Human RPN1(Ribophorin I) ELISA Kit

Human RPN1(Ribophorin I) ELISA Kit

To Order Contact us below: 

    Human Ribophorin I (RPN1) ELISA Kit

    RDR-RPN1-Hu-96Tests 96 Tests
    EUR 756

    Human Ribophorin I (RPN1) ELISA Kit

    RD-RPN1-Hu-48Tests 48 Tests
    EUR 521

    Human Ribophorin I (RPN1) ELISA Kit

    RD-RPN1-Hu-96Tests 96 Tests
    EUR 723

    Human Ribophorin I (RPN1) ELISA Kit

    20-abx152971
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ribophorin I(RPN1)ELISA Kit

    QY-E03154 96T
    EUR 361

    Human Ribophorin I (RPN1) ELISA Kit

    SEC769Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

    Human Ribophorin I (RPN1) ELISA Kit

    SEC769Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

    Human Ribophorin I (RPN1) ELISA Kit

    SEC769Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

    Human Ribophorin I (RPN1) ELISA Kit

    SEC769Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribophorin I (RPN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribophorin I (RPN1) in Tissue homogenates and other biological fluids.

    Human Ribophorin I (RPN1) ELISA Kit

    4-SEC769Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ribophorin I elisa. Alternative names of the recognized antigen: RPNI
    • OST1
    • RBPH1
    • Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Subunit 1
    • Dolichyl-diphosphooligosaccharide protein glycosyltransferase 67 kDa subunit
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribophorin I (RPN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Ribophorin I (RPN1) Antibody

    20-abx101029
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Ribophorin I (RPN1) Antibody

    20-abx101030
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Ribophorin I (RPN1) Antibody

    20-abx101031
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Ribophorin I (RPN1) Antibody

    20-abx101032
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Ribophorin I (RPN1) Antibody

    20-abx101033
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Ribophorin I (RPN1) Antibody

    20-abx115218
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ribophorin I (RPN1) Antibody

    20-abx174419
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Ribophorin I (RPN1) Antibody

    20-abx241913
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ribophorin I (RPN1) Antibody

    20-abx241914
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Recombinant Ribophorin I (RPN1)

    4-RPC769Hu01
    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P04843
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 18.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Ribophorin I expressed in: E.coli

    Recombinant Ribophorin I (RPN1)

    4-RPC769Hu02
    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P04843
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 16.0kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Ribophorin I expressed in: E.coli

    Recombinant Ribophorin I (RPN1)

    4-RPC769Hu03
    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P04843
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 17.0kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Ribophorin I expressed in: E.coli

    Recombinant Ribophorin I (RPN1)

    4-RPC769Hu04
    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P04843
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 58.3kDa
    • Isoelectric Point: 6.4
    Description: Recombinant Human Recombinant Ribophorin I (RPN1) expressed in: E.coli

    Recombinant Ribophorin I (RPN1)

    4-RPC769Mu01
    • EUR 533.66
    • EUR 246.00
    • EUR 1726.24
    • EUR 642.08
    • EUR 1184.16
    • EUR 420.00
    • EUR 4165.60
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q91YQ5
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 60.4kDa
    • Isoelectric Point: 6.2
    Description: Recombinant Mouse Ribophorin I expressed in: E.coli

    Human Ribophorin I (RPN1) Protein

    20-abx068930
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Ribophorin I (RPN1) Protein

    20-abx068931
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Ribophorin I (RPN1) Protein

    20-abx068932
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Ribophorin I (RPN1) Protein

    20-abx654965
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Ribophorin I (RPN1) CLIA Kit

    20-abx493890
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human RPN1 (Ribophorin I)

    ELK4062 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribophorin I (RPN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ribophorin I (
    • Show more
    Description: A sandwich ELISA kit for detection of Ribophorin I from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Mouse Ribophorin I (RPN1) Protein

    20-abx068933
    • EUR 746.00
    • EUR 300.00
    • EUR 2318.00
    • EUR 885.00
    • EUR 523.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Ribophorin I (RPN1) Antibody (FITC)

    20-abx271175
    • EUR 495.00
    • EUR 258.00
    • EUR 1455.00
    • EUR 676.00
    • EUR 398.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Ribophorin I (RPN1) Antibody (Biotin)

    20-abx271441
    • EUR 467.00
    • EUR 244.00
    • EUR 1344.00
    • EUR 634.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Ribophorin I (RPN1) Antibody (Biotin)

    20-abx272297
    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Ribophorin I (RPN1) Polyclonal Antibody (Mouse)

    4-PAC769Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ser273~Lys518)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1)

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)

    4-PAC769Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ala24~Ser179)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)

    4-PAC769Hu02
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Arg180~Ile307)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig)

    4-PAC769Hu03
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Leu308~Glu438)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1)

    Ribophorin I (RPN1) Polyclonal Antibody (Mouse), APC

    4-PAC769Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ser273~Lys518)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with APC.

    Ribophorin I (RPN1) Polyclonal Antibody (Mouse), Biotinylated

    4-PAC769Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ser273~Lys518)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with Biotin.

    Ribophorin I (RPN1) Polyclonal Antibody (Mouse), Cy3

    4-PAC769Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ser273~Lys518)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with Cy3.

    Ribophorin I (RPN1) Polyclonal Antibody (Mouse), FITC

    4-PAC769Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ser273~Lys518)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with FITC.

    Ribophorin I (RPN1) Polyclonal Antibody (Mouse), HRP

    4-PAC769Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ser273~Lys518)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with HRP.

    Ribophorin I (RPN1) Polyclonal Antibody (Mouse), PE

    4-PAC769Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ser273~Lys518)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with PE.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC

    4-PAC769Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ala24~Ser179)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated

    4-PAC769Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ala24~Ser179)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3

    4-PAC769Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ala24~Ser179)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC

    4-PAC769Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ala24~Ser179)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP

    4-PAC769Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ala24~Ser179)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE

    4-PAC769Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ala24~Ser179)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC

    4-PAC769Hu02-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Arg180~Ile307)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated

    4-PAC769Hu02-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Arg180~Ile307)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3

    4-PAC769Hu02-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Arg180~Ile307)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC

    4-PAC769Hu02-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Arg180~Ile307)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP

    4-PAC769Hu02-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Arg180~Ile307)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE

    4-PAC769Hu02-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Arg180~Ile307)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC

    4-PAC769Hu03-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Leu308~Glu438)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Biotinylated

    4-PAC769Hu03-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Leu308~Glu438)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Biotin.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), Cy3

    4-PAC769Hu03-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Leu308~Glu438)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with Cy3.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), FITC

    4-PAC769Hu03-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Leu308~Glu438)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with FITC.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), HRP

    4-PAC769Hu03-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Leu308~Glu438)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with HRP.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), PE

    4-PAC769Hu03-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Leu308~Glu438)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with PE.

    Ribophorin 1 (RPN1) Antibody

    20-abx141902
    • EUR 370.00
    • EUR 606.00
    • EUR 300.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ribophorin I (RPN1) Polyclonal Antibody (Mouse), APC-Cy7

    4-PAC769Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ser273~Lys518)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7

    4-PAC769Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Ala24~Ser179)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7

    4-PAC769Hu02-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Arg180~Ile307)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

    Ribophorin I (RPN1) Polyclonal Antibody (Human, Pig), APC-Cy7

    4-PAC769Hu03-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RPN1 (Leu308~Glu438)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Ribophorin I (RPN1). This antibody is labeled with APC-Cy7.

    Ribophorin I antibody

    70R-7108 50 ug
    EUR 467
    Description: Rabbit polyclonal Ribophorin I antibody raised against the middle region of RPN1

    Ribophorin I antibody

    70R-7110 50 ug
    EUR 467
    Description: Rabbit polyclonal Ribophorin I antibody raised against the N terminal of RPN1

    Ribophorin I Blocking Peptide

    33R-1015 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Thap11 antibody, catalog no. 70R-9605

    Ribophorin I Blocking Peptide

    33R-9295 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN1 antibody, catalog no. 70R-7110

    Anti-Ribophorin I (2C10-2F6)

    YF-MA15253 100 ug
    EUR 363
    Description: Mouse monoclonal to Ribophorin I

    Anti-Ribophorin I (4B1-1E6)

    YF-MA15254 100 ug
    EUR 363
    Description: Mouse monoclonal to Ribophorin I

    Rpn1/ Rat Rpn1 ELISA Kit

    ELI-15193r 96 Tests
    EUR 886

    RPN1 ELISA KIT|Human

    EF002608 96 Tests
    EUR 689

    Human RPN1 ELISA KIT

    ELI-36305h 96 Tests
    EUR 824

    Human Kinase Library I

    HKIN-I 1 set
    EUR 450

    Human Drug Detoxication I

    HDTX-I 1 set
    EUR 548

    RPN1 ELISA Kit (Human) (OKCD00686)

    OKCD00686 96 Wells
    EUR 831
    Description: Description of target: Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

    Human Ribophorin II(RPN2)ELISA Kit

    QY-E03153 96T
    EUR 361

    Mouse Rpn1 ELISA KIT

    ELI-30183m 96 Tests
    EUR 865

    Chicken RPN1 ELISA KIT

    ELI-40915c 96 Tests
    EUR 928

    Human Cytokine Primer Library I

    HCA-I 1 set
    EUR 450

    Human Colon Cancer Primer Library I

    HCCP-I 1 set
    EUR 548

    Human DNA Repair Primer Library I

    HDRL-I 1 set
    EUR 548

    Human Drug Transporter I Primer Library

    HDTP-I 1 set
    EUR 548

    Human Interferon Type I Signaling Primer Library

    HIFN-I 1 set
    EUR 548

    Human Cancer Driver Gene I Primer Library

    HCDG-I 1 set
    EUR 645

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Mouse Cytokine Primer Library I

    MCA-I 1 set
    EUR 450

    Rat Cytokine Primer Library I

    RCA-I 1 set
    EUR 548

    Mouse DNA Repair Primer Library I

    MDRL-I 1 set
    EUR 645

    Ribophorin II antibody

    70R-6845 50 ug
    EUR 467
    Description: Rabbit polyclonal Ribophorin II antibody raised against the middle region of RPN2

    Ribophorin II antibody

    70R-7330 50 ug
    EUR 467
    Description: Rabbit polyclonal Ribophorin II antibody raised against the N terminal of RPN2

    Ribophorin II (Recombinant)

    20-abx073549
    • EUR 4490.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    RPN1 antibody

    70R-19993 50 ul
    EUR 435
    Description: Rabbit polyclonal RPN1 antibody

    RPN1 Antibody

    36173-100ul 100ul
    EUR 252

    RPN1 antibody

    39133-100ul 100ul
    EUR 252

    RPN1 antibody

    10R-5666 100 ul
    EUR 691
    Description: Mouse monoclonal RPN1 antibody

    RPN1 antibody

    10R-5667 100 ul
    EUR 691
    Description: Mouse monoclonal RPN1 antibody

    RPN1 antibody

    10R-5668 100 ul
    EUR 691
    Description: Mouse monoclonal RPN1 antibody

    RPN1 antibody

    10R-5669 100 ul
    EUR 726
    Description: Mouse monoclonal RPN1 antibody

    RPN1 antibody

    10R-5670 100 ul
    EUR 691
    Description: Mouse monoclonal RPN1 antibody

    RPN1 antibody

    10R-5671 100 ul
    EUR 691
    Description: Mouse monoclonal RPN1 antibody

    RPN1 antibody

    10R-5672 100 ul
    EUR 691
    Description: Mouse monoclonal RPN1 antibody

    RPN1 antibody

    10R-5673 100 ul
    EUR 691
    Description: Mouse monoclonal RPN1 antibody

    RPN1 antibody

    10R-5674 100 ul
    EUR 691
    Description: Mouse monoclonal RPN1 antibody

    RPN1 Antibody

    1-CSB-PA05124A0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

    RPN1 Antibody

    DF12727 200ul
    EUR 304
    Description: RPN1 Antibody detects endogenous levels of RPN1.

    RPN1 Antibody

    1-CSB-PA579544
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

    RPN1 Antibody

    1-CSB-PA233350
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

    RPN1 Antibody

    1-CSB-PA020344GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    RPN1 siRNA

    20-abx904681
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RPN1 siRNA

    20-abx932007
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RPN1 siRNA

    20-abx932008
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Human RPN1 shRNA Plasmid

    20-abx954161
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    RPN1 Recombinant Protein (Human)

    RP027055 100 ug Ask for price

    Rpn1 ELISA Kit| Rat Dolichyl-diphosphooligosaccharide--protein

    EF019270 96 Tests
    EUR 689

    Rpn1 ELISA Kit| Mouse Dolichyl-diphosphooligosaccharide--protei

    EF016099 96 Tests
    EUR 689

    RPN1 ELISA Kit| chicken Dolichyl-diphosphooligosaccharide--prot

    EF012495 96 Tests
    EUR 689

    Ribophorin II Blocking Peptide

    33R-4018 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN2 antibody, catalog no. 70R-6845

    Ribophorin II Blocking Peptide

    33R-1522 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPN2 antibody, catalog no. 70R-7330

    Ribophorin 2 (RPN2) Antibody

    20-abx115219
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ribophorin 2 (RPN2) Antibody

    20-abx142066
    • EUR 370.00
    • EUR 606.00
    • EUR 300.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ribophorin 2 (RPN2) Antibody

    abx031592-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Ribophorin 2 (RPN2) Antibody

    abx031592-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    RPN1 Rabbit pAb

    A12497-100ul 100 ul
    EUR 308

    RPN1 Rabbit pAb

    A12497-200ul 200 ul
    EUR 459

    RPN1 Rabbit pAb

    A12497-20ul 20 ul
    EUR 183

    RPN1 Rabbit pAb

    A12497-50ul 50 ul
    EUR 223

    RPN1 Blocking Peptide

    DF12727-BP 1mg
    EUR 195

    RPN1 Conjugated Antibody

    C36173 100ul
    EUR 397

    RPN1 Conjugated Antibody

    C39133 100ul
    EUR 397

    RPN1 cloning plasmid

    CSB-CL020344HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1824
    • Sequence: atggaggcgccagccgccggcttgtttctgctcctgttgcttgggacttgggccccggcgccgggcagcgcctcctccgaggcaccgccgctgatcaatgaggacgtgaagcgcacagtggacctaagcagccacctggctaaggtgacggccgaggtggtcctggcgcacctgg
    • Show more
    Description: A cloning plasmid for the RPN1 gene.

    RPN1 Rabbit pAb

    A6726-100ul 100 ul
    EUR 308

    RPN1 Rabbit pAb

    A6726-200ul 200 ul
    EUR 459

    RPN1 Rabbit pAb

    A6726-20ul 20 ul
    EUR 183

    RPN1 Rabbit pAb

    A6726-50ul 50 ul
    EUR 223

    RPN1 Polyclonal Antibody

    A54001 100 µg
    EUR 570.55
    Description: fast delivery possible

    anti- RPN1 antibody

    FNab07450 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: ribophorin I
    • Uniprot ID: P04843
    • Gene ID: 6184
    • Research Area: Metabolism
    Description: Antibody raised against RPN1

    Anti-RPN1 antibody

    PAab07450 100 ug
    EUR 386

    pDONR223-RPN1 Plasmid

    PVTB01119-1 2 ug
    EUR 356

    Anti-RPN1 antibody

    STJ28809 100 µl
    EUR 277
    Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome.

    Anti-RPN1 antibody

    STJ114371 100 µl
    EUR 277
    Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome.

    RPN2 Ribophorin II Human Recombinant Protein

    PROTP04844 Regular: 20ug
    EUR 317
    Description: RPN2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 539 amino acids (23-540) and having a molecular mass of 59.2kDa.;RPN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Human Angiotensin I (Ang I) ELISA Kit

    20-abx150653
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Angiotensin I (Ang I) ELISA Kit

    abx252004-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human ANG I(Angiotensin I) ELISA Kit

    EH2626 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Alias: ANG I
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human PCOL-I(Procollagen I) ELISA Kit

    EH4851 96T
    EUR 524.1
    • Detection range: 62.5-4000 pg/ml
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens ;Sensitivity: 37.5 pg/ml

    Human MHC I/RLA I ELISA Kit

    EHM0283 96Tests
    EUR 521

    Human Troponin I (Tn-I) ELISA Kit

    abx350097-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    RPN1 ORF Vector (Human) (pORF)

    ORF009019 1.0 ug DNA
    EUR 95

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    AXYPREP FRAGMENTSELECT-I KIT- 1 ML - (SAMPLE SIZE)

    MAG-FRAG-I-1 1/pk
    EUR 64
    Description: Bioscience Mag Beads; Magnetic Fragment Select

    AXYPREP FRAGMENTSELECT-I KIT- 250 ML - 1900 PREPS

    MAG-FRAG-I-250 1/pk
    EUR 1953
    Description: Bioscience Mag Beads; Magnetic Fragment Select

    AXYPREP FRAGMENTSELECT-I KIT- 5 ML - 4 PREPS

    MAG-FRAG-I-5 1/pk
    EUR 158
    Description: Bioscience Mag Beads; Magnetic Fragment Select

    AXYPREP FRAGMENTSELECT-I KIT- 50 ML - 380 PREPS

    MAG-FRAG-I-50 1/pk
    EUR 659
    Description: Bioscience Mag Beads; Magnetic Fragment Select

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Human MHC I/AgB I/H-1 I ELISA Kit

    EHM0279 96Tests
    EUR 521

    Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

    E01D0306-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

    E01D0306-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

    E01D0306-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Human Tn-I (Troponin I)

    E-EL-H0144 1 plate of 96 wells
    EUR 377
    • Gentaur's Tn-I ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Tn-I. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human Tn-I (Troponin I) in samples from Serum, Plasma, Cell supernatant

    Human MHC I/H-2 I ELISA Kit

    EHM0280 96Tests
    EUR 521

    Human Collagenase I ELISA Kit

    201-12-0719 96 tests
    EUR 440
    • This Collagenase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Gastrin I ELISA kit

    55R-IB09607 96 wells
    EUR 795
    Description: ELISA kit for the detection of Gastrin I in the research laboratory

    Human Pepsinogen I ELISA Kit

    DEIA2005 96T
    EUR 1036
    Description: This ELISA (enzyme-linked immunosorbent assay) kit is intended for measurement of human pepsinogen I levels in serum.

    Human Collagenase I ELISA kit

    E01C0051-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Collagenase I ELISA kit

    E01C0051-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Collagenase I ELISA kit

    E01C0051-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Collagenase I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Deoxyribonuclease I ELISA kit

    E01D0214-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Deoxyribonuclease I ELISA kit

    E01D0214-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Deoxyribonuclease I ELISA kit

    E01D0214-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human deoxyribonuclease I ELISA kit

    E01D0246-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human deoxyribonuclease I ELISA kit

    E01D0246-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human deoxyribonuclease I ELISA kit

    E01D0246-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human deoxyribonuclease I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transcobalamin I ELISA kit

    E01T0876-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transcobalamin I ELISA kit

    E01T0876-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transcobalamin I ELISA kit

    E01T0876-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Transcobalamin I in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Angiotensin I ELISA Kit

    20-abx051886
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human I ctp ELISA Kit

    EHA0672 96Tests
    EUR 521

    Human ACE I ELISA Kit

    EHA0714 96Tests
    EUR 521

    Human Ang-I ELISA Kit

    EHA0812 96Tests
    EUR 521

    Human Col I ELISA Kit

    EHC0788 96Tests
    EUR 521

    Human Dnase I ELISA Kit

    EHD0221 96Tests
    EUR 521

    Human Dnase-I ELISA Kit

    EHD0253 96Tests
    EUR 521

    Human I-PTH ELISA Kit

    EHI0409 96Tests
    EUR 521

    Human TNFsR-I ELISA Kit

    EHT0533 96Tests
    EUR 521

    Human angiotension I ELISA Kit

    ELA-E0811h 96 Tests
    EUR 824

    Angiotensin I (Human) ELISA Kit

    E4515-100
    EUR 805

    Collagenase I (Human) ELISA Kit

    E4646-100
    EUR 805

    Troponin I (Human) ELISA Kit

    E4735-100
    EUR 620

    PCOL-I ELISA KIT|Human

    EF010944 96 Tests
    EUR 689

    cyclin I ELISA KIT|Human

    EF008950 96 Tests
    EUR 689

    ANG I ELISA KIT|Human

    EF006592 96 Tests
    EUR 689

    Collagenase I ELISA KIT|Human

    EF006725 96 Tests
    EUR 689

    Glyoxalase I ELISA KIT|Human

    EF006867 96 Tests
    EUR 689

    TFII I ELISA KIT|Human

    EF003560 96 Tests
    EUR 689

    Pepsinogen I ELISA KIT|Human

    EF001677 96 Tests
    EUR 689

    Human Pepsinogen I ELISA Kit

    CSB-E17538h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Pepsinogen I in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Pepsinogen I ELISA Kit

    1-CSB-E17538h
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Pepsinogen I in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Collagenase I ELISA Kit

    CN-03970H1 96T
    EUR 471

    Human Collagenase I ELISA Kit

    CN-03970H2 48T
    EUR 322

    Human Collagenase I ELISA Kit

    GA-E0735HM-48T 48T
    EUR 289

    Human Collagenase I ELISA Kit

    GA-E0735HM-96T 96T
    EUR 466

    Human Troponin I ELISA kit

    LF-EK0128 1×96T
    EUR 603

    Human Collagenase I ELISA Kit

    QY-E02844 96T
    EUR 361

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    Angiotensin I (Ang I) ELISA Kit

    abx520454-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ANG I(Angiotensin I) ELISA Kit

    EU3123 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: General;Sensitivity: 0.188 ng/ml

    RPN1 Antibody, HRP conjugated

    1-CSB-PA05124B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    RPN1 Antibody, FITC conjugated

    1-CSB-PA05124C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    RPN1 Antibody, Biotin conjugated

    1-CSB-PA05124D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Rat RPN1 shRNA Plasmid

    20-abx985150
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse RPN1 shRNA Plasmid

    20-abx979606
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    RPN1 Recombinant Protein (Mouse)

    RP169139 100 ug Ask for price

    RPN1 Recombinant Protein (Rat)

    RP226742 100 ug Ask for price

    RPN1 sgRNA CRISPR Lentivector set (Human)

    K1997601 3 x 1.0 ug
    EUR 339

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Tn-I ELISA Kit| Porcine Troponin I ELISA Kit

    EF016700 96 Tests
    EUR 689

    Tn-I ELISA Kit| Rabbit Troponin I ELISA Kit

    EF016760 96 Tests
    EUR 689

    Collagenase I ELISA Kit| Rat Collagenase I ELISA Kit

    EF016982 96 Tests
    EUR 689

    Tn-I ELISA Kit| Rat Troponin I ELISA Kit

    EF018088 96 Tests
    EUR 689

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    General Ang-I/ Angiotensin I ELISA Kit

    E0006Ge 1 Kit
    EUR 717

    Rat Angiotensin I (Ang I) ELISA Kit

    20-abx052173
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Dog Angiotensin I (Ang I) ELISA Kit

    20-abx150222
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Angiotensin I (Ang I) ELISA Kit

    20-abx156700
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Rat Angiotensin I (Ang I) ELISA Kit

    20-abx155197
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Pig Troponin I (Tn-I) ELISA Kit

    abx255574-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Rat Troponin I (Tn-I) ELISA Kit

    abx256062-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rabbit Troponin I (Tn-I) ELISA Kit

    abx257092-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    TNFsR-I/ Rat TNFsR- I ELISA Kit

    ELA-E0131r 96 Tests
    EUR 886

    i-PTH/ Rat i- PTH ELISA Kit

    ELA-E0474r 96 Tests
    EUR 886

    cTn-I/ Rat cTn- I ELISA Kit

    ELA-E0478r 96 Tests
    EUR 886

    Tn-I/ Rat Tn- I ELISA Kit

    ELA-E0564r 96 Tests
    EUR 886

    Col I/ Rat Col I ELISA Kit

    ELA-E0571r 96 Tests
    EUR 886

    Ang-I/ Rat Ang- I ELISA Kit

    ELA-E0811r 96 Tests
    EUR 886

    DNase-I/ Rat DNase- I ELISA Kit

    ELA-E1127r 96 Tests
    EUR 886

    Bovine MHC I/RLA I ELISA Kit

    EBM0283 96Tests
    EUR 521

    Anserine MHC I/RLA I ELISA Kit

    EAM0283 96Tests
    EUR 521

    Canine MHC I/RLA I ELISA Kit

    ECM0283 96Tests
    EUR 521

    Goat MHC I/RLA I ELISA Kit

    EGTM0283 96Tests
    EUR 521

    General Angiotensin I, Ang-I ELISA KIT

    ELI-07537Ge 96 Tests
    EUR 886

    Rat annexin I (ANX-I) ELISA Kit

    CSB-E15811r-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Rat annexin I (ANX-I) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Rat annexin I (ANX-I) ELISA Kit

    1-CSB-E15811r
    • EUR 946.00
    • EUR 5782.00
    • EUR 3060.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Rat annexin I (ANX-I) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Monkey Angiotensin I (Ang I) ELISA Kit

    abx359809-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Pig Angiotensin I (Ang I) ELISA Kit

    abx361852-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Rabbit Angiotensin I (Ang I) ELISA Kit

    abx362177-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Mouse Troponin I (Tn-I) ELISA Kit

    abx350148-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Chicken Troponin I (Tn-I) ELISA Kit

    abx356933-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Chicken Angiotensin I (Ang I) ELISA Kit

    abx357036-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Monkey Troponin I (Tn-I) ELISA Kit

    abx358975-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Sheep Angiotensin I (Ang I) ELISA Kit

    abx364718-96tests 96 tests
    EUR 926
    • Shipped within 5-12 working days.

    Rat Angiotensin I (Ang I) ELISA Kit

    abx574142-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Dog Angiotensin I (Ang I) ELISA Kit

    abx575153-96tests 96 tests
    EUR 926
    • Shipped within 5-12 working days.

    Mouse Angiotensin I (Ang I) ELISA Kit

    abx575764-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human RPN1(Ribophorin I) ELISA Kit