Human RTN4(Reticulon 4) ELISA Kit

Human RTN4(Reticulon 4) ELISA Kit

To Order Contact us below: 

    Human Reticulon 4 (RTN4) ELISA Kit
    RD-RTN4-Hu-96Tests 96 Tests
    EUR 723
    Human Reticulon 4 (RTN4) ELISA Kit
    RDR-RTN4-Hu-48Tests 48 Tests
    EUR 544
    Human Reticulon 4 (RTN4) ELISA Kit
    RDR-RTN4-Hu-96Tests 96 Tests
    EUR 756
    Human RTN4(Reticulon 4) ELISA Kit
    EH3732 96T
    EUR 524.1
    • Detection range: 78.125-5000 pg/ml
    • Uniprot ID: Q9NQC3
    • Alias: RTN4/Reticulon-5/RTN-x/Neuroendocrine-specific protein C homolog/Neuroendocrine-specific protein(NSP)/Foocen/Neurite outgrowth inhibitor(Nogo protein)/
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml
    Human Reticulon- 4, RTN4 ELISA KIT
    ELI-52764h 96 Tests
    EUR 824
    Human Reticulon 4 (RTN4) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Reticulon 4 (RTN4) ELISA Kit
    abx253120-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human Reticulon-4(RTN4) ELISA kit
    CSB-EL020572HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 (RTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Reticulon-4(RTN4) ELISA kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4(RTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Reticulon 4 ELISA Kit (RTN4)
    RK02217 96 Tests
    EUR 521
    Human Reticulon 4(RTN4)ELISA Kit
    QY-E01104 96T
    EUR 361
    Human Reticulon 4 (RTN4) ELISA Kit
    SEF994Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.
    Human Reticulon 4 (RTN4) ELISA Kit
    SEF994Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.
    Human Reticulon 4 (RTN4) ELISA Kit
    SEF994Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.
    Human Reticulon 4 (RTN4) ELISA Kit
    SEF994Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.
    Human Reticulon 4 (RTN4) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Reticulon 4 elisa. Alternative names of the recognized antigen: NSP
    • ASY
    • NOGO
    • NSP-CL
    • RTN-X
    • Reticulon-5
    • Foocen
    • Neurite outgrowth inhibitor
    • Neuroendocrine-specific protein
    • Neuroendocrine-specific protein C homolog
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 (RTN4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Reticulon 4 (RTN4) Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Reticulon 4 (RTN4) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Reticulon 4 (RTN4) Antibody
    abx002254-50ul 50 ul
    EUR 356
    • Shipped within 5-10 working days.
    Reticulon 4 (RTN4) Antibody
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Reticulon 4 (RTN4) Antibody
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Reticulon 4 (RTN4) Antibody
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Reticulon 4 (RTN4) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Reticulon 4 (RTN4) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Mouse Reticulon- 4, Rtn4 ELISA KIT
    ELI-20214m 96 Tests
    EUR 865
    Rat RTN4(Reticulon 4) ELISA Kit
    ER1312 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q9JK11
    • Alias: RTN4
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml
    Mouse Reticulon 4 (RTN4) ELISA Kit
    abx051861-96tests 96 tests
    EUR 786
    • Shipped within 5-10 working days.
    Mouse Reticulon 4 (RTN4) ELISA Kit
    abx353194-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.
    Rat Reticulon 4 (RTN4) ELISA Kit
    abx255978-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human Reticulon 4 (RTN4) Protein
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Human Reticulon 4 (RTN4) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human RTN4 (Reticulon 4)
    E-EL-H2535 1 plate of 96 wells
    EUR 534
    • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for Human RTN4 (Reticulon 4)
    ELK4140 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 (RTN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticulon 4 (RT
    • Show more
    Description: A sandwich ELISA kit for detection of Reticulon 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Reticulon-4 (RTN4)
    KTE60779-48T 48T
    EUR 332
    • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Reticulon-4 (RTN4)
    KTE60779-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Reticulon-4 (RTN4)
    KTE60779-96T 96T
    EUR 539
    • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse RTN4 (Reticulon 4)
    E-EL-M1350 1 plate of 96 wells
    EUR 534
    • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Mouse RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for Rat RTN4 (Reticulon 4)
    E-EL-R1503 1 plate of 96 wells
    EUR 534
    • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4. Standards or samples are added to the micro ELISA plate wells and combined with the
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant
    Rat Reticulon 4 (RTN4) CLIA Kit
    abx197645-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    RTN4 ELISA Kit| Rat Reticulon 4 ELISA Kit
    EF018017 96 Tests
    EUR 689
    CLIA kit for Rat RTN4 (Reticulon 4)
    E-CL-R0748 1 plate of 96 wells
    EUR 584
    • Gentaur's RTN4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4 . Standards or samples are added to the micro CLIA plate wells and combined with the sp
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant
    Recombinant human Reticulon-4
    P1398 100ug Ask for price
    • Uniprot ID: Q9NQC3
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human Reticulon-4
    Human Reticulon- 4 receptor, RTN4R ELISA KIT
    ELI-29471h 96 Tests
    EUR 824
    Human Reticulon 4 Receptor (RTN4R) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Reticulon 4 Receptor(RTN4R)ELISA Kit
    QY-E01103 96T
    EUR 361
    Human Reticulon 4 Receptor (RTN4R) ELISA Kit
    SEF991Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.
    Human Reticulon 4 Receptor (RTN4R) ELISA Kit
    SEF991Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.
    Human Reticulon 4 Receptor (RTN4R) ELISA Kit
    SEF991Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.
    Human Reticulon 4 Receptor (RTN4R) ELISA Kit
    SEF991Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.
    Human Reticulon 4 Receptor (RTN4R) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR
    • NOGOR
    • Nogo-66 Receptor
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Rtn4/ Rat Rtn4 ELISA Kit
    ELI-15668r 96 Tests
    EUR 886
    ELISA kit for Human RTN4R (Reticulon 4 Receptor)
    ELK5164 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 Receptor (RTN4R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Retic
    • Show more
    Description: A sandwich ELISA kit for detection of Reticulon 4 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Reticulon-4 receptor (RTN4R)
    KTE60778-48T 48T
    EUR 332
    • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Reticulon-4 receptor (RTN4R)
    KTE60778-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Reticulon-4 receptor (RTN4R)
    KTE60778-96T 96T
    EUR 539
    • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT
    ELI-18409m 96 Tests
    EUR 865
    RTN4 ELISA KIT|Human
    EF010898 96 Tests
    EUR 689
    Human Reticulon 4 Receptor (RTN4R) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Human Reticulon- 4 receptor- like 1, RTN4RL1 ELISA KIT
    ELI-35842h 96 Tests
    EUR 824
    Human Reticulon- 4 receptor- like 2, RTN4RL2 ELISA KIT
    ELI-30455h 96 Tests
    EUR 824
    Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit
    CSB-EL020576HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2 (RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2(RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Reticulon 4 Receptor (RTN4R) Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Reticulon 4 Receptor (RTN4R) Antibody
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Reticulon 4 Receptor (RTN4R) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Reticulon 4 Receptor (RTN4R) Antibody
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Reticulon 4 Receptor (RTN4R) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    RTN4 ELISA Kit (Human) (OKAN06179)
    OKAN06179 96 Wells
    EUR 792
    Description: Description of target: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL
    RTN4 ELISA Kit (Human) (OKCD08873)
    OKCD08873 96 Wells
    EUR 975
    Description: Description of target: RTN4 belongs to the family of reticulons. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. RTN4 is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates.This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL
    RTN4 ELISA Kit (Human) (OKDD00514)
    OKDD00514 96 Wells
    EUR 975
    Description: Description of target: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL
    Mouse RTN4 ELISA Kit
    STJ150544 1 kit
    EUR 412
    Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of RTN4 in Mouse serum, plasma and other biological fluids
    Mouse Reticulon- 4 receptor- like 2, Rtn4rl2 ELISA KIT
    ELI-15500m 96 Tests
    EUR 865
    Mouse Reticulon- 4 receptor- like 1, Rtn4rl1 ELISA KIT
    ELI-52476m 96 Tests
    EUR 865
    Recombinant human Reticulon-4 receptor-like 2
    P1411 100ug Ask for price
    • Uniprot ID: Q86UN3
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human Reticulon-4 receptor-like 2
    RTN4R Reticulon 4 Receptor Human Recombinant Protein
    PROTQ9BZR6 Regular: 10ug
    EUR 317
    Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.
    Human RTN3(Reticulon-3) ELISA Kit
    EH12024 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: O95197
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    Human Reticulon- 2, RTN2 ELISA KIT
    ELI-36391h 96 Tests
    EUR 824
    Human Reticulon- 3, RTN3 ELISA KIT
    ELI-41269h 96 Tests
    EUR 824
    Human Reticulon 2 (RTN2) ELISA Kit
    abx382990-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Reticulon 3 (RTN3) ELISA Kit
    abx382991-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Reticulon 3(RTN3)ELISA Kit
    QY-E01105 96T
    EUR 361
    Human Reticulon 2(RTN2)ELISA Kit
    QY-E01106 96T
    EUR 361
    Human Reticulon 1(RTN1)ELISA Kit
    QY-E01107 96T
    EUR 361
    Reticulon 4 Interacting Protein 1 Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RTN4 ELISA Kit (Mouse) (OKCA01764)
    OKCA01764 96 Wells
    EUR 846
    Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL
    RTN4 ELISA Kit (Rat) (OKEH07826)
    OKEH07826 96 Wells
    EUR 896
    Description: Description of target: a myelin protein that is a potent inhibitor of neurite growth [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.6pg/mL
    RTN4 ELISA Kit (Rat) (OKEI00899)
    OKEI00899 96 Wells
    EUR 767
    Description: Description of target: Developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Regulates neurite fasciculation, branching and extension in the developing nervous system. Involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. Regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 and isoform 3 inhibit BACE1 activity and amyloid precursor protein processing. Induces the formation and stabilization of endoplasmic reticulum (ER) tubules. Regulates membrane morphogenesis in the ER by promoting tubular ER production. Influences NE expansion, nuclear pore complex formation and proper localization of inner nuclear membrane proteins.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL
    Human RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
    ELI-29470h 96 Tests
    EUR 824
    IL-4 Interleukin 4 Human Recombinant Protein, Yeast
    PROTP05112-4 Regular: 10ug
    EUR 317
    Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
    abx122324-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
    abx032462-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
    abx032462-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
    DLR-CA72-4-Hu-48T 48T
    EUR 479
    • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
    DLR-CA72-4-Hu-96T 96T
    EUR 621
    • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
    RD-CA72-4-Hu-48Tests 48 Tests
    EUR 478
    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
    RD-CA72-4-Hu-96Tests 96 Tests
    EUR 662
    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
    RDR-CA72-4-Hu-48Tests 48 Tests
    EUR 500
    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
    RDR-CA72-4-Hu-96Tests 96 Tests
    EUR 692
    Mouse Reticulon- 3, Rtn3 ELISA KIT
    ELI-21595m 96 Tests
    EUR 865
    Mouse Reticulon- 2, Rtn2 ELISA KIT
    ELI-38724m 96 Tests
    EUR 865
    Bovine Reticulon- 3, RTN3 ELISA KIT
    ELI-41268b 96 Tests
    EUR 928
    RTN4IP1 Reticulon 4 Interacting Protein 1 Human Recombinant Protein
    PROTQ8WWV3 Regular: 20ug
    EUR 317
    Description: RTN4IP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 379 amino acids (41-396 a.a.) and having a molecular mass of 41.4kDa. ;RTN4IP1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    RTN4 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RTN4 antibody
    70R-7137 50 ug
    EUR 467
    Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4
    RTN4 antibody
    70R-7139 50 ug
    EUR 467
    Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4
    RTN4 Antibody
    37191-100ul 100ul
    EUR 252
    RTN4 antibody
    70R-20039 50 ul
    EUR 435
    Description: Rabbit polyclonal RTN4 antibody
    RTN4 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RTN4 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RTN4 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
    RTN4 Antibody
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
    RTN4 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:50-1:200
    RTN4 Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody
    abx122325-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Human FibrOut 4, for brain, neural
    4-21552 1 ml Ask for price
    Human FibrOut 4, for brain, neural
    4-21553 5 x 1 ml Ask for price
    Recombinant Human PF-4 (CXCL4) Protein
    PROTP02776-4 20ug
    EUR 317
    Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.
    Recombinant Human 4-1BB Receptor Protein
    PROTQ07011-4 20ug
    EUR 317
    Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.
    Human RTN4 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Rat RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
    ELI-20212r 96 Tests
    EUR 886
    Mouse RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
    ELI-53344m 96 Tests
    EUR 865
    Reticulon 1A antibody
    10R-8103 100 ug
    EUR 467
    Description: Mouse monoclonal Reticulon 1A antibody
    Reticulon 1A antibody
    10R-8104 100 ug
    EUR 467
    Description: Mouse monoclonal Reticulon 1A antibody
    Reticulon 1A antibody
    10R-8105 100 ug
    EUR 467
    Description: Mouse monoclonal Reticulon 1A antibody
    Reticulon 1C antibody
    10R-8108 100 ug
    EUR 435
    Description: Mouse monoclonal Reticulon 1C antibody
    anti-Reticulon 2
    YF-PA14468 50 ul
    EUR 363
    Description: Mouse polyclonal to Reticulon 2
    anti-Reticulon 2
    YF-PA14469 50 ug
    EUR 363
    Description: Mouse polyclonal to Reticulon 2
    anti-Reticulon 2
    YF-PA14470 100 ug
    EUR 403
    Description: Rabbit polyclonal to Reticulon 2
    anti-Reticulon 2
    YF-PA24640 50 ul
    EUR 334
    Description: Mouse polyclonal to Reticulon 2
    Human Reticulon 1 (RTN1) Protein
    • EUR 648.00
    • EUR 272.00
    • EUR 1970.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Individual Reaction Mix 4
    G065-4 200 reactions
    EUR 167
    RTN4 Conjugated Antibody
    C37191 100ul
    EUR 397
    RTN4 / NOGO Antibody
    abx237524-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    RTN4 / NOGO Antibody
    abx237525-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.
    RTN4 Rabbit pAb
    A3114-100ul 100 ul
    EUR 308
    RTN4 Rabbit pAb
    A3114-200ul 200 ul
    EUR 459
    RTN4 Rabbit pAb
    A3114-20ul 20 ul Ask for price
    RTN4 Rabbit pAb
    A3114-50ul 50 ul
    EUR 223
    RTN4 Rabbit pAb
    A1752-100ul 100 ul
    EUR 308
    RTN4 Rabbit pAb
    A1752-200ul 200 ul
    EUR 459
    RTN4 Rabbit pAb
    A1752-20ul 20 ul
    EUR 183
    RTN4 Rabbit pAb
    A1752-50ul 50 ul
    EUR 223
    RTN4 Rabbit pAb
    A19436-100ul 100 ul Ask for price
    RTN4 Rabbit pAb
    A19436-200ul 200 ul Ask for price
    RTN4 Rabbit pAb
    A19436-20ul 20 ul Ask for price
    RTN4 Rabbit pAb
    A19436-50ul 50 ul
    EUR 308
    RTN4 Blocking Peptide
    33R-3051 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7139
    RTN4 Blocking Peptide
    33R-7833 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7137
    RTN4 cloning plasmid
    CSB-CL878853HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 600
    • Sequence: atggacggtcagaagaaaaattggaaggacaaggttgttgacctcctgtactggagagacattaagaagactggagtggtgtttggtgccagcctattcctgctgctttcattgacagtattcagcattgtgagcgtaacagcctacattgccttggccctgctctctgtgaccat
    • Show more
    Description: A cloning plasmid for the RTN4 gene.
    RTN4 cloning plasmid
    CSB-CL878853HU2-10ug 10ug
    EUR 398
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1032
    • Sequence: atggaagacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagaggaagcccgccgccgggctgtccgcggccccagtgcccaccgcccctgccgccggcgcgcccctgatggacttcggaaatgacttcgtgccgccgg
    • Show more
    Description: A cloning plasmid for the RTN4 gene.
    RTN4 cloning plasmid
    CSB-CL878853HU3-10ug 10ug
    EUR 423
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1122
    • Sequence: atggaagacctggaccagtctcctctggtctcgtcctcggacagcccaccccggccgcagcccgcgttcaagtaccagttcgtgagggagcccgaggacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagcggaagc
    • Show more
    Description: A cloning plasmid for the RTN4 gene.
    PVT13995 2 ug
    EUR 391
    Anti-RTN4 Antibody
    STJ501942 100 µg
    EUR 476
    Anti-RTN4 antibody
    STJ11100630 50 µl
    EUR 287
    Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.
    Anti-RTN4 antibody
    STJ27689 100 µl
    EUR 277
    Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.
    Anti-RTN4 antibody
    STJ119612 100 µl
    EUR 277
    Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
    RTN4 ORF Vector (Human) (pORF)
    ORF009130 1.0 ug DNA
    EUR 95

    Human RTN4(Reticulon 4) ELISA Kit