
    EUR 988
    Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin. Diminishes HSPG (heparan sulfate proteoglycans) sulfation, inhibits signaling by heparin-dependent growth factors, diminishes proliferation, and facilitates apoptosis in response to exogenous stimulation. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    DLR-SUMF1-Hu-48T 48T
    EUR 517
    • Should the Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from tissue homogenates or other biological fluids.

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    DLR-SUMF1-Hu-96T 96T
    EUR 673
    • Should the Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from tissue homogenates or other biological fluids.

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    20-abx153191
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Sulfatase- modifying factor 1, SUMF1 ELISA KIT

    ELI-29982h 96 Tests
    EUR 824

    Human Sulfatase Modifying Factor 1(SUMF1)ELISA Kit

    QY-E02237 96T
    EUR 361

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    RD-SUMF1-Hu-48Tests 48 Tests
    EUR 521

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    RD-SUMF1-Hu-96Tests 96 Tests
    EUR 723

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    SEC879Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    SEC879Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    SEC879Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    SEC879Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    4-SEC879Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Sulfatase Modifying Factor 1 elisa. Alternative names of the recognized antigen: FGE
    • C-alpha-formylglycine-generating enzyme 1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    RDR-SUMF1-Hu-48Tests 48 Tests
    EUR 544

    Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    RDR-SUMF1-Hu-96Tests 96 Tests
    EUR 756

    SULF1 Antibody

    40377-100ul 100ul
    EUR 252

    SULF1 Antibody

    1-CSB-PA814217LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SULF1. Recognizes SULF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

    SULF1 Antibody

    1-CSB-PA260604
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against SULF1. Recognizes SULF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

    SULF1 siRNA

    20-abx905369
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SULF1 siRNA

    20-abx935632
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SULF1 siRNA

    20-abx935633
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Human iduronate sulfatase,IDS ELISA Kit

    201-12-0731 96 tests
    EUR 440
    • This iduronate sulfatase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Sulfatase 2 (SULF2) ELISA Kit

    DLR-SULF2-Hu-48T 48T
    EUR 517
    • Should the Human Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Sulfatase 2 (SULF2) ELISA Kit

    DLR-SULF2-Hu-96T 96T
    EUR 673
    • Should the Human Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human aryl sulfatase A ELISA kit

    E01A0874-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human aryl sulfatase A ELISA kit

    E01A0874-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human aryl sulfatase A ELISA kit

    E01A0874-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Sulfatase 2 (SULF2) ELISA Kit

    20-abx153189
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Sulfatase 2 (SULF2) ELISA Kit

    abx253890-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Human Steryl-sulfatase (STS) ELISA Kit

    abx251845-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    ELISA kit for Human Steryl-sulfatase

    EK4979 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Steryl-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human STS(Steryl-sulfatase) ELISA Kit

    EH2478 96T
    EUR 567.6
    • Detection range: 1.56-100 ng/ml
    • Uniprot ID: P08842
    • Alias: STS/Steryl-sulfate sulfohydrolase/Arylsulfatase C(ASC)/Steroid sulfatase/ARSC1
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

    Human STS/ Steryl-sulfatase ELISA Kit

    E2419Hu 1 Kit
    EUR 605

    Human Steryl- sulfatase, STS ELISA KIT

    ELI-52169h 96 Tests
    EUR 824

    Human iduronate sulfatase,IDS ELISA Kit

    CN-04541H1 96T
    EUR 448

    Human iduronate sulfatase,IDS ELISA Kit

    CN-04541H2 48T
    EUR 297

    Human iduronate sulfatase, IDS ELISA Kit

    CSB-E09471h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human iduronate sulfatase, IDS ELISA Kit

    1-CSB-E09471h
    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Sulfatase 2 (SULF2) ELISA Kit

    abx573928-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human iduronate sulfatase(IDS)ELISA Kit

    GA-E0747HM-48T 48T
    EUR 289

    Human iduronate sulfatase(IDS)ELISA Kit

    GA-E0747HM-96T 96T
    EUR 466

    Human iduronate sulfatase(IDS)ELISA Kit

    QY-E04351 96T
    EUR 361

    Human Sulfatase 2 ELISA Kit (SULF2)

    RK02346 96 Tests
    EUR 521

    Human Sulfatase 2 (SULF2) ELISA Kit

    RD-SULF2-Hu-48Tests 48 Tests
    EUR 521

    Human Sulfatase 2 (SULF2) ELISA Kit

    RD-SULF2-Hu-96Tests 96 Tests
    EUR 723

    Human Sulfatase 2 (SULF2) ELISA Kit

    RDR-SULF2-Hu-48Tests 48 Tests
    EUR 544

    Human Sulfatase 2 (SULF2) ELISA Kit

    RDR-SULF2-Hu-96Tests 96 Tests
    EUR 756

    Human Sulfatase 2 (SULF2) ELISA Kit

    SEH107Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 2 (SULF2) ELISA Kit

    SEH107Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 2 (SULF2) ELISA Kit

    SEH107Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 2 (SULF2) ELISA Kit

    SEH107Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

    Human Sulfatase 2 (SULF2) ELISA Kit

    4-SEH107Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Sulfatase 2 elisa. Alternative names of the recognized antigen: HSULF-2
    • Extracellular sulfatase Sulf-2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    anti-Sulfatase 1

    YF-PA17790 50 ug
    EUR 363
    Description: Mouse polyclonal to Sulfatase 1

    anti-Sulfatase 1

    YF-PA17791 100 ug
    EUR 403
    Description: Rabbit polyclonal to Sulfatase 1

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    ELISA kit for Human SUMF1 (Sulfatase Modifying Factor 1)

    ELK3331 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase Modifying Factor 1 (SUMF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
    • Show more
    Description: A sandwich ELISA kit for detection of Sulfatase Modifying Factor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)

    KTE60403-48T 48T
    EUR 332
    • Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)

    KTE60403-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)

    KTE60403-96T 96T
    EUR 539
    • Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Human SULF1 shRNA Plasmid

    20-abx958091
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat Iduronate sulfatase ELISA kit

    E02I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Iduronate sulfatase ELISA kit

    E02I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Iduronate sulfatase ELISA kit

    E02I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Iduronate sulfatase ELISA kit

    E04I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Iduronate sulfatase ELISA kit

    E04I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Iduronate sulfatase ELISA kit

    E04I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Iduronate sulfatase ELISA kit

    E03I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Iduronate sulfatase ELISA kit

    E03I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Iduronate sulfatase ELISA kit

    E03I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Iduronate sulfatase ELISA kit

    E06I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Iduronate sulfatase ELISA kit

    E06I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Iduronate sulfatase ELISA kit

    E06I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Iduronate sulfatase ELISA kit

    E09I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Iduronate sulfatase ELISA kit

    E09I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Iduronate sulfatase ELISA kit

    E09I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Iduronate sulfatase ELISA kit

    E08I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Iduronate sulfatase ELISA kit

    E08I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Iduronate sulfatase ELISA kit

    E08I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Iduronate sulfatase ELISA kit

    E07I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Iduronate sulfatase ELISA kit

    E07I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Iduronate sulfatase ELISA kit

    E07I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    SULF1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K2312002 1.0 ug DNA
    EUR 154

    Human aryl sulfatase A,ASA ELISA Kit

    201-12-0728 96 tests
    EUR 440
    • This aryl sulfatase A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    DLR-IDS-Hu-48T 48T
    EUR 517
    • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    DLR-IDS-Hu-96T 96T
    EUR 673
    • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human N Acetylgalactosamine 6 Sulfatase ELISA kit

    E01G0081-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human N Acetylgalactosamine 6 Sulfatase ELISA kit

    E01G0081-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human N Acetylgalactosamine 6 Sulfatase ELISA kit

    E01G0081-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    20-abx151901
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Iduronate 2-Sulfatase (IDS) ELISA Kit

    abx253725-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ELISA kit for Human Iduronate 2-sulfatase

    EK1482 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Iduronate 2-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human IDS/ Iduronate 2-sulfatase ELISA Kit

    E1209Hu 1 Kit
    EUR 571

    Human IDS(Iduronate 2-sulfatase) ELISA Kit

    EH0767 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: P22304
    • Alias: IDS/SIDS/MPS2/S/Alpha-L-iduronate sulfate sulfatase/iduronate 2-sulfatase/iduronate 2-sulfatase 14 kDa chain/iduronate 2-sulfatase 42 kDa chain/idursulfase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    ELISA kit for Human SULF2 (Sulfatase 2)

    ELK3437 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 2 (SULF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 2 (S
    • Show more
    Description: A sandwich ELISA kit for detection of Sulfatase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human aryl sulfatase A,ASA ELISA Kit

    CN-04535H1 96T
    EUR 439

    Human aryl sulfatase A,ASA ELISA Kit

    CN-04535H2 48T
    EUR 290

    Human aryl sulfatase A(ASA)ELISA Kit

    GA-E0744HM-48T 48T
    EUR 289

    Human aryl sulfatase A(ASA)ELISA Kit

    GA-E0744HM-96T 96T
    EUR 466

    ELISA kit for Human Steryl-sulfatase (STS)

    KTE60396-48T 48T
    EUR 332
    • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Steryl-sulfatase (STS)

    KTE60396-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Steryl-sulfatase (STS)

    KTE60396-96T 96T
    EUR 539
    • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Human aryl sulfatase A(ARSA)ELISA Kit

    QY-E03645 96T
    EUR 361

    Human Iduronate-2-Sulfatase ELISA Kit (IDS)

    RK01625 96 Tests
    EUR 521

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    RDR-IDS-Hu-48Tests 48 Tests
    EUR 544

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    RDR-IDS-Hu-96Tests 96 Tests
    EUR 756

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    RD-IDS-Hu-48Tests 48 Tests
    EUR 521

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    RD-IDS-Hu-96Tests 96 Tests
    EUR 723

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    SEH833Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    SEH833Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    SEH833Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    SEH833Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

    Human Iduronate-2-Sulfatase (IDS) ELISA Kit

    4-SEH833Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Iduronate-2-Sulfatase elisa. Alternative names of the recognized antigen: MPS2
    • SIDS
    • Hunter Syndrome
    • Idursulfase
    • Alpha-L-iduronate sulfate sulfatase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Mouse Sulfatase- modifying factor 1, Sumf1 ELISA KIT

    ELI-52629m 96 Tests
    EUR 865

    Bovine Sulfatase- modifying factor 1, SUMF1 ELISA KIT

    ELI-46212b 96 Tests
    EUR 928

    Mouse Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit

    abx390675-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Sumf1 ELISA Kit| Mouse Sulfatase-modifying factor 1 ELISA Kit

    EF016318 96 Tests
    EUR 689

    SUMF1 ELISA Kit| Bovine Sulfatase-modifying factor 1 ELISA Kit

    EF011943 96 Tests
    EUR 689

    Anti-Sulfatase 1 (1A4)

    YF-MA11397 200 ul
    EUR 363
    Description: Mouse monoclonal to Sulfatase 1

    SULF1 Rabbit pAb

    A13797-100ul 100 ul
    EUR 308

    SULF1 Rabbit pAb

    A13797-200ul 200 ul
    EUR 459

    SULF1 Rabbit pAb

    A13797-20ul 20 ul
    EUR 183

    SULF1 Rabbit pAb

    A13797-50ul 50 ul
    EUR 223

    SULF1 Conjugated Antibody

    C40377 100ul
    EUR 397

    SULF1 cloning plasmid

    CSB-CL814217HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1935
    • Sequence: atgtgctatggaactcctagttataactatgcaccaaatatggataaacactggattatgcagtacacaggaccaatgctgcccatccacatggaatttacaaacattctacagcgcaaaaggctccagactttgatgtcagtggatgattctgtggagaggctgtataacatgc
    • Show more
    Description: A cloning plasmid for the SULF1 gene.

    Anti-SULF1 antibody

    STJ115741 100 µl
    EUR 277
    Description: This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants.

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Human Sulfatase Modifying Factor 1 (SUMF1) CLIA Kit

    20-abx493949
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    SULF1 ORF Vector (Human) (pORF)

    ORF010196 1.0 ug DNA
    EUR 95

    Mouse Sulfatase 2 (SULF2) ELISA Kit

    DLR-SULF2-Mu-48T 48T
    EUR 527
    • Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Mouse Sulfatase 2 (SULF2) ELISA Kit

    DLR-SULF2-Mu-96T 96T
    EUR 688
    • Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Mouse aryl sulfatase A ELISA kit

    E03A0874-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse aryl sulfatase A ELISA kit

    E03A0874-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse aryl sulfatase A ELISA kit

    E03A0874-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat aryl sulfatase A ELISA kit

    E02A0874-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat aryl sulfatase A ELISA kit

    E02A0874-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat aryl sulfatase A ELISA kit

    E02A0874-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit aryl sulfatase A ELISA kit

    E04A0874-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit aryl sulfatase A ELISA kit

    E04A0874-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit aryl sulfatase A ELISA kit

    E04A0874-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Iduronate sulfatase ELISA kit

    E05I0334-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Iduronate sulfatase ELISA kit

    E05I0334-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Iduronate sulfatase ELISA kit

    E05I0334-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat aryl sulfatase A ELISA kit

    E06A0874-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat aryl sulfatase A ELISA kit

    E06A0874-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat aryl sulfatase A ELISA kit

    E06A0874-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Sulfatase 2 (SULF2) ELISA Kit

    20-abx154718
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Sulfatase 2 (SULF2) ELISA Kit

    abx254754-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Monkey aryl sulfatase A ELISA kit

    E09A0874-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey aryl sulfatase A ELISA kit

    E09A0874-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey aryl sulfatase A ELISA kit

    E09A0874-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Sts/ Steryl-sulfatase ELISA Kit

    E0952Ra 1 Kit
    EUR 646

    Dog aryl sulfatase A ELISA kit

    E08A0874-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog aryl sulfatase A ELISA kit

    E08A0874-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog aryl sulfatase A ELISA kit

    E08A0874-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig aryl sulfatase A ELISA kit

    E07A0874-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig aryl sulfatase A ELISA kit

    E07A0874-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig aryl sulfatase A ELISA kit

    E07A0874-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Steryl- sulfatase, Sts ELISA KIT

    ELI-53369m 96 Tests
    EUR 865

    Rat iduronate sulfatase,IDS ELISA Kit

    CN-02004R1 96T
    EUR 468

    Rat iduronate sulfatase,IDS ELISA Kit

    CN-02004R2 48T
    EUR 318

    Mouse Steryl-sulfatase (STS) ELISA Kit

    abx521168-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Rat Steryl-sulfatase (STS) ELISA Kit

    abx521169-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Rat Iduronate Sulfatase (IDS) ELISA Kit

    abx570921-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Mouse Sulfatase 2 (SULF2) ELISA Kit

    abx573406-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat iduronate sulfatase(IDS)ELISA Kit

    GA-E0115RT-48T 48T
    EUR 317

    Rat iduronate sulfatase(IDS)ELISA Kit

    GA-E0115RT-96T 96T
    EUR 496

    Rat iduronate sulfatase(IDS)ELISA Kit

    QY-E11538 96T
    EUR 361

    Mouse Sulfatase 2 (SULF2) ELISA Kit

    RD-SULF2-Mu-48Tests 48 Tests
    EUR 533

    Mouse Sulfatase 2 (SULF2) ELISA Kit

    RD-SULF2-Mu-96Tests 96 Tests
    EUR 740

    Mouse iduronate sulfatase(IDS)ELISA Kit

    QY-E20773 96T
    EUR 361

    Human SULF1(Sulfatase 1) ELISA Kit