Human RTN4(Reticulon 4) ELISA Kit

Human RTN4(Reticulon 4) ELISA Kit

To Order Contact us below: 

Human Reticulon 4 (RTN4) ELISA Kit
RD-RTN4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Reticulon 4 (RTN4) ELISA Kit
RDR-RTN4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Reticulon 4 (RTN4) ELISA Kit
RDR-RTN4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human RTN4(Reticulon 4) ELISA Kit
EH3732	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: Q9NQC3 Alias: RTN4/Reticulon-5/RTN-x/Neuroendocrine-specific protein C homolog/Neuroendocrine-specific protein(NSP)/Foocen/Neurite outgrowth inhibitor(Nogo protein)/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Reticulon- 4, RTN4 ELISA KIT
ELI-52764h	Lifescience Market	96 Tests	EUR 824

Human Reticulon 4 (RTN4) ELISA Kit
20-abx152955	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Reticulon 4 (RTN4) ELISA Kit
abx253120-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Reticulon-4(RTN4) ELISA kit
CSB-EL020572HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 (RTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Reticulon-4(RTN4) ELISA kit
1-CSB-EL020572HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4(RTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Reticulon 4 ELISA Kit (RTN4)
RK02217	Abclonal	96 Tests	EUR 521

Human Reticulon 4(RTN4)ELISA Kit
QY-E01104	Qayee Biotechnology	96T	EUR 361

Human Reticulon 4 (RTN4) ELISA Kit
SEF994Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit
SEF994Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit
SEF994Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit
SEF994Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit
4-SEF994Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulon 4 elisa. Alternative names of the recognized antigen: NSP ASY NOGO NSP-CL RTN-X Reticulon-5 Foocen Neurite outgrowth inhibitor Neuroendocrine-specific protein Neuroendocrine-specific protein C homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 (RTN4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Reticulon 4 (RTN4) Antibody
20-abx115138	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody
20-abx123018	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody
abx002254-50ul	Abbexa	50 ul	EUR 356
Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody
20-abx174385	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Reticulon 4 (RTN4) Antibody
20-abx178258	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Reticulon 4 (RTN4) Antibody
20-abx328394	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody
20-abx214961	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody
20-abx241122	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mouse Reticulon- 4, Rtn4 ELISA KIT
ELI-20214m	Lifescience Market	96 Tests	EUR 865

Rat RTN4(Reticulon 4) ELISA Kit
ER1312	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q9JK11 Alias: RTN4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Mouse Reticulon 4 (RTN4) ELISA Kit
abx051861-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-10 working days.

Mouse Reticulon 4 (RTN4) ELISA Kit
abx353194-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Reticulon 4 (RTN4) ELISA Kit
abx255978-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Reticulon 4 (RTN4) Protein
20-abx654948	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Human RTN4 (Reticulon 4)
E-EL-H2535	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human RTN4 (Reticulon 4)
ELK4140	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 (RTN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticulon 4 (RT Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)
KTE60779-48T	Abbkine	48T	EUR 332
Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)
KTE60779-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)
KTE60779-96T	Abbkine	96T	EUR 539
Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Reticulon 4 (RTN4) CLIA Kit
20-abx495073	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse RTN4 (Reticulon 4)
E-EL-M1350	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat RTN4 (Reticulon 4)
E-EL-R1503	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

Rat Reticulon 4 (RTN4) CLIA Kit
abx197645-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

RTN4 ELISA Kit| Rat Reticulon 4 ELISA Kit
EF018017	Lifescience Market	96 Tests	EUR 689

CLIA kit for Rat RTN4 (Reticulon 4)
E-CL-R0748	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's RTN4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4 . Standards or samples are added to the micro CLIA plate wells and combined with the sp Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

Recombinant human Reticulon-4
P1398	FN Test	100ug	Ask for price
Uniprot ID: Q9NQC3 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Reticulon-4

Human Reticulon- 4 receptor, RTN4R ELISA KIT
ELI-29471h	Lifescience Market	96 Tests	EUR 824

Human Reticulon 4 Receptor (RTN4R) ELISA Kit
20-abx156874	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Reticulon 4 Receptor(RTN4R)ELISA Kit
QY-E01103	Qayee Biotechnology	96T	EUR 361

Human Reticulon 4 Receptor (RTN4R) ELISA Kit
SEF991Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit
SEF991Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit
SEF991Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit
SEF991Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit
4-SEF991Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR NOGOR Nogo-66 Receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rtn4/ Rat Rtn4 ELISA Kit
ELI-15668r	Lifescience Market	96 Tests	EUR 886

ELISA kit for Human RTN4R (Reticulon 4 Receptor)
ELK5164	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 Receptor (RTN4R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Retic Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)
KTE60778-48T	Abbkine	48T	EUR 332
Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)
KTE60778-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)
KTE60778-96T	Abbkine	96T	EUR 539
Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT
ELI-18409m	Lifescience Market	96 Tests	EUR 865

RTN4 ELISA KIT|Human
EF010898	Lifescience Market	96 Tests	EUR 689

Human Reticulon 4 Receptor (RTN4R) CLIA Kit
20-abx495072	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Reticulon- 4 receptor- like 1, RTN4RL1 ELISA KIT
ELI-35842h	Lifescience Market	96 Tests	EUR 824

Human Reticulon- 4 receptor- like 2, RTN4RL2 ELISA KIT
ELI-30455h	Lifescience Market	96 Tests	EUR 824

Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit
CSB-EL020576HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2 (RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit
1-CSB-EL020576HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2(RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Reticulon 4 Receptor (RTN4R) Antibody
20-abx115139	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody
20-abx008053	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody
20-abx004484	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody
20-abx321708	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody
20-abx241707	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mouse RTN4 ELISA Kit
STJ150544	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of RTN4 in Mouse serum, plasma and other biological fluids

Mouse Reticulon- 4 receptor- like 2, Rtn4rl2 ELISA KIT
ELI-15500m	Lifescience Market	96 Tests	EUR 865

Mouse Reticulon- 4 receptor- like 1, Rtn4rl1 ELISA KIT
ELI-52476m	Lifescience Market	96 Tests	EUR 865

Recombinant human Reticulon-4 receptor-like 2
P1411	FN Test	100ug	Ask for price
Uniprot ID: Q86UN3 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Reticulon-4 receptor-like 2

RTN4R Reticulon 4 Receptor Human Recombinant Protein
PROTQ9BZR6	BosterBio	Regular: 10ug	EUR 317
Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.

Human RTN3(Reticulon-3) ELISA Kit
EH12024	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O95197
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Reticulon- 2, RTN2 ELISA KIT
ELI-36391h	Lifescience Market	96 Tests	EUR 824

Human Reticulon- 3, RTN3 ELISA KIT
ELI-41269h	Lifescience Market	96 Tests	EUR 824

Human Reticulon 2 (RTN2) ELISA Kit
abx382990-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Reticulon 3 (RTN3) ELISA Kit
abx382991-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Reticulon 3(RTN3)ELISA Kit
QY-E01105	Qayee Biotechnology	96T	EUR 361

Human Reticulon 2(RTN2)ELISA Kit
QY-E01106	Qayee Biotechnology	96T	EUR 361

Human Reticulon 1(RTN1)ELISA Kit
QY-E01107	Qayee Biotechnology	96T	EUR 361

Reticulon 4 Interacting Protein 1 Protein
20-abx260853	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
ELI-29470h	Lifescience Market	96 Tests	EUR 824

IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx122324-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
20-abx135939	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx032462-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx032462-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
20-abx308457	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T	DL Develop	48T	EUR 479
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T	DL Develop	96T	EUR 621
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Reticulon- 3, Rtn3 ELISA KIT
ELI-21595m	Lifescience Market	96 Tests	EUR 865

Mouse Reticulon- 2, Rtn2 ELISA KIT
ELI-38724m	Lifescience Market	96 Tests	EUR 865

Bovine Reticulon- 3, RTN3 ELISA KIT
ELI-41268b	Lifescience Market	96 Tests	EUR 928

RTN4IP1 Reticulon 4 Interacting Protein 1 Human Recombinant Protein
PROTQ8WWV3	BosterBio	Regular: 20ug	EUR 317
Description: RTN4IP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 379 amino acids (41-396 a.a.) and having a molecular mass of 41.4kDa. ;RTN4IP1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RTN4 siRNA
20-abx904743	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RTN4 antibody
70R-7137	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4

RTN4 antibody
70R-7139	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4

RTN4 Antibody
37191-100ul	SAB	100ul	EUR 252

RTN4 antibody
70R-20039	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RTN4 antibody

RTN4 siRNA
20-abx932262	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RTN4 siRNA
20-abx932263	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RTN4 Antibody
1-CSB-PA931699	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

RTN4 Antibody
1-CSB-PA003461	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

RTN4 Antibody
1-CSB-PA054695	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:50-1:200

RTN4 Antibody
1-CSB-PA020572GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody
abx122325-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody
20-abx309988	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human FibrOut 4, for brain, neural
4-21552	CHI Scientific	1 ml	Ask for price

Human FibrOut 4, for brain, neural
4-21553	CHI Scientific	5 x 1 ml	Ask for price

Recombinant Human PF-4 (CXCL4) Protein
PROTP02776-4	BosterBio	20ug	EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

Recombinant Human 4-1BB Receptor Protein
PROTQ07011-4	BosterBio	20ug	EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Human RTN4 shRNA Plasmid
20-abx961351	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
ELI-20212r	Lifescience Market	96 Tests	EUR 886

Mouse RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
ELI-53344m	Lifescience Market	96 Tests	EUR 865

Reticulon 1A antibody
10R-8103	Fitzgerald	100 ug	EUR 467
Description: Mouse monoclonal Reticulon 1A antibody

Reticulon 1A antibody
10R-8104	Fitzgerald	100 ug	EUR 467
Description: Mouse monoclonal Reticulon 1A antibody

Reticulon 1A antibody
10R-8105	Fitzgerald	100 ug	EUR 467
Description: Mouse monoclonal Reticulon 1A antibody

Reticulon 1C antibody
10R-8108	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal Reticulon 1C antibody

anti-Reticulon 2
YF-PA14468	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Reticulon 2

anti-Reticulon 2
YF-PA14469	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Reticulon 2

anti-Reticulon 2
YF-PA14470	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Reticulon 2

anti-Reticulon 2
YF-PA24640	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Reticulon 2

Human Reticulon 1 (RTN1) Protein
20-abx650236	Abbexa	EUR 648.00 EUR 272.00 EUR 1970.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Individual Reaction Mix 4
G065-4	ABM	200 reactions	EUR 167

RTN4 Conjugated Antibody
C37191	SAB	100ul	EUR 397

RTN4 / NOGO Antibody
abx237524-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

RTN4 / NOGO Antibody
abx237525-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

RTN4 Rabbit pAb
A3114-100ul	Abclonal	100 ul	EUR 308

RTN4 Rabbit pAb
A3114-200ul	Abclonal	200 ul	EUR 459

RTN4 Rabbit pAb
A3114-20ul	Abclonal	20 ul	Ask for price

RTN4 Rabbit pAb
A3114-50ul	Abclonal	50 ul	EUR 223

RTN4 Rabbit pAb
A1752-100ul	Abclonal	100 ul	EUR 308

RTN4 Rabbit pAb
A1752-200ul	Abclonal	200 ul	EUR 459

RTN4 Rabbit pAb
A1752-20ul	Abclonal	20 ul	EUR 183

RTN4 Rabbit pAb
A1752-50ul	Abclonal	50 ul	EUR 223

RTN4 Rabbit pAb
A19436-100ul	Abclonal	100 ul	Ask for price

RTN4 Rabbit pAb
A19436-200ul	Abclonal	200 ul	Ask for price

RTN4 Rabbit pAb
A19436-20ul	Abclonal	20 ul	Ask for price

RTN4 Rabbit pAb
A19436-50ul	Abclonal	50 ul	EUR 308

RTN4 Blocking Peptide
33R-3051	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7139

RTN4 Blocking Peptide
33R-7833	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7137

RTN4 cloning plasmid
CSB-CL878853HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 600 Sequence: atggacggtcagaagaaaaattggaaggacaaggttgttgacctcctgtactggagagacattaagaagactggagtggtgtttggtgccagcctattcctgctgctttcattgacagtattcagcattgtgagcgtaacagcctacattgccttggccctgctctctgtgaccat Show more
Description: A cloning plasmid for the RTN4 gene.

RTN4 cloning plasmid
CSB-CL878853HU2-10ug	Cusabio	10ug	EUR 398
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1032 Sequence: atggaagacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagaggaagcccgccgccgggctgtccgcggccccagtgcccaccgcccctgccgccggcgcgcccctgatggacttcggaaatgacttcgtgccgccgg Show more
Description: A cloning plasmid for the RTN4 gene.

RTN4 cloning plasmid
CSB-CL878853HU3-10ug	Cusabio	10ug	EUR 423
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1122 Sequence: atggaagacctggaccagtctcctctggtctcgtcctcggacagcccaccccggccgcagcccgcgttcaagtaccagttcgtgagggagcccgaggacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagcggaagc Show more
Description: A cloning plasmid for the RTN4 gene.

pCMV-SPORT6-RTN4
PVT13995	Lifescience Market	2 ug	EUR 391

Anti-RTN4 Antibody
STJ501942	St John's Laboratory	100 µg	EUR 476

Anti-RTN4 antibody
STJ11100630	St John's Laboratory	50 µl	EUR 287
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.

Anti-RTN4 antibody
STJ27689	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.

Anti-RTN4 antibody
STJ119612	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

RTN4 ORF Vector (Human) (pORF)
ORF009130	ABM	1.0 ug DNA	EUR 95

RTN4 ORF Vector (Human) (pORF)
ORF009131	ABM	1.0 ug DNA	EUR 95

RTN4 ORF Vector (Human) (pORF)
ORF009132	ABM	1.0 ug DNA	EUR 95

pLenti-CLDN1 shRNA-4 Plasmid
PVTBAV04867-4	Lifescience Market	2 ug	EUR 356

Feline IL-4 Recombinant Protein
R00230-4	BosterBio	5ug/vial	EUR 259
Description: IL-4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation, and the differentiation of CD4+ T-cells into Th2 cells. It is a key regulator in humoral and adaptive immunity. Feline IL-4 Recombinant Protein is purified interleukin-4 produced in yeast.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ExoStd? Lyophilized Exosome Standard (30 µg, Human Plasma, 4 vials)
M1040-4	Biovision		EUR 909

Human RTN4(Reticulon 4) ELISA Kit