Human RPN1(Ribophorin I) ELISA Kit

Human RPN1(Ribophorin I) ELISA Kit

To Order Contact us below: 

Human Ribophorin I (RPN1) ELISA Kit

RDR-RPN1-Hu-96Tests 96 Tests
EUR 756

Human Ribophorin I (RPN1) ELISA Kit

RD-RPN1-Hu-48Tests 48 Tests
EUR 521

Human Ribophorin I (RPN1) ELISA Kit

RD-RPN1-Hu-96Tests 96 Tests
EUR 723

Human Ribophorin I (RPN1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribophorin I(RPN1)ELISA Kit

QY-E03154 96T
EUR 361

Human Ribophorin I (RPN1) ELISA Kit

SEC769Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit

SEC769Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit

SEC769Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit

SEC769Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribophorin I elisa. Alternative names of the recognized antigen: RPNI
  • OST1
  • RBPH1
  • Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 1
  • Dolichyl-diphosphooligosaccharide protein glycosyltransferase 67 kDa subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribophorin I (RPN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Ribophorin I (RPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin I (RPN1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribophorin I (RPN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin I (RPN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Ribophorin I (RPN1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04843
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04843
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04843
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04843
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.3kDa
  • Isoelectric Point: 6.4
Description: Recombinant Human Recombinant Ribophorin I (RPN1) expressed in: E.coli

Recombinant Ribophorin I (RPN1)

  • EUR 533.66
  • EUR 246.00
  • EUR 1726.24
  • EUR 642.08
  • EUR 1184.16
  • EUR 420.00
  • EUR 4165.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91YQ5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.4kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Ribophorin I expressed in: E.coli

Human Ribophorin I (RPN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ribophorin I (RPN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human RPN1 (Ribophorin I)

ELK4062 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribophorin I (RPN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ribophorin I (
  • Show more
Description: A sandwich ELISA kit for detection of Ribophorin I from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Ribophorin I (RPN1) Protein

  • EUR 746.00
  • EUR 300.00
  • EUR 2318.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Ribophorin I (RPN1) Antibody (FITC)

  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ser273~Lys518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1)

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ala24~Ser179)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Arg180~Ile307)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Leu308~Glu438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ser273~Lys518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with APC.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ser273~Lys518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with Biotin.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ser273~Lys518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with Cy3.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ser273~Lys518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with FITC.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ser273~Lys518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with HRP.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ser273~Lys518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with PE.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ala24~Ser179)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ala24~Ser179)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ala24~Ser179)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ala24~Ser179)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ala24~Ser179)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ala24~Ser179)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Arg180~Ile307)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Arg180~Ile307)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Arg180~Ile307)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Arg180~Ile307)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Arg180~Ile307)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Arg180~Ile307)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Leu308~Glu438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Leu308~Glu438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Leu308~Glu438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Leu308~Glu438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Leu308~Glu438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Leu308~Glu438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

Ribophorin 1 (RPN1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ser273~Lys518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Ala24~Ser179)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Arg180~Ile307)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RPN1 (Leu308~Glu438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

Ribophorin I antibody

70R-7108 50 ug
EUR 467
Description: Rabbit polyclonal Ribophorin I antibody raised against the middle region of RPN1

Ribophorin I antibody

70R-7110 50 ug
EUR 467
Description: Rabbit polyclonal Ribophorin I antibody raised against the N terminal of RPN1

Ribophorin I Blocking Peptide

33R-1015 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Thap11 antibody, catalog no. 70R-9605

Ribophorin I Blocking Peptide

33R-9295 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN1 antibody, catalog no. 70R-7110

Anti-Ribophorin I (2C10-2F6)

YF-MA15253 100 ug
EUR 363
Description: Mouse monoclonal to Ribophorin I

Anti-Ribophorin I (4B1-1E6)

YF-MA15254 100 ug
EUR 363
Description: Mouse monoclonal to Ribophorin I

Rpn1/ Rat Rpn1 ELISA Kit

ELI-15193r 96 Tests
EUR 886


EF002608 96 Tests
EUR 689


ELI-36305h 96 Tests
EUR 824

Human Kinase Library I

HKIN-I 1 set
EUR 450

Human Drug Detoxication I

HDTX-I 1 set
EUR 548

RPN1 ELISA Kit (Human) (OKCD00686)

OKCD00686 96 Wells
EUR 831
Description: Description of target: Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

Human Ribophorin II(RPN2)ELISA Kit

QY-E03153 96T
EUR 361

Mouse Rpn1 ELISA KIT

ELI-30183m 96 Tests
EUR 865


ELI-40915c 96 Tests
EUR 928

Human Cytokine Primer Library I

HCA-I 1 set
EUR 450

Human Colon Cancer Primer Library I

HCCP-I 1 set
EUR 548

Human DNA Repair Primer Library I

HDRL-I 1 set
EUR 548

Human Drug Transporter I Primer Library

HDTP-I 1 set
EUR 548

Human Interferon Type I Signaling Primer Library

HIFN-I 1 set
EUR 548

Human Cancer Driver Gene I Primer Library

HCDG-I 1 set
EUR 645

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mouse Cytokine Primer Library I

MCA-I 1 set
EUR 450

Rat Cytokine Primer Library I

RCA-I 1 set
EUR 548

Mouse DNA Repair Primer Library I

MDRL-I 1 set
EUR 645

Ribophorin II antibody

70R-6845 50 ug
EUR 467
Description: Rabbit polyclonal Ribophorin II antibody raised against the middle region of RPN2

Ribophorin II antibody

70R-7330 50 ug
EUR 467
Description: Rabbit polyclonal Ribophorin II antibody raised against the N terminal of RPN2

Ribophorin II (Recombinant)

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RPN1 antibody

70R-19993 50 ul
EUR 435
Description: Rabbit polyclonal RPN1 antibody

RPN1 Antibody

36173-100ul 100ul
EUR 252

RPN1 antibody

39133-100ul 100ul
EUR 252

RPN1 antibody

10R-5666 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5667 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5668 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5669 100 ul
EUR 726
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5670 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5671 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5672 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5673 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5674 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RPN1 Antibody

DF12727 200ul
EUR 304
Description: RPN1 Antibody detects endogenous levels of RPN1.

RPN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RPN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RPN1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human RPN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPN1 Recombinant Protein (Human)

RP027055 100 ug Ask for price

Rpn1 ELISA Kit| Rat Dolichyl-diphosphooligosaccharide--protein

EF019270 96 Tests
EUR 689

Rpn1 ELISA Kit| Mouse Dolichyl-diphosphooligosaccharide--protei

EF016099 96 Tests
EUR 689

RPN1 ELISA Kit| chicken Dolichyl-diphosphooligosaccharide--prot

EF012495 96 Tests
EUR 689

Ribophorin II Blocking Peptide

33R-4018 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN2 antibody, catalog no. 70R-6845

Ribophorin II Blocking Peptide

33R-1522 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN2 antibody, catalog no. 70R-7330

Ribophorin 2 (RPN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody

abx031592-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody

abx031592-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RPN1 Rabbit pAb

A12497-100ul 100 ul
EUR 308

RPN1 Rabbit pAb

A12497-200ul 200 ul
EUR 459

RPN1 Rabbit pAb

A12497-20ul 20 ul
EUR 183

RPN1 Rabbit pAb

A12497-50ul 50 ul
EUR 223

RPN1 Blocking Peptide

DF12727-BP 1mg
EUR 195

RPN1 Conjugated Antibody

C36173 100ul
EUR 397

RPN1 Conjugated Antibody

C39133 100ul
EUR 397

RPN1 cloning plasmid

CSB-CL020344HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1824
  • Sequence: atggaggcgccagccgccggcttgtttctgctcctgttgcttgggacttgggccccggcgccgggcagcgcctcctccgaggcaccgccgctgatcaatgaggacgtgaagcgcacagtggacctaagcagccacctggctaaggtgacggccgaggtggtcctggcgcacctgg
  • Show more
Description: A cloning plasmid for the RPN1 gene.

RPN1 Rabbit pAb

A6726-100ul 100 ul
EUR 308

RPN1 Rabbit pAb

A6726-200ul 200 ul
EUR 459

RPN1 Rabbit pAb

A6726-20ul 20 ul
EUR 183

RPN1 Rabbit pAb

A6726-50ul 50 ul
EUR 223

RPN1 Polyclonal Antibody

A54001 100 µg
EUR 570.55
Description: fast delivery possible

anti- RPN1 antibody

FNab07450 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ribophorin I
  • Uniprot ID: P04843
  • Gene ID: 6184
  • Research Area: Metabolism
Description: Antibody raised against RPN1

Anti-RPN1 antibody

PAab07450 100 ug
EUR 386

pDONR223-RPN1 Plasmid

PVTB01119-1 2 ug
EUR 356

Anti-RPN1 antibody

STJ28809 100 µl
EUR 277
Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome.

Anti-RPN1 antibody

STJ114371 100 µl
EUR 277
Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome.

RPN2 Ribophorin II Human Recombinant Protein

PROTP04844 Regular: 20ug
EUR 317
Description: RPN2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 539 amino acids (23-540) and having a molecular mass of 59.2kDa.;RPN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Angiotensin I (Ang I) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Angiotensin I (Ang I) ELISA Kit

abx252004-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ANG I(Angiotensin I) ELISA Kit

EH2626 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Alias: ANG I
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human PCOL-I(Procollagen I) ELISA Kit

EH4851 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens ;Sensitivity: 37.5 pg/ml


EHM0283 96Tests
EUR 521

Human Troponin I (Tn-I) ELISA Kit

abx350097-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

RPN1 ORF Vector (Human) (pORF)

ORF009019 1.0 ug DNA
EUR 95

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.


MAG-FRAG-I-1 1/pk
EUR 64
Description: Bioscience Mag Beads; Magnetic Fragment Select


MAG-FRAG-I-250 1/pk
EUR 1953
Description: Bioscience Mag Beads; Magnetic Fragment Select


MAG-FRAG-I-5 1/pk
EUR 158
Description: Bioscience Mag Beads; Magnetic Fragment Select


MAG-FRAG-I-50 1/pk
EUR 659
Description: Bioscience Mag Beads; Magnetic Fragment Select

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human MHC I/AgB I/H-1 I ELISA Kit

EHM0279 96Tests
EUR 521

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E01D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E01D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E01D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Tn-I (Troponin I)

E-EL-H0144 1 plate of 96 wells
EUR 377
  • Gentaur's Tn-I ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Tn-I. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Tn-I (Troponin I) in samples from Serum, Plasma, Cell supernatant

Human MHC I/H-2 I ELISA Kit

EHM0280 96Tests
EUR 521

Human Collagenase I ELISA Kit

201-12-0719 96 tests
EUR 440
  • This Collagenase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Gastrin I ELISA kit

55R-IB09607 96 wells
EUR 795
Description: ELISA kit for the detection of Gastrin I in the research laboratory

Human Pepsinogen I ELISA Kit

DEIA2005 96T
EUR 1036
Description: This ELISA (enzyme-linked immunosorbent assay) kit is intended for measurement of human pepsinogen I levels in serum.

Human Collagenase I ELISA kit

E01C0051-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagenase I ELISA kit

E01C0051-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagenase I ELISA kit

E01C0051-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Deoxyribonuclease I ELISA kit

E01D0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Deoxyribonuclease I ELISA kit

E01D0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Deoxyribonuclease I ELISA kit

E01D0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human deoxyribonuclease I ELISA kit

E01D0246-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human deoxyribonuclease I ELISA kit

E01D0246-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human deoxyribonuclease I ELISA kit

E01D0246-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transcobalamin I ELISA kit

E01T0876-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transcobalamin I ELISA kit

E01T0876-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transcobalamin I ELISA kit

E01T0876-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiotensin I ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human I ctp ELISA Kit

EHA0672 96Tests
EUR 521


EHA0714 96Tests
EUR 521

Human Ang-I ELISA Kit

EHA0812 96Tests
EUR 521

Human Col I ELISA Kit

EHC0788 96Tests
EUR 521

Human Dnase I ELISA Kit

EHD0221 96Tests
EUR 521

Human Dnase-I ELISA Kit

EHD0253 96Tests
EUR 521


EHI0409 96Tests
EUR 521


EHT0533 96Tests
EUR 521

Human angiotension I ELISA Kit

ELA-E0811h 96 Tests
EUR 824

Angiotensin I (Human) ELISA Kit

EUR 805

Collagenase I (Human) ELISA Kit

EUR 805

Troponin I (Human) ELISA Kit

EUR 620


EF010944 96 Tests
EUR 689

cyclin I ELISA KIT|Human

EF008950 96 Tests
EUR 689


EF006592 96 Tests
EUR 689

Collagenase I ELISA KIT|Human

EF006725 96 Tests
EUR 689

Glyoxalase I ELISA KIT|Human

EF006867 96 Tests
EUR 689


EF003560 96 Tests
EUR 689

Pepsinogen I ELISA KIT|Human

EF001677 96 Tests
EUR 689

Human Pepsinogen I ELISA Kit

CSB-E17538h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Pepsinogen I in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Pepsinogen I ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Pepsinogen I in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Collagenase I ELISA Kit

CN-03970H1 96T
EUR 471

Human Collagenase I ELISA Kit

CN-03970H2 48T
EUR 322

Human Collagenase I ELISA Kit

GA-E0735HM-48T 48T
EUR 289

Human Collagenase I ELISA Kit

GA-E0735HM-96T 96T
EUR 466

Human Troponin I ELISA kit

LF-EK0128 1×96T
EUR 603

Human Collagenase I ELISA Kit

QY-E02844 96T
EUR 361

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Angiotensin I (Ang I) ELISA Kit

abx520454-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ANG I(Angiotensin I) ELISA Kit

EU3123 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: General;Sensitivity: 0.188 ng/ml

RPN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat RPN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPN1 Recombinant Protein (Mouse)

RP169139 100 ug Ask for price

RPN1 Recombinant Protein (Rat)

RP226742 100 ug Ask for price

RPN1 sgRNA CRISPR Lentivector set (Human)

K1997601 3 x 1.0 ug
EUR 339

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Tn-I ELISA Kit| Porcine Troponin I ELISA Kit

EF016700 96 Tests
EUR 689

Tn-I ELISA Kit| Rabbit Troponin I ELISA Kit

EF016760 96 Tests
EUR 689

Collagenase I ELISA Kit| Rat Collagenase I ELISA Kit

EF016982 96 Tests
EUR 689

Tn-I ELISA Kit| Rat Troponin I ELISA Kit

EF018088 96 Tests
EUR 689

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

General Ang-I/ Angiotensin I ELISA Kit

E0006Ge 1 Kit
EUR 717

Rat Angiotensin I (Ang I) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog Angiotensin I (Ang I) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Angiotensin I (Ang I) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Angiotensin I (Ang I) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Pig Troponin I (Tn-I) ELISA Kit

abx255574-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rat Troponin I (Tn-I) ELISA Kit

abx256062-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rabbit Troponin I (Tn-I) ELISA Kit

abx257092-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.


ELA-E0131r 96 Tests
EUR 886

i-PTH/ Rat i- PTH ELISA Kit

ELA-E0474r 96 Tests
EUR 886

cTn-I/ Rat cTn- I ELISA Kit

ELA-E0478r 96 Tests
EUR 886

Tn-I/ Rat Tn- I ELISA Kit

ELA-E0564r 96 Tests
EUR 886

Col I/ Rat Col I ELISA Kit

ELA-E0571r 96 Tests
EUR 886

Ang-I/ Rat Ang- I ELISA Kit

ELA-E0811r 96 Tests
EUR 886

DNase-I/ Rat DNase- I ELISA Kit

ELA-E1127r 96 Tests
EUR 886


EBM0283 96Tests
EUR 521

Anserine MHC I/RLA I ELISA Kit

EAM0283 96Tests
EUR 521


ECM0283 96Tests
EUR 521


EGTM0283 96Tests
EUR 521

General Angiotensin I, Ang-I ELISA KIT

ELI-07537Ge 96 Tests
EUR 886

Rat annexin I (ANX-I) ELISA Kit

CSB-E15811r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat annexin I (ANX-I) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat annexin I (ANX-I) ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat annexin I (ANX-I) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey Angiotensin I (Ang I) ELISA Kit

abx359809-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Pig Angiotensin I (Ang I) ELISA Kit

abx361852-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rabbit Angiotensin I (Ang I) ELISA Kit

abx362177-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Troponin I (Tn-I) ELISA Kit

abx350148-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Chicken Troponin I (Tn-I) ELISA Kit

abx356933-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Chicken Angiotensin I (Ang I) ELISA Kit

abx357036-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Monkey Troponin I (Tn-I) ELISA Kit

abx358975-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Sheep Angiotensin I (Ang I) ELISA Kit

abx364718-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Rat Angiotensin I (Ang I) ELISA Kit

abx574142-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Dog Angiotensin I (Ang I) ELISA Kit

abx575153-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse Angiotensin I (Ang I) ELISA Kit

abx575764-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human RPN1(Ribophorin I) ELISA Kit