Human RPN1(Ribophorin I) ELISA Kit

Human RPN1(Ribophorin I) ELISA Kit

To Order Contact us below: 

Human Ribophorin I (RPN1) ELISA Kit
RDR-RPN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Ribophorin I (RPN1) ELISA Kit
RD-RPN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Ribophorin I (RPN1) ELISA Kit
RD-RPN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Ribophorin I (RPN1) ELISA Kit
20-abx152971	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Ribophorin I(RPN1)ELISA Kit
QY-E03154	Qayee Biotechnology	96T	EUR 361

Human Ribophorin I (RPN1) ELISA Kit
SEC769Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit
SEC769Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit
SEC769Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit
SEC769Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit
4-SEC769Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ribophorin I elisa. Alternative names of the recognized antigen: RPNI OST1 RBPH1 Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 1 Dolichyl-diphosphooligosaccharide protein glycosyltransferase 67 kDa subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribophorin I (RPN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Ribophorin I (RPN1) Antibody
20-abx101029	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody
20-abx101030	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody
20-abx101031	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody
20-abx101032	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody
20-abx101033	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody
20-abx115218	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribophorin I (RPN1) Antibody
20-abx174419	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Ribophorin I (RPN1) Antibody
20-abx241913	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ribophorin I (RPN1) Antibody
20-abx241914	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Ribophorin I (RPN1)
4-RPC769Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04843 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)
4-RPC769Hu02	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04843 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)
4-RPC769Hu03	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04843 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)
4-RPC769Hu04	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04843 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 58.3kDa Isoelectric Point: 6.4
Description: Recombinant Human Recombinant Ribophorin I (RPN1) expressed in: E.coli

Recombinant Ribophorin I (RPN1)
4-RPC769Mu01	Cloud-Clone	EUR 533.66 EUR 246.00 EUR 1726.24 EUR 642.08 EUR 1184.16 EUR 420.00 EUR 4165.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q91YQ5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 60.4kDa Isoelectric Point: 6.2
Description: Recombinant Mouse Ribophorin I expressed in: E.coli

Human Ribophorin I (RPN1) Protein
20-abx068930	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein
20-abx068931	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein
20-abx068932	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein
20-abx654965	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Ribophorin I (RPN1) CLIA Kit
20-abx493890	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human RPN1 (Ribophorin I)
ELK4062	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribophorin I (RPN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ribophorin I ( Show more
Description: A sandwich ELISA kit for detection of Ribophorin I from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Ribophorin I (RPN1) Protein
20-abx068933	Abbexa	EUR 746.00 EUR 300.00 EUR 2318.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Ribophorin I (RPN1) Antibody (FITC)
20-abx271175	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody (Biotin)
20-abx271441	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody (Biotin)
20-abx272297	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse)
4-PAC769Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ser273~Lys518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1)

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)
4-PAC769Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ala24~Ser179) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)
4-PAC769Hu02	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Arg180~Ile307) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)
4-PAC769Hu03	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Leu308~Glu438) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), APC
4-PAC769Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ser273~Lys518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with APC.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC769Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ser273~Lys518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with Biotin.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), Cy3
4-PAC769Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ser273~Lys518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with Cy3.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), FITC
4-PAC769Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ser273~Lys518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with FITC.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), HRP
4-PAC769Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ser273~Lys518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with HRP.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), PE
4-PAC769Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ser273~Lys518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with PE.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC
4-PAC769Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ala24~Ser179) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAC769Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ala24~Ser179) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3
4-PAC769Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ala24~Ser179) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC
4-PAC769Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ala24~Ser179) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP
4-PAC769Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ala24~Ser179) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE
4-PAC769Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ala24~Ser179) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC
4-PAC769Hu02-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Arg180~Ile307) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAC769Hu02-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Arg180~Ile307) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3
4-PAC769Hu02-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Arg180~Ile307) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC
4-PAC769Hu02-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Arg180~Ile307) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP
4-PAC769Hu02-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Arg180~Ile307) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE
4-PAC769Hu02-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Arg180~Ile307) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC
4-PAC769Hu03-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Leu308~Glu438) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAC769Hu03-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Leu308~Glu438) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3
4-PAC769Hu03-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Leu308~Glu438) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC
4-PAC769Hu03-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Leu308~Glu438) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP
4-PAC769Hu03-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Leu308~Glu438) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE
4-PAC769Hu03-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Leu308~Glu438) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

Ribophorin 1 (RPN1) Antibody
20-abx141902	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ribophorin I (RPN1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC769Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ser273~Lys518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAC769Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Ala24~Ser179) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAC769Hu02-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Arg180~Ile307) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAC769Hu03-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RPN1 (Leu308~Glu438) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

Ribophorin I antibody
70R-7108	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Ribophorin I antibody raised against the middle region of RPN1

Ribophorin I antibody
70R-7110	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Ribophorin I antibody raised against the N terminal of RPN1

Ribophorin I Blocking Peptide
33R-1015	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Thap11 antibody, catalog no. 70R-9605

Ribophorin I Blocking Peptide
33R-9295	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN1 antibody, catalog no. 70R-7110

Anti-Ribophorin I (2C10-2F6)
YF-MA15253	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Ribophorin I

Anti-Ribophorin I (4B1-1E6)
YF-MA15254	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Ribophorin I

Rpn1/ Rat Rpn1 ELISA Kit
ELI-15193r	Lifescience Market	96 Tests	EUR 886

RPN1 ELISA KIT|Human
EF002608	Lifescience Market	96 Tests	EUR 689

Human RPN1 ELISA KIT
ELI-36305h	Lifescience Market	96 Tests	EUR 824

Human Kinase Library I
HKIN-I	Real Time Primers	1 set	EUR 450

Human Drug Detoxication I
HDTX-I	Real Time Primers	1 set	EUR 548

RPN1 ELISA Kit (Human) (OKCD00686)
OKCD00686	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

Human Ribophorin II(RPN2)ELISA Kit
QY-E03153	Qayee Biotechnology	96T	EUR 361

Mouse Rpn1 ELISA KIT
ELI-30183m	Lifescience Market	96 Tests	EUR 865

Chicken RPN1 ELISA KIT
ELI-40915c	Lifescience Market	96 Tests	EUR 928

Human Cytokine Primer Library I
HCA-I	Real Time Primers	1 set	EUR 450

Human Colon Cancer Primer Library I
HCCP-I	Real Time Primers	1 set	EUR 548

Human DNA Repair Primer Library I
HDRL-I	Real Time Primers	1 set	EUR 548

Human Drug Transporter I Primer Library
HDTP-I	Real Time Primers	1 set	EUR 548

Human Interferon Type I Signaling Primer Library
HIFN-I	Real Time Primers	1 set	EUR 548

Human Cancer Driver Gene I Primer Library
HCDG-I	Real Time Primers	1 set	EUR 645

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Cytokine Primer Library I
MCA-I	Real Time Primers	1 set	EUR 450

Rat Cytokine Primer Library I
RCA-I	Real Time Primers	1 set	EUR 548

Mouse DNA Repair Primer Library I
MDRL-I	Real Time Primers	1 set	EUR 645

Ribophorin II antibody
70R-6845	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Ribophorin II antibody raised against the middle region of RPN2

Ribophorin II antibody
70R-7330	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Ribophorin II antibody raised against the N terminal of RPN2

Ribophorin II (Recombinant)
20-abx073549	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

RPN1 antibody
70R-19993	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPN1 antibody

RPN1 Antibody
36173-100ul	SAB	100ul	EUR 252

RPN1 antibody
39133-100ul	SAB	100ul	EUR 252

RPN1 antibody
10R-5666	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody
10R-5667	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody
10R-5668	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody
10R-5669	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody
10R-5670	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody
10R-5671	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody
10R-5672	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody
10R-5673	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody
10R-5674	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 Antibody
1-CSB-PA05124A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RPN1 Antibody
DF12727	Affbiotech	200ul	EUR 304
Description: RPN1 Antibody detects endogenous levels of RPN1.

RPN1 Antibody
1-CSB-PA579544	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RPN1 Antibody
1-CSB-PA233350	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RPN1 Antibody
1-CSB-PA020344GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPN1 siRNA
20-abx904681	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPN1 siRNA
20-abx932007	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPN1 siRNA
20-abx932008	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human RPN1 shRNA Plasmid
20-abx954161	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPN1 Recombinant Protein (Human)
RP027055	ABM	100 ug	Ask for price

Rpn1 ELISA Kit| Rat Dolichyl-diphosphooligosaccharide--protein
EF019270	Lifescience Market	96 Tests	EUR 689

Rpn1 ELISA Kit| Mouse Dolichyl-diphosphooligosaccharide--protei
EF016099	Lifescience Market	96 Tests	EUR 689

RPN1 ELISA Kit| chicken Dolichyl-diphosphooligosaccharide--prot
EF012495	Lifescience Market	96 Tests	EUR 689

Ribophorin II Blocking Peptide
33R-4018	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN2 antibody, catalog no. 70R-6845

Ribophorin II Blocking Peptide
33R-1522	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN2 antibody, catalog no. 70R-7330

Ribophorin 2 (RPN2) Antibody
20-abx115219	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody
20-abx142066	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody
abx031592-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribophorin 2 (RPN2) Antibody
abx031592-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

RPN1 Rabbit pAb
A12497-100ul	Abclonal	100 ul	EUR 308

RPN1 Rabbit pAb
A12497-200ul	Abclonal	200 ul	EUR 459

RPN1 Rabbit pAb
A12497-20ul	Abclonal	20 ul	EUR 183

RPN1 Rabbit pAb
A12497-50ul	Abclonal	50 ul	EUR 223

RPN1 Blocking Peptide
DF12727-BP	Affbiotech	1mg	EUR 195

RPN1 Conjugated Antibody
C36173	SAB	100ul	EUR 397

RPN1 Conjugated Antibody
C39133	SAB	100ul	EUR 397

RPN1 cloning plasmid
CSB-CL020344HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1824 Sequence: atggaggcgccagccgccggcttgtttctgctcctgttgcttgggacttgggccccggcgccgggcagcgcctcctccgaggcaccgccgctgatcaatgaggacgtgaagcgcacagtggacctaagcagccacctggctaaggtgacggccgaggtggtcctggcgcacctgg Show more
Description: A cloning plasmid for the RPN1 gene.

RPN1 Rabbit pAb
A6726-100ul	Abclonal	100 ul	EUR 308

RPN1 Rabbit pAb
A6726-200ul	Abclonal	200 ul	EUR 459

RPN1 Rabbit pAb
A6726-20ul	Abclonal	20 ul	EUR 183

RPN1 Rabbit pAb
A6726-50ul	Abclonal	50 ul	EUR 223

RPN1 Polyclonal Antibody
A54001	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

anti- RPN1 antibody
FNab07450	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: ribophorin I Uniprot ID: P04843 Gene ID: 6184 Research Area: Metabolism
Description: Antibody raised against RPN1

Anti-RPN1 antibody
PAab07450	Lifescience Market	100 ug	EUR 386

pDONR223-RPN1 Plasmid
PVTB01119-1	Lifescience Market	2 ug	EUR 356

Anti-RPN1 antibody
STJ28809	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome.

Anti-RPN1 antibody
STJ114371	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome.

RPN2 Ribophorin II Human Recombinant Protein
PROTP04844	BosterBio	Regular: 20ug	EUR 317
Description: RPN2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 539 amino acids (23-540) and having a molecular mass of 59.2kDa.;RPN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Angiotensin I (Ang I) ELISA Kit
20-abx150653	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Angiotensin I (Ang I) ELISA Kit
abx252004-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human ANG I(Angiotensin I) ELISA Kit
EH2626	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Alias: ANG I
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human PCOL-I(Procollagen I) ELISA Kit
EH4851	FN Test	96T	EUR 524.1
Detection range: 62.5-4000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens ;Sensitivity: 37.5 pg/ml

Human MHC I/RLA I ELISA Kit
EHM0283	Abclonal	96Tests	EUR 521

Human Troponin I (Tn-I) ELISA Kit
abx350097-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

RPN1 ORF Vector (Human) (pORF)
ORF009019	ABM	1.0 ug DNA	EUR 95

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

AXYPREP FRAGMENTSELECT-I KIT- 1 ML - (SAMPLE SIZE)
MAG-FRAG-I-1	CORNING	1/pk	EUR 64
Description: Bioscience Mag Beads; Magnetic Fragment Select

AXYPREP FRAGMENTSELECT-I KIT- 250 ML - 1900 PREPS
MAG-FRAG-I-250	CORNING	1/pk	EUR 1953
Description: Bioscience Mag Beads; Magnetic Fragment Select

AXYPREP FRAGMENTSELECT-I KIT- 5 ML - 4 PREPS
MAG-FRAG-I-5	CORNING	1/pk	EUR 158
Description: Bioscience Mag Beads; Magnetic Fragment Select

AXYPREP FRAGMENTSELECT-I KIT- 50 ML - 380 PREPS
MAG-FRAG-I-50	CORNING	1/pk	EUR 659
Description: Bioscience Mag Beads; Magnetic Fragment Select

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human MHC I/AgB I/H-1 I ELISA Kit
EHM0279	Abclonal	96Tests	EUR 521

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit
E01D0306-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit
E01D0306-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit
E01D0306-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Tn-I (Troponin I)
E-EL-H0144	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's Tn-I ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Tn-I. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human Tn-I (Troponin I) in samples from Serum, Plasma, Cell supernatant

Human MHC I/H-2 I ELISA Kit
EHM0280	Abclonal	96Tests	EUR 521

Human Collagenase I ELISA Kit
201-12-0719	SunredBio	96 tests	EUR 440
This Collagenase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Gastrin I ELISA kit
55R-IB09607	Fitzgerald	96 wells	EUR 795
Description: ELISA kit for the detection of Gastrin I in the research laboratory

Human Pepsinogen I ELISA Kit
DEIA2005	Creative Diagnostics	96T	EUR 1036
Description: This ELISA (enzyme-linked immunosorbent assay) kit is intended for measurement of human pepsinogen I levels in serum.

Human Collagenase I ELISA kit
E01C0051-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagenase I ELISA kit
E01C0051-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Collagenase I ELISA kit
E01C0051-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Deoxyribonuclease I ELISA kit
E01D0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Deoxyribonuclease I ELISA kit
E01D0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Deoxyribonuclease I ELISA kit
E01D0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human deoxyribonuclease I ELISA kit
E01D0246-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human deoxyribonuclease I ELISA kit
E01D0246-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human deoxyribonuclease I ELISA kit
E01D0246-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transcobalamin I ELISA kit
E01T0876-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transcobalamin I ELISA kit
E01T0876-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transcobalamin I ELISA kit
E01T0876-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiotensin I ELISA Kit
20-abx051886	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human I ctp ELISA Kit
EHA0672	Abclonal	96Tests	EUR 521

Human ACE I ELISA Kit
EHA0714	Abclonal	96Tests	EUR 521

Human Ang-I ELISA Kit
EHA0812	Abclonal	96Tests	EUR 521

Human Col I ELISA Kit
EHC0788	Abclonal	96Tests	EUR 521

Human Dnase I ELISA Kit
EHD0221	Abclonal	96Tests	EUR 521

Human Dnase-I ELISA Kit
EHD0253	Abclonal	96Tests	EUR 521

Human I-PTH ELISA Kit
EHI0409	Abclonal	96Tests	EUR 521

Human TNFsR-I ELISA Kit
EHT0533	Abclonal	96Tests	EUR 521

Human angiotension I ELISA Kit
ELA-E0811h	Lifescience Market	96 Tests	EUR 824

Angiotensin I (Human) ELISA Kit
E4515-100	Biovision		EUR 805

Collagenase I (Human) ELISA Kit
E4646-100	Biovision		EUR 805

Troponin I (Human) ELISA Kit
E4735-100	Biovision		EUR 620

PCOL-I ELISA KIT|Human
EF010944	Lifescience Market	96 Tests	EUR 689

cyclin I ELISA KIT|Human
EF008950	Lifescience Market	96 Tests	EUR 689

ANG I ELISA KIT|Human
EF006592	Lifescience Market	96 Tests	EUR 689

Collagenase I ELISA KIT|Human
EF006725	Lifescience Market	96 Tests	EUR 689

Glyoxalase I ELISA KIT|Human
EF006867	Lifescience Market	96 Tests	EUR 689

TFII I ELISA KIT|Human
EF003560	Lifescience Market	96 Tests	EUR 689

Pepsinogen I ELISA KIT|Human
EF001677	Lifescience Market	96 Tests	EUR 689

Human Pepsinogen I ELISA Kit
CSB-E17538h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Pepsinogen I in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Pepsinogen I ELISA Kit
1-CSB-E17538h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Pepsinogen I in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Collagenase I ELISA Kit
CN-03970H1	ChemNorm	96T	EUR 471

Human Collagenase I ELISA Kit
CN-03970H2	ChemNorm	48T	EUR 322

Human Collagenase I ELISA Kit
GA-E0735HM-48T	GenAsia Biotech	48T	EUR 289

Human Collagenase I ELISA Kit
GA-E0735HM-96T	GenAsia Biotech	96T	EUR 466

Human Troponin I ELISA kit
LF-EK0128	Abfrontier	1×96T	EUR 603

Human Collagenase I ELISA Kit
QY-E02844	Qayee Biotechnology	96T	EUR 361

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Angiotensin I (Ang I) ELISA Kit
abx520454-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ANG I(Angiotensin I) ELISA Kit
EU3123	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: General;Sensitivity: 0.188 ng/ml

RPN1 Antibody, HRP conjugated
1-CSB-PA05124B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPN1 Antibody, FITC conjugated
1-CSB-PA05124C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPN1 Antibody, Biotin conjugated
1-CSB-PA05124D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat RPN1 shRNA Plasmid
20-abx985150	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RPN1 shRNA Plasmid
20-abx979606	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPN1 Recombinant Protein (Mouse)
RP169139	ABM	100 ug	Ask for price

RPN1 Recombinant Protein (Rat)
RP226742	ABM	100 ug	Ask for price

RPN1 sgRNA CRISPR Lentivector set (Human)
K1997601	ABM	3 x 1.0 ug	EUR 339

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Tn-I ELISA Kit| Porcine Troponin I ELISA Kit
EF016700	Lifescience Market	96 Tests	EUR 689

Tn-I ELISA Kit| Rabbit Troponin I ELISA Kit
EF016760	Lifescience Market	96 Tests	EUR 689

Collagenase I ELISA Kit| Rat Collagenase I ELISA Kit
EF016982	Lifescience Market	96 Tests	EUR 689

Tn-I ELISA Kit| Rat Troponin I ELISA Kit
EF018088	Lifescience Market	96 Tests	EUR 689

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

General Ang-I/ Angiotensin I ELISA Kit
E0006Ge	Sunlong	1 Kit	EUR 717

Rat Angiotensin I (Ang I) ELISA Kit
20-abx052173	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Dog Angiotensin I (Ang I) ELISA Kit
20-abx150222	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Angiotensin I (Ang I) ELISA Kit
20-abx156700	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Angiotensin I (Ang I) ELISA Kit
20-abx155197	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Pig Troponin I (Tn-I) ELISA Kit
abx255574-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Rat Troponin I (Tn-I) ELISA Kit
abx256062-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rabbit Troponin I (Tn-I) ELISA Kit
abx257092-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

TNFsR-I/ Rat TNFsR- I ELISA Kit
ELA-E0131r	Lifescience Market	96 Tests	EUR 886

i-PTH/ Rat i- PTH ELISA Kit
ELA-E0474r	Lifescience Market	96 Tests	EUR 886

cTn-I/ Rat cTn- I ELISA Kit
ELA-E0478r	Lifescience Market	96 Tests	EUR 886

Tn-I/ Rat Tn- I ELISA Kit
ELA-E0564r	Lifescience Market	96 Tests	EUR 886

Col I/ Rat Col I ELISA Kit
ELA-E0571r	Lifescience Market	96 Tests	EUR 886

Ang-I/ Rat Ang- I ELISA Kit
ELA-E0811r	Lifescience Market	96 Tests	EUR 886

DNase-I/ Rat DNase- I ELISA Kit
ELA-E1127r	Lifescience Market	96 Tests	EUR 886

Bovine MHC I/RLA I ELISA Kit
EBM0283	Abclonal	96Tests	EUR 521

Anserine MHC I/RLA I ELISA Kit
EAM0283	Abclonal	96Tests	EUR 521

Canine MHC I/RLA I ELISA Kit
ECM0283	Abclonal	96Tests	EUR 521

Goat MHC I/RLA I ELISA Kit
EGTM0283	Abclonal	96Tests	EUR 521

General Angiotensin I, Ang-I ELISA KIT
ELI-07537Ge	Lifescience Market	96 Tests	EUR 886

Rat annexin I (ANX-I) ELISA Kit
CSB-E15811r-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat annexin I (ANX-I) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat annexin I (ANX-I) ELISA Kit
1-CSB-E15811r	Cusabio	EUR 946.00 EUR 5782.00 EUR 3060.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat annexin I (ANX-I) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey Angiotensin I (Ang I) ELISA Kit
abx359809-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Pig Angiotensin I (Ang I) ELISA Kit
abx361852-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Rabbit Angiotensin I (Ang I) ELISA Kit
abx362177-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Mouse Troponin I (Tn-I) ELISA Kit
abx350148-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Chicken Troponin I (Tn-I) ELISA Kit
abx356933-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Chicken Angiotensin I (Ang I) ELISA Kit
abx357036-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Monkey Troponin I (Tn-I) ELISA Kit
abx358975-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Sheep Angiotensin I (Ang I) ELISA Kit
abx364718-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Rat Angiotensin I (Ang I) ELISA Kit
abx574142-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Dog Angiotensin I (Ang I) ELISA Kit
abx575153-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Mouse Angiotensin I (Ang I) ELISA Kit
abx575764-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human RPN1(Ribophorin I) ELISA Kit