Human SULF1(Sulfatase 1) ELISA Kit

Human SULF1(Sulfatase 1) ELISA Kit

To Order Contact us below: 

Human Sulfatase 1 (SULF1) ELISA Kit
RDR-SULF1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit
DLR-SULF1-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Extracellular Sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit
DLR-SULF1-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Extracellular Sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit
RD-SULF1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit
RD-SULF1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit
RDR-SULF1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Extracellular Sulfatase Sulf-1 (SULF1) ELISA Kit
RDR-SULF1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Sulfatase 1 (SULF1) ELISA Kit
20-abx153188	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sulfatase 1 (SULF1) ELISA Kit
abx573979-96tests	Abbexa	96 tests	EUR 825
Shipped within 20 working days.

Human Sulfatase 1(SULF1)ELISA Kit
QY-E02238	Qayee Biotechnology	96T	EUR 361

Human Sulfatase 1 (SULF1) ELISA Kit
SEH108Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
SEH108Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
SEH108Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
SEH108Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
4-SEH108Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfatase 1 elisa. Alternative names of the recognized antigen: HSULF-1 Extracellular sulfatase Sulf-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 1 (SULF1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Sulfatase 1 (SULF1) ELISA Kit
abx547930-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-2 months.

Mouse Sulfatase 1 (SULF1) ELISA Kit
20-abx390674	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

ELISA kit for Human SULF1 (Sulfatase 1)
ELK4163	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 1 (SULF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 1 (S Show more
Description: A sandwich ELISA kit for detection of Sulfatase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Sulfatase 1 (SULF1) Antibody
20-abx213685	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Sulfatase 1 (SULF1) Antibody
20-abx101037	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sulfatase 1 (SULF1) Antibody
20-abx174655	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Sulfatase 1 (SULF1) Antibody
20-abx313584	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Sulfatase 1 (SULF1)
4-RPH108Hu01	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8IWU6 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 61.1kDa Isoelectric Point: 8.3
Description: Recombinant Human Sulfatase 1 expressed in: E.coli

Human Sulfatase 1 (SULF1) CLIA Kit
20-abx190329	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sulfatase 1 (SULF1)CLIA Kit
SCH108Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1)CLIA Kit
SCH108Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1)CLIA Kit
SCH108Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1)CLIA Kit
SCH108Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) CLIA Kit
4-SCH108Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfatase 1 Clia kit. Alternative names of the recognized antigen: HSULF-1 Extracellular sulfatase Sulf-1
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Sulfatase 1 (SULF1)Serum, plasma, tissue homogenates and other biological fluids

Human Sulfatase 1 (SULF1) Protein
20-abx069184	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Extracellular sulfatase Sulf-1(SULF1) ELISA kit
CSB-EL022930HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Extracellular sulfatase Sulf-1(SULF1) ELISA kit
1-CSB-EL022930HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Extracellular sulfatase Sulf-1(SULF1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human SULF1/ Extracellular sulfatase Sulf-1 ELISA Kit
E2422Hu	Sunlong	1 Kit	EUR 605

Human SULF1(Extracellular sulfatase Sulf-1)ELISA Kit
EH15391	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Extracellular sulfatase Sulf- 1, SULF1 ELISA KIT
ELI-46210h	Lifescience Market	96 Tests	EUR 824

Sulfatase 1 (SULF1) Antibody (HRP)
20-abx313585	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfatase 1 (SULF1) Antibody (FITC)
20-abx313586	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfatase 1 (SULF1) Antibody (Biotin)
20-abx313587	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human)
4-PAH108Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF1 (Pro609~Gly871) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1)

Mouse Extracellular sulfatase Sulf- 1, Sulf1 ELISA KIT
ELI-29909m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)
KTE60400-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)
KTE60400-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular sulfatase Sulf-1 (SULF1)
KTE60400-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-1 (SULF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), APC
4-PAH108Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF1 (Pro609~Gly871) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with APC.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), Biotinylated
4-PAH108Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF1 (Pro609~Gly871) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with Biotin.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), Cy3
4-PAH108Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF1 (Pro609~Gly871) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with Cy3.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), FITC
4-PAH108Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF1 (Pro609~Gly871) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with FITC.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), HRP
4-PAH108Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF1 (Pro609~Gly871) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with HRP.

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), PE
4-PAH108Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF1 (Pro609~Gly871) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with PE.

Sulf1 ELISA Kit| Rat Extracellular sulfatase Sulf-1 ELISA Kit
EF019389	Lifescience Market	96 Tests	EUR 689

Sulf1 ELISA Kit| Mouse Extracellular sulfatase Sulf-1 ELISA Kit
EF016317	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Sulfatase 1 (SULF1) Polyclonal Antibody (Human), APC-Cy7
4-PAH108Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF1 (Pro609~Gly871) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sulfatase 1 (SULF1). This antibody is labeled with APC-Cy7.

Sulf1/ Rat Sulf1 ELISA Kit
ELI-46211r	Lifescience Market	96 Tests	EUR 886

SULF1 ELISA KIT|Human
EF005626	Lifescience Market	96 Tests	EUR 689

Human Iduronate sulfatase ELISA kit
E01I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate sulfatase ELISA kit
E01I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate sulfatase ELISA kit
E01I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase ELISA Kit
QY-E05306	Qayee Biotechnology	96T	EUR 361

Anti-Steroid sulfatase/STS Antibody
A01198-1	BosterBio	100ug/vial	EUR 294

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
DLR-SUMF1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from tissue homogenates or other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
DLR-SUMF1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from tissue homogenates or other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
20-abx153191	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sulfatase- modifying factor 1, SUMF1 ELISA KIT
ELI-29982h	Lifescience Market	96 Tests	EUR 824

Human Sulfatase Modifying Factor 1(SUMF1)ELISA Kit
QY-E02237	Qayee Biotechnology	96T	EUR 361

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
RD-SUMF1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
RD-SUMF1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
SEC879Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
SEC879Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
SEC879Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
SEC879Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase Modifying Factor 1 (SUMF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in Tissue homogenates and other biological fluids.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
4-SEC879Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfatase Modifying Factor 1 elisa. Alternative names of the recognized antigen: FGE C-alpha-formylglycine-generating enzyme 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
RDR-SUMF1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
RDR-SUMF1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

SULF1 Antibody
40377-100ul	SAB	100ul	EUR 252

SULF1 Antibody
1-CSB-PA814217LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULF1. Recognizes SULF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

SULF1 Antibody
1-CSB-PA260604	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SULF1. Recognizes SULF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

SULF1 siRNA
20-abx905369	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SULF1 siRNA
20-abx935632	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SULF1 siRNA
20-abx935633	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human iduronate sulfatase,IDS ELISA Kit
201-12-0731	SunredBio	96 tests	EUR 440
This iduronate sulfatase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
DLR-SULF2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
DLR-SULF2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human aryl sulfatase A ELISA kit
E01A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase A ELISA kit
E01A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase A ELISA kit
E01A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sulfatase 2 (SULF2) ELISA Kit
20-abx153189	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sulfatase 2 (SULF2) ELISA Kit
abx253890-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Steryl-sulfatase (STS) ELISA Kit
abx251845-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Human Steryl-sulfatase
EK4979	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Steryl-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human STS(Steryl-sulfatase) ELISA Kit
EH2478	FN Test	96T	EUR 567.6
Detection range: 1.56-100 ng/ml Uniprot ID: P08842 Alias: STS/Steryl-sulfate sulfohydrolase/Arylsulfatase C(ASC)/Steroid sulfatase/ARSC1
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human STS/ Steryl-sulfatase ELISA Kit
E2419Hu	Sunlong	1 Kit	EUR 605

Human Steryl- sulfatase, STS ELISA KIT
ELI-52169h	Lifescience Market	96 Tests	EUR 824

Human iduronate sulfatase,IDS ELISA Kit
CN-04541H1	ChemNorm	96T	EUR 448

Human iduronate sulfatase,IDS ELISA Kit
CN-04541H2	ChemNorm	48T	EUR 297

Human iduronate sulfatase, IDS ELISA Kit
CSB-E09471h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human iduronate sulfatase, IDS ELISA Kit
1-CSB-E09471h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Sulfatase 2 (SULF2) ELISA Kit
abx573928-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human iduronate sulfatase(IDS)ELISA Kit
GA-E0747HM-48T	GenAsia Biotech	48T	EUR 289

Human iduronate sulfatase(IDS)ELISA Kit
GA-E0747HM-96T	GenAsia Biotech	96T	EUR 466

Human iduronate sulfatase(IDS)ELISA Kit
QY-E04351	Qayee Biotechnology	96T	EUR 361

Human Sulfatase 2 ELISA Kit (SULF2)
RK02346	Abclonal	96 Tests	EUR 521

Human Sulfatase 2 (SULF2) ELISA Kit
RD-SULF2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Sulfatase 2 (SULF2) ELISA Kit
RD-SULF2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Sulfatase 2 (SULF2) ELISA Kit
RDR-SULF2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sulfatase 2 (SULF2) ELISA Kit
RDR-SULF2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Sulfatase 2 (SULF2) ELISA Kit
SEH107Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
SEH107Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
SEH107Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
SEH107Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
4-SEH107Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfatase 2 elisa. Alternative names of the recognized antigen: HSULF-2 Extracellular sulfatase Sulf-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

anti-Sulfatase 1
YF-PA17790	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Sulfatase 1

anti-Sulfatase 1
YF-PA17791	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Sulfatase 1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

ELISA kit for Human SUMF1 (Sulfatase Modifying Factor 1)
ELK3331	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase Modifying Factor 1 (SUMF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Sulfatase Modifying Factor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)
KTE60403-48T	Abbkine	48T	EUR 332
Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from Show more
Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)
KTE60403-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from Show more
Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sulfatase-modifying factor 1 (SUMF1)
KTE60403-96T	Abbkine	96T	EUR 539
Sulfatases catalyze the hydrolysis of sulfate esters such as glycosaminoglycans, sulfolipids, and steroid sulfates. C-alpha-formylglycine (FGly), the catalytic residue in the active site of eukaryotic sulfatases, is posttranslationally generated from Show more
Description: Quantitative sandwich ELISA for measuring Human Sulfatase-modifying factor 1 (SUMF1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human SULF1 shRNA Plasmid
20-abx958091	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat Iduronate sulfatase ELISA kit
E02I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit
E02I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit
E02I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit
E04I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit
E04I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit
E04I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit
E03I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit
E03I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit
E03I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit
E06I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit
E06I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit
E06I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit
E09I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit
E09I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit
E09I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit
E08I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit
E08I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit
E08I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit
E07I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit
E07I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit
E07I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SULF1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2312002	ABM	1.0 ug DNA	EUR 154

Human aryl sulfatase A,ASA ELISA Kit
201-12-0728	SunredBio	96 tests	EUR 440
This aryl sulfatase A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
DLR-IDS-Hu-48T	DL Develop	48T	EUR 517
Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
DLR-IDS-Hu-96T	DL Develop	96T	EUR 673
Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit
E01G0081-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit
E01G0081-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit
E01G0081-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
20-abx151901	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Iduronate 2-Sulfatase (IDS) ELISA Kit
abx253725-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Iduronate 2-sulfatase
EK1482	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Iduronate 2-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IDS/ Iduronate 2-sulfatase ELISA Kit
E1209Hu	Sunlong	1 Kit	EUR 571

Human IDS(Iduronate 2-sulfatase) ELISA Kit
EH0767	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P22304 Alias: IDS/SIDS/MPS2/S/Alpha-L-iduronate sulfate sulfatase/iduronate 2-sulfatase/iduronate 2-sulfatase 14 kDa chain/iduronate 2-sulfatase 42 kDa chain/idursulfase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human SULF2 (Sulfatase 2)
ELK3437	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 2 (SULF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 2 (S Show more
Description: A sandwich ELISA kit for detection of Sulfatase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human aryl sulfatase A,ASA ELISA Kit
CN-04535H1	ChemNorm	96T	EUR 439

Human aryl sulfatase A,ASA ELISA Kit
CN-04535H2	ChemNorm	48T	EUR 290

Human aryl sulfatase A(ASA)ELISA Kit
GA-E0744HM-48T	GenAsia Biotech	48T	EUR 289

Human aryl sulfatase A(ASA)ELISA Kit
GA-E0744HM-96T	GenAsia Biotech	96T	EUR 466

ELISA kit for Human Steryl-sulfatase (STS)
KTE60396-48T	Abbkine	48T	EUR 332
STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Steryl-sulfatase (STS)
KTE60396-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Steryl-sulfatase (STS)
KTE60396-96T	Abbkine	96T	EUR 539
STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human aryl sulfatase A(ARSA)ELISA Kit
QY-E03645	Qayee Biotechnology	96T	EUR 361

Human Iduronate-2-Sulfatase ELISA Kit (IDS)
RK01625	Abclonal	96 Tests	EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RDR-IDS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RDR-IDS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RD-IDS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RD-IDS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
4-SEH833Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Iduronate-2-Sulfatase elisa. Alternative names of the recognized antigen: MPS2 SIDS Hunter Syndrome Idursulfase Alpha-L-iduronate sulfate sulfatase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sulfatase- modifying factor 1, Sumf1 ELISA KIT
ELI-52629m	Lifescience Market	96 Tests	EUR 865

Bovine Sulfatase- modifying factor 1, SUMF1 ELISA KIT
ELI-46212b	Lifescience Market	96 Tests	EUR 928

Mouse Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
abx390675-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Sumf1 ELISA Kit| Mouse Sulfatase-modifying factor 1 ELISA Kit
EF016318	Lifescience Market	96 Tests	EUR 689

SUMF1 ELISA Kit| Bovine Sulfatase-modifying factor 1 ELISA Kit
EF011943	Lifescience Market	96 Tests	EUR 689

SULF1 Rabbit pAb
A13797-100ul	Abclonal	100 ul	EUR 308

SULF1 Rabbit pAb
A13797-200ul	Abclonal	200 ul	EUR 459

SULF1 Rabbit pAb
A13797-20ul	Abclonal	20 ul	EUR 183

SULF1 Rabbit pAb
A13797-50ul	Abclonal	50 ul	EUR 223

SULF1 Conjugated Antibody
C40377	SAB	100ul	EUR 397

SULF1 cloning plasmid
CSB-CL814217HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1935 Sequence: atgtgctatggaactcctagttataactatgcaccaaatatggataaacactggattatgcagtacacaggaccaatgctgcccatccacatggaatttacaaacattctacagcgcaaaaggctccagactttgatgtcagtggatgattctgtggagaggctgtataacatgc Show more
Description: A cloning plasmid for the SULF1 gene.

Anti-SULF1 antibody
STJ115741	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants.

Anti-Sulfatase 1 (1A4)
YF-MA11397	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to Sulfatase 1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Human Sulfatase Modifying Factor 1 (SUMF1) CLIA Kit
20-abx493949	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

SULF1 ORF Vector (Human) (pORF)
ORF010196	ABM	1.0 ug DNA	EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Mouse Sulfatase 2 (SULF2) ELISA Kit
DLR-SULF2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit
DLR-SULF2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse aryl sulfatase A ELISA kit
E03A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit
E03A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit
E03A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit
E02A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit
E02A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit
E02A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit aryl sulfatase A ELISA kit
E04A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit aryl sulfatase A ELISA kit
E04A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit aryl sulfatase A ELISA kit
E04A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit
E05I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit
E05I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit
E05I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit
E06A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit
E06A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit
E06A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sulfatase 2 (SULF2) ELISA Kit
20-abx154718	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit
abx254754-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Monkey aryl sulfatase A ELISA kit
E09A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey aryl sulfatase A ELISA kit
E09A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey aryl sulfatase A ELISA kit
E09A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sts/ Steryl-sulfatase ELISA Kit
E0952Ra	Sunlong	1 Kit	EUR 646

Dog aryl sulfatase A ELISA kit
E08A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog aryl sulfatase A ELISA kit
E08A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog aryl sulfatase A ELISA kit
E08A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig aryl sulfatase A ELISA kit
E07A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig aryl sulfatase A ELISA kit
E07A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig aryl sulfatase A ELISA kit
E07A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Steryl- sulfatase, Sts ELISA KIT
ELI-53369m	Lifescience Market	96 Tests	EUR 865

Rat iduronate sulfatase,IDS ELISA Kit
CN-02004R1	ChemNorm	96T	EUR 468

Rat iduronate sulfatase,IDS ELISA Kit
CN-02004R2	ChemNorm	48T	EUR 318

Mouse Steryl-sulfatase (STS) ELISA Kit
abx521168-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Steryl-sulfatase (STS) ELISA Kit
abx521169-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Iduronate Sulfatase (IDS) ELISA Kit
abx570921-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit
abx573406-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat iduronate sulfatase(IDS)ELISA Kit
GA-E0115RT-48T	GenAsia Biotech	48T	EUR 317

Rat iduronate sulfatase(IDS)ELISA Kit
GA-E0115RT-96T	GenAsia Biotech	96T	EUR 496

Rat iduronate sulfatase(IDS)ELISA Kit
QY-E11538	Qayee Biotechnology	96T	EUR 361

Mouse Sulfatase 2 (SULF2) ELISA Kit
RD-SULF2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Sulfatase 2 (SULF2) ELISA Kit
RD-SULF2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse iduronate sulfatase(IDS)ELISA Kit
QY-E20773	Qayee Biotechnology	96T	EUR 361

Mouse Sulfatase 2 (SULF2) ELISA Kit
RDR-SULF2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Sulfatase 2 (SULF2) ELISA Kit
RDR-SULF2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Sulfatase 2 (SULF2) ELISA Kit
SEH107Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit
SEH107Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human SULF1(Sulfatase 1) ELISA Kit