Human RTN4(Reticulon 4) ELISA Kit

Human RTN4(Reticulon 4) ELISA Kit

To Order Contact us below: 

Human Reticulon 4 (RTN4) ELISA Kit
RD-RTN4-Hu-96Tests 96 Tests
EUR 723
Human Reticulon 4 (RTN4) ELISA Kit
RDR-RTN4-Hu-48Tests 48 Tests
EUR 544
Human Reticulon 4 (RTN4) ELISA Kit
RDR-RTN4-Hu-96Tests 96 Tests
EUR 756
Human RTN4(Reticulon 4) ELISA Kit
EH3732 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q9NQC3
  • Alias: RTN4/Reticulon-5/RTN-x/Neuroendocrine-specific protein C homolog/Neuroendocrine-specific protein(NSP)/Foocen/Neurite outgrowth inhibitor(Nogo protein)/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml
Human Reticulon- 4, RTN4 ELISA KIT
ELI-52764h 96 Tests
EUR 824
Human Reticulon 4 (RTN4) ELISA Kit
20-abx152955
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Reticulon 4 (RTN4) ELISA Kit
abx253120-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Reticulon-4(RTN4) ELISA kit
CSB-EL020572HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 (RTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Reticulon-4(RTN4) ELISA kit
1-CSB-EL020572HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4(RTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Reticulon 4 ELISA Kit (RTN4)
RK02217 96 Tests
EUR 521
Human Reticulon 4(RTN4)ELISA Kit
QY-E01104 96T
EUR 361
Human Reticulon 4 (RTN4) ELISA Kit
SEF994Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.
Human Reticulon 4 (RTN4) ELISA Kit
SEF994Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.
Human Reticulon 4 (RTN4) ELISA Kit
SEF994Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.
Human Reticulon 4 (RTN4) ELISA Kit
SEF994Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.
Human Reticulon 4 (RTN4) ELISA Kit
4-SEF994Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulon 4 elisa. Alternative names of the recognized antigen: NSP
  • ASY
  • NOGO
  • NSP-CL
  • RTN-X
  • Reticulon-5
  • Foocen
  • Neurite outgrowth inhibitor
  • Neuroendocrine-specific protein
  • Neuroendocrine-specific protein C homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 (RTN4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Reticulon 4 (RTN4) Antibody
20-abx115138
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Reticulon 4 (RTN4) Antibody
20-abx123018
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Reticulon 4 (RTN4) Antibody
abx002254-50ul 50 ul
EUR 356
  • Shipped within 5-10 working days.
Reticulon 4 (RTN4) Antibody
20-abx174385
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Reticulon 4 (RTN4) Antibody
20-abx178258
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Reticulon 4 (RTN4) Antibody
20-abx328394
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Reticulon 4 (RTN4) Antibody
20-abx214961
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Reticulon 4 (RTN4) Antibody
20-abx241122
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse Reticulon- 4, Rtn4 ELISA KIT
ELI-20214m 96 Tests
EUR 865
Rat RTN4(Reticulon 4) ELISA Kit
ER1312 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9JK11
  • Alias: RTN4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml
Mouse Reticulon 4 (RTN4) ELISA Kit
abx051861-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.
Mouse Reticulon 4 (RTN4) ELISA Kit
abx353194-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Rat Reticulon 4 (RTN4) ELISA Kit
abx255978-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Reticulon 4 (RTN4) Protein
20-abx654948
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ELISA kit for Human RTN4 (Reticulon 4)
E-EL-H2535 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human RTN4 (Reticulon 4)
ELK4140 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 (RTN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticulon 4 (RT
  • Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Reticulon-4 (RTN4)
KTE60779-48T 48T
EUR 332
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Reticulon-4 (RTN4)
KTE60779-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Reticulon-4 (RTN4)
KTE60779-96T 96T
EUR 539
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Reticulon 4 (RTN4) CLIA Kit
20-abx495073
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Mouse RTN4 (Reticulon 4)
E-EL-M1350 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rat RTN4 (Reticulon 4)
E-EL-R1503 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant
Rat Reticulon 4 (RTN4) CLIA Kit
abx197645-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
RTN4 ELISA Kit| Rat Reticulon 4 ELISA Kit
EF018017 96 Tests
EUR 689
CLIA kit for Rat RTN4 (Reticulon 4)
E-CL-R0748 1 plate of 96 wells
EUR 584
  • Gentaur's RTN4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4 . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant
Recombinant human Reticulon-4
P1398 100ug Ask for price
  • Uniprot ID: Q9NQC3
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Reticulon-4
Human Reticulon- 4 receptor, RTN4R ELISA KIT
ELI-29471h 96 Tests
EUR 824
Human Reticulon 4 Receptor (RTN4R) ELISA Kit
20-abx156874
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Reticulon 4 Receptor(RTN4R)ELISA Kit
QY-E01103 96T
EUR 361
Human Reticulon 4 Receptor (RTN4R) ELISA Kit
SEF991Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.
Human Reticulon 4 Receptor (RTN4R) ELISA Kit
SEF991Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.
Human Reticulon 4 Receptor (RTN4R) ELISA Kit
SEF991Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.
Human Reticulon 4 Receptor (RTN4R) ELISA Kit
SEF991Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.
Human Reticulon 4 Receptor (RTN4R) ELISA Kit
4-SEF991Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR
  • NOGOR
  • Nogo-66 Receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Rtn4/ Rat Rtn4 ELISA Kit
ELI-15668r 96 Tests
EUR 886
ELISA kit for Human RTN4R (Reticulon 4 Receptor)
ELK5164 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 Receptor (RTN4R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Retic
  • Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Reticulon-4 receptor (RTN4R)
KTE60778-48T 48T
EUR 332
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Reticulon-4 receptor (RTN4R)
KTE60778-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Reticulon-4 receptor (RTN4R)
KTE60778-96T 96T
EUR 539
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT
ELI-18409m 96 Tests
EUR 865
RTN4 ELISA KIT|Human
EF010898 96 Tests
EUR 689
Human Reticulon 4 Receptor (RTN4R) CLIA Kit
20-abx495072
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Reticulon- 4 receptor- like 1, RTN4RL1 ELISA KIT
ELI-35842h 96 Tests
EUR 824
Human Reticulon- 4 receptor- like 2, RTN4RL2 ELISA KIT
ELI-30455h 96 Tests
EUR 824
Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit
CSB-EL020576HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2 (RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit
1-CSB-EL020576HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2(RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Reticulon 4 Receptor (RTN4R) Antibody
20-abx115139
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Reticulon 4 Receptor (RTN4R) Antibody
20-abx008053
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Reticulon 4 Receptor (RTN4R) Antibody
20-abx004484
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Reticulon 4 Receptor (RTN4R) Antibody
20-abx321708
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Reticulon 4 Receptor (RTN4R) Antibody
20-abx241707
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse RTN4 ELISA Kit
STJ150544 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of RTN4 in Mouse serum, plasma and other biological fluids
Mouse Reticulon- 4 receptor- like 2, Rtn4rl2 ELISA KIT
ELI-15500m 96 Tests
EUR 865
Mouse Reticulon- 4 receptor- like 1, Rtn4rl1 ELISA KIT
ELI-52476m 96 Tests
EUR 865
Recombinant human Reticulon-4 receptor-like 2
P1411 100ug Ask for price
  • Uniprot ID: Q86UN3
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Reticulon-4 receptor-like 2
RTN4R Reticulon 4 Receptor Human Recombinant Protein
PROTQ9BZR6 Regular: 10ug
EUR 317
Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.
Human RTN3(Reticulon-3) ELISA Kit
EH12024 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O95197
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Reticulon- 2, RTN2 ELISA KIT
ELI-36391h 96 Tests
EUR 824
Human Reticulon- 3, RTN3 ELISA KIT
ELI-41269h 96 Tests
EUR 824
Human Reticulon 2 (RTN2) ELISA Kit
abx382990-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Reticulon 3 (RTN3) ELISA Kit
abx382991-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Reticulon 3(RTN3)ELISA Kit
QY-E01105 96T
EUR 361
Human Reticulon 2(RTN2)ELISA Kit
QY-E01106 96T
EUR 361
Human Reticulon 1(RTN1)ELISA Kit
QY-E01107 96T
EUR 361
Reticulon 4 Interacting Protein 1 Protein
20-abx260853
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Human RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
ELI-29470h 96 Tests
EUR 824
IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx122324-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
20-abx135939
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx032462-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx032462-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
20-abx308457
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests 48 Tests
EUR 478
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests 96 Tests
EUR 662
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692
Mouse Reticulon- 3, Rtn3 ELISA KIT
ELI-21595m 96 Tests
EUR 865
Mouse Reticulon- 2, Rtn2 ELISA KIT
ELI-38724m 96 Tests
EUR 865
Bovine Reticulon- 3, RTN3 ELISA KIT
ELI-41268b 96 Tests
EUR 928
RTN4IP1 Reticulon 4 Interacting Protein 1 Human Recombinant Protein
PROTQ8WWV3 Regular: 20ug
EUR 317
Description: RTN4IP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 379 amino acids (41-396 a.a.) and having a molecular mass of 41.4kDa. ;RTN4IP1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
RTN4 siRNA
20-abx904743
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RTN4 antibody
70R-7137 50 ug
EUR 467
Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4
RTN4 antibody
70R-7139 50 ug
EUR 467
Description: Rabbit polyclonal RTN4 antibody raised against the middle region of RTN4
RTN4 Antibody
37191-100ul 100ul
EUR 252
RTN4 antibody
70R-20039 50 ul
EUR 435
Description: Rabbit polyclonal RTN4 antibody
RTN4 siRNA
20-abx932262
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RTN4 siRNA
20-abx932263
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RTN4 Antibody
1-CSB-PA931699
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
RTN4 Antibody
1-CSB-PA003461
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
RTN4 Antibody
1-CSB-PA054695
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:50-1:200
RTN4 Antibody
1-CSB-PA020572GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RTN4. Recognizes RTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody
abx122325-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody
20-abx309988
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human FibrOut 4, for brain, neural
4-21552 1 ml Ask for price
Human FibrOut 4, for brain, neural
4-21553 5 x 1 ml Ask for price
Recombinant Human PF-4 (CXCL4) Protein
PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.
Recombinant Human 4-1BB Receptor Protein
PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.
Human RTN4 shRNA Plasmid
20-abx961351
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
ELI-20212r 96 Tests
EUR 886
Mouse RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)
ELI-53344m 96 Tests
EUR 865
Reticulon 1A antibody
10R-8103 100 ug
EUR 467
Description: Mouse monoclonal Reticulon 1A antibody
Reticulon 1A antibody
10R-8104 100 ug
EUR 467
Description: Mouse monoclonal Reticulon 1A antibody
Reticulon 1A antibody
10R-8105 100 ug
EUR 467
Description: Mouse monoclonal Reticulon 1A antibody
Reticulon 1C antibody
10R-8108 100 ug
EUR 435
Description: Mouse monoclonal Reticulon 1C antibody
anti-Reticulon 2
YF-PA14468 50 ul
EUR 363
Description: Mouse polyclonal to Reticulon 2
anti-Reticulon 2
YF-PA14469 50 ug
EUR 363
Description: Mouse polyclonal to Reticulon 2
anti-Reticulon 2
YF-PA14470 100 ug
EUR 403
Description: Rabbit polyclonal to Reticulon 2
anti-Reticulon 2
YF-PA24640 50 ul
EUR 334
Description: Mouse polyclonal to Reticulon 2
Human Reticulon 1 (RTN1) Protein
20-abx650236
  • EUR 648.00
  • EUR 272.00
  • EUR 1970.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Individual Reaction Mix 4
G065-4 200 reactions
EUR 167
RTN4 Conjugated Antibody
C37191 100ul
EUR 397
RTN4 / NOGO Antibody
abx237524-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
RTN4 / NOGO Antibody
abx237525-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
RTN4 Rabbit pAb
A3114-100ul 100 ul
EUR 308
RTN4 Rabbit pAb
A3114-200ul 200 ul
EUR 459
RTN4 Rabbit pAb
A3114-20ul 20 ul Ask for price
RTN4 Rabbit pAb
A3114-50ul 50 ul
EUR 223
RTN4 Rabbit pAb
A1752-100ul 100 ul
EUR 308
RTN4 Rabbit pAb
A1752-200ul 200 ul
EUR 459
RTN4 Rabbit pAb
A1752-20ul 20 ul
EUR 183
RTN4 Rabbit pAb
A1752-50ul 50 ul
EUR 223
RTN4 Rabbit pAb
A19436-100ul 100 ul Ask for price
RTN4 Rabbit pAb
A19436-200ul 200 ul Ask for price
RTN4 Rabbit pAb
A19436-20ul 20 ul Ask for price
RTN4 Rabbit pAb
A19436-50ul 50 ul
EUR 308
RTN4 Blocking Peptide
33R-3051 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7139
RTN4 Blocking Peptide
33R-7833 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTN4 antibody, catalog no. 70R-7137
RTN4 cloning plasmid
CSB-CL878853HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 600
  • Sequence: atggacggtcagaagaaaaattggaaggacaaggttgttgacctcctgtactggagagacattaagaagactggagtggtgtttggtgccagcctattcctgctgctttcattgacagtattcagcattgtgagcgtaacagcctacattgccttggccctgctctctgtgaccat
  • Show more
Description: A cloning plasmid for the RTN4 gene.
RTN4 cloning plasmid
CSB-CL878853HU2-10ug 10ug
EUR 398
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1032
  • Sequence: atggaagacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagaggaagcccgccgccgggctgtccgcggccccagtgcccaccgcccctgccgccggcgcgcccctgatggacttcggaaatgacttcgtgccgccgg
  • Show more
Description: A cloning plasmid for the RTN4 gene.
RTN4 cloning plasmid
CSB-CL878853HU3-10ug 10ug
EUR 423
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: atggaagacctggaccagtctcctctggtctcgtcctcggacagcccaccccggccgcagcccgcgttcaagtaccagttcgtgagggagcccgaggacgaggaggaagaagaggaggaggaagaggaggacgaggacgaagacctggaggagctggaggtgctggagcggaagc
  • Show more
Description: A cloning plasmid for the RTN4 gene.
pCMV-SPORT6-RTN4
PVT13995 2 ug
EUR 391
Anti-RTN4 Antibody
STJ501942 100 µg
EUR 476
Anti-RTN4 antibody
STJ11100630 50 µl
EUR 287
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.
Anti-RTN4 antibody
STJ27689 100 µl
EUR 277
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.
Anti-RTN4 antibody
STJ119612 100 µl
EUR 277
Description: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
RTN4 ORF Vector (Human) (pORF)
ORF009130 1.0 ug DNA
EUR 95
RTN4 ORF Vector (Human) (pORF)
ORF009131 1.0 ug DNA
EUR 95
RTN4 ORF Vector (Human) (pORF)
ORF009132 1.0 ug DNA
EUR 95
pLenti-CLDN1 shRNA-4 Plasmid
PVTBAV04867-4 2 ug
EUR 356
Feline IL-4 Recombinant Protein
R00230-4 5ug/vial
EUR 259
Description: IL-4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation, and the differentiation of CD4+ T-cells into Th2 cells. It is a key regulator in humoral and adaptive immunity. Feline IL-4 Recombinant Protein is purified interleukin-4 produced in yeast.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
ExoStd? Lyophilized Exosome Standard (30 µg, Human Plasma, 4 vials)
M1040-4
EUR 909

Human RTN4(Reticulon 4) ELISA Kit