Human PLXNB1(Plexin B1) ELISA Kit

Human PLXNB1(Plexin B1) ELISA Kit

To Order Contact us below: 

Human Plexin B1 (PLXNB1) ELISA Kit

RDR-PLXNB1-Hu-96Tests 96 Tests
EUR 756

Human Plexin- B1, PLXNB1 ELISA KIT

ELI-19690h 96 Tests
EUR 824

Human Plexin B1 (PLXNB1) ELISA Kit

20-abx152779
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Plexin B1 (PLXNB1)ELISA Kit

201-12-2636 96 tests
EUR 440
  • This Plexin B1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin-B1(PLXNB1) ELISA kit

CSB-EL018222HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Plexin-B1 (PLXNB1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Plexin-B1(PLXNB1) ELISA kit

1-CSB-EL018222HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Plexin-B1(PLXNB1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Plexin B1 ELISA Kit (PLXNB1)

RK02109 96 Tests
EUR 521

Human Plexin B1(PLXNB1)ELISA Kit

QY-E03976 96T
EUR 361

Human Plexin B1 (PLXNB1) ELISA Kit

SEH358Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plexin B1 (PLXNB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plexin B1 (PLXNB1) in tissue homogenates, cell lysates and other biological fluids.

Human Plexin B1 (PLXNB1) ELISA Kit

SEH358Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plexin B1 (PLXNB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plexin B1 (PLXNB1) in tissue homogenates, cell lysates and other biological fluids.

Human Plexin B1 (PLXNB1) ELISA Kit

SEH358Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plexin B1 (PLXNB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plexin B1 (PLXNB1) in tissue homogenates, cell lysates and other biological fluids.

Human Plexin B1 (PLXNB1) ELISA Kit

SEH358Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plexin B1 (PLXNB1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plexin B1 (PLXNB1) in tissue homogenates, cell lysates and other biological fluids.

Human Plexin B1 (PLXNB1) ELISA Kit

4-SEH358Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Plexin B1 elisa. Alternative names of the recognized antigen: PLXN5
  • SEP
  • Semaphorin receptor SEP
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Plexin B1 (PLXNB1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Plexin B1 (PLXNB1) Antibody

20-abx129793
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plexin B1 (PLXNB1) Antibody

20-abx135928
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Plexin-B1 (PLXNB1) Antibody

abx038326-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Plexin-B1 (PLXNB1) Antibody

abx038327-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Plexin B1 (PLXNB1) Antibody

20-abx100854
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plexin B1 (PLXNB1) Antibody

20-abx100855
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Plexin B1 (PLXNB1) Antibody

20-abx100856
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plexin B1 (PLXNB1) Antibody

20-abx334210
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Plexin B1 (PLXNB1) Antibody

abx236566-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Plexin B1 (PLXNB1) Antibody

20-abx213020
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Plexin B1 (PLXNB1) Antibody

20-abx213021
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Plexin B1 (PLXNB1)

4-RPH358Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43157
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.7kDa
  • Isoelectric Point: 5.5
Description: Recombinant Human Plexin B1 expressed in: E.coli

Recombinant Plexin B1 (PLXNB1)

4-RPH358Hu02
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43157
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Plexin B1 expressed in: E.coli

Recombinant Plexin B1 (PLXNB1)

4-RPH358Hu03
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43157
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.7kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Plexin B1 expressed in: E.coli

Recombinant Plexin B1 (PLXNB1)

4-RPH358Mu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8CJH3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Plexin B1 expressed in: E.coli

Mouse Plexin- B1, Plxnb1 ELISA KIT

ELI-19691m 96 Tests
EUR 865

Human Plexin B1 (PLXNB1) Protein

20-abx068611
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Plexin B1 (PLXNB1) Protein

20-abx068612
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Plexin B1 (PLXNB1) Protein

20-abx068613
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Plexin B1 (PLXNB1) CLIA Kit

20-abx495440
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human PLXNB1 (Plexin B1)

ELK3909 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Plexin B1 (PLXNB1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Plexin B1 (PLXN
  • Show more
Description: A sandwich ELISA kit for detection of Plexin B1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Polyclonal PLXNB1 / Plexin-B1 Antibody

APR12902G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLXNB1 / Plexin-B1 . This antibody is tested and proven to work in the following applications:

Mouse Plexin B1 (PLXNB1) Protein

20-abx168446
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plexin B1 (PLXNB1) Antibody (HRP)

20-abx337081
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Plexin B1 (PLXNB1) Antibody (FITC)

20-abx337082
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Plexin B1 (PLXNB1) Antibody (Biotin)

20-abx337083
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human)

4-PAH358Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu47~Thr173)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1)

Plexin B1 (PLXNB1) Polyclonal Antibody (Human)

4-PAH358Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu581~Gly727)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1)

Plexin B1 (PLXNB1) Polyclonal Antibody (Human)

4-PAH358Hu03
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Ala1780~Ile2042)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1)

Plexin B1 (PLXNB1) Polyclonal Antibody (Mouse)

4-PAH358Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu1598~Val1849)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Plexin B1 (PLXNB1)

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), APC

4-PAH358Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu47~Thr173)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with APC.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), Biotinylated

4-PAH358Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu47~Thr173)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with Biotin.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), Cy3

4-PAH358Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu47~Thr173)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with Cy3.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), FITC

4-PAH358Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu47~Thr173)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with FITC.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), HRP

4-PAH358Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu47~Thr173)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with HRP.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), PE

4-PAH358Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu47~Thr173)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with PE.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), APC

4-PAH358Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu581~Gly727)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with APC.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), Biotinylated

4-PAH358Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu581~Gly727)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with Biotin.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), Cy3

4-PAH358Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu581~Gly727)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with Cy3.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), FITC

4-PAH358Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu581~Gly727)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with FITC.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), HRP

4-PAH358Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu581~Gly727)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with HRP.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), PE

4-PAH358Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu581~Gly727)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with PE.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), APC

4-PAH358Hu03-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Ala1780~Ile2042)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with APC.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), Biotinylated

4-PAH358Hu03-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Ala1780~Ile2042)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with Biotin.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), Cy3

4-PAH358Hu03-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Ala1780~Ile2042)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with Cy3.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), FITC

4-PAH358Hu03-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Ala1780~Ile2042)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with FITC.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), HRP

4-PAH358Hu03-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Ala1780~Ile2042)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with HRP.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), PE

4-PAH358Hu03-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Ala1780~Ile2042)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with PE.

Plexin B1 (PLXNB1) Polyclonal Antibody (Mouse), APC

4-PAH358Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu1598~Val1849)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Plexin B1 (PLXNB1). This antibody is labeled with APC.

Plexin B1 (PLXNB1) Polyclonal Antibody (Mouse), Biotinylated

4-PAH358Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu1598~Val1849)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Plexin B1 (PLXNB1). This antibody is labeled with Biotin.

Plexin B1 (PLXNB1) Polyclonal Antibody (Mouse), Cy3

4-PAH358Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu1598~Val1849)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Plexin B1 (PLXNB1). This antibody is labeled with Cy3.

Plexin B1 (PLXNB1) Polyclonal Antibody (Mouse), FITC

4-PAH358Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu1598~Val1849)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Plexin B1 (PLXNB1). This antibody is labeled with FITC.

Plexin B1 (PLXNB1) Polyclonal Antibody (Mouse), HRP

4-PAH358Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu1598~Val1849)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Plexin B1 (PLXNB1). This antibody is labeled with HRP.

Plexin B1 (PLXNB1) Polyclonal Antibody (Mouse), PE

4-PAH358Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu1598~Val1849)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Plexin B1 (PLXNB1). This antibody is labeled with PE.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), APC-Cy7

4-PAH358Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu47~Thr173)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with APC-Cy7.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), APC-Cy7

4-PAH358Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu581~Gly727)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with APC-Cy7.

Plexin B1 (PLXNB1) Polyclonal Antibody (Human), APC-Cy7

4-PAH358Hu03-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Ala1780~Ile2042)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plexin B1 (PLXNB1). This antibody is labeled with APC-Cy7.

Plexin B1 (PLXNB1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH358Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLXNB1 (Leu1598~Val1849)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Plexin B1 (PLXNB1). This antibody is labeled with APC-Cy7.

Plexin B1 Antibody

39234-100ul 100ul
EUR 390

PLXNB1 ELISA KIT|Human

EF001877 96 Tests
EUR 689

Bovine IL-10 ELISA Kit

DEIABL-B1 96T
EUR 689
Description: This CD Bovine IL-10 ELISA kit is a 1.5 hour solid-phase ELISA designed for the quantitative determination of Bovine IL-10. This ELISA kit for research use only, not for therapeutic or diagnostic applications!

Human Plexin C1 ELISA kit

E01P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Plexin C1 ELISA kit

E01P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Plexin C1 ELISA kit

E01P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Plexin B2 ELISA KIT|Human

EF001860 96 Tests
EUR 689

Human Plexin B2 PicoKine ELISA Kit

EK1826 96 wells
EUR 425
Description: For quantitative detection of human Plexin B2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Plexin B3 PicoKine ELISA Kit

EK1827 96 wells
EUR 425
Description: For quantitative detection of human Plexin B3 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Plexin- A2, PLXNA2 ELISA KIT

ELI-12573h 96 Tests
EUR 824

Human Plexin- A4, PLXNA4 ELISA KIT

ELI-19689h 96 Tests
EUR 824

Human Plexin- C1, PLXNC1 ELISA KIT

ELI-15328h 96 Tests
EUR 824

Human Plexin- B2, PLXNB2 ELISA KIT

ELI-36127h 96 Tests
EUR 824

Human Plexin- B3, PLXNB3 ELISA KIT

ELI-36128h 96 Tests
EUR 824

Human Plexin- A1, PLXNA1 ELISA KIT

ELI-43580h 96 Tests
EUR 824

Human Plexin- D1, PLXND1 ELISA KIT

ELI-45235h 96 Tests
EUR 824

Human Plexin- A3, PLXNA3 ELISA KIT

ELI-45346h 96 Tests
EUR 824

Human Plexin B2 (PLXNB2) ELISA Kit

abx259794-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Plexin-A2 (PLXNA2) ELISA Kit

abx352209-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Plexin A1 (PLXNA1)ELISA Kit

201-12-2632 96 tests
EUR 440
  • This Plexin A1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin A2 (PLXNA2)ELISA Kit

201-12-2633 96 tests
EUR 440
  • This Plexin A2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin A3 (PLXNA3)ELISA Kit

201-12-2634 96 tests
EUR 440
  • This Plexin A3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin A4 (PLXNA4)ELISA Kit

201-12-2635 96 tests
EUR 440
  • This Plexin A4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin B2 (PLXNB2)ELISA Kit

201-12-2637 96 tests
EUR 440
  • This Plexin B2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin B3 (PLXNB3)ELISA Kit

201-12-2638 96 tests
EUR 440
  • This Plexin B3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin C1 (PLXNC1)ELISA Kit

201-12-2639 96 tests
EUR 440
  • This Plexin C1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin D1 (PLXND1)ELISA Kit

201-12-2640 96 tests
EUR 440
  • This Plexin D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Plexin-C1(PLXNC1) ELISA kit

CSB-EL018225HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Plexin-C1 (PLXNC1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Plexin-C1(PLXNC1) ELISA kit

1-CSB-EL018225HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Plexin-C1(PLXNC1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Plexin D1(PLXND1)ELISA Kit

QY-E03972 96T
EUR 361

Human Plexin C1(PLXNC1)ELISA Kit

QY-E03973 96T
EUR 361

Human Plexin B3(PLXNB3)ELISA Kit

QY-E03974 96T
EUR 361

Human Plexin B2(PLXNB2)ELISA Kit

QY-E03975 96T
EUR 361

Human Plexin A4(PLXNA4)ELISA Kit

QY-E03977 96T
EUR 361

Human Plexin A3(PLXNA3)ELISA Kit

QY-E03978 96T
EUR 361

Human Plexin A2(PLXNA2)ELISA Kit

QY-E03979 96T
EUR 361

Human Plexin A1(PLXNA1)ELISA Kit

QY-E03980 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

PLXNB1 siRNA

20-abx929015
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PLXNB1 siRNA

20-abx929016
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PLXNB1 Antibody

37836-100ul 100ul
EUR 252

PLXNB1 Antibody

1-CSB-PA569970
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLXNB1. Recognizes PLXNB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PLXNB1 Antibody

1-CSB-PA058322
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLXNB1. Recognizes PLXNB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PLXNB1 Antibody

1-CSB-PA018222LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLXNB1. Recognizes PLXNB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

Rat Plexin C1 ELISA kit

E02P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Plexin C1 ELISA kit

E02P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Plexin C1 ELISA kit

E02P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Plexin C1 ELISA kit

E03P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Plexin C1 ELISA kit

E03P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Plexin C1 ELISA kit

E03P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Plexin C1 ELISA kit

E04P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Plexin C1 ELISA kit

E04P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Plexin C1 ELISA kit

E04P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Plexin C1 ELISA kit

E06P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Plexin C1 ELISA kit

E06P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Plexin C1 ELISA kit

E06P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Plexin C1 ELISA kit

E07P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Plexin C1 ELISA kit

E07P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Plexin C1 ELISA kit

E07P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Plexin C1 ELISA kit

E08P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Plexin C1 ELISA kit

E08P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Plexin C1 ELISA kit

E08P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Plexin C1 ELISA kit

E09P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Plexin C1 ELISA kit

E09P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Plexin C1 ELISA kit

E09P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human PLXNA2 (Plexin-A2)

E-EL-H2486 1 plate of 96 wells
EUR 534
  • Gentaur's PLXNA2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLXNA2. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PLXNA2 (Plexin-A2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Plexin-D1 (PLXND1)

KTE62357-48T 48T
EUR 332
  • Tamagnone et al. (1999) identified the cDNA sequence of a novel member of the plexin gene family and named the gene plexin D1. Plxnd1 was expressed by embryonic vascular endothelial cells. Expression was robust in endocardium, intersomitic vessels, p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-D1 (PLXND1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-D1 (PLXND1)

KTE62357-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tamagnone et al. (1999) identified the cDNA sequence of a novel member of the plexin gene family and named the gene plexin D1. Plxnd1 was expressed by embryonic vascular endothelial cells. Expression was robust in endocardium, intersomitic vessels, p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-D1 (PLXND1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-D1 (PLXND1)

KTE62357-96T 96T
EUR 539
  • Tamagnone et al. (1999) identified the cDNA sequence of a novel member of the plexin gene family and named the gene plexin D1. Plxnd1 was expressed by embryonic vascular endothelial cells. Expression was robust in endocardium, intersomitic vessels, p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-D1 (PLXND1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-B3 (PLXNB3)

KTE61201-48T 48T
EUR 332
  • Tamagnone et al. (1999) identified the cDNA sequence of a novel member of the plexin gene family, which they called plexin B3.Artigiani et al. (2004) showed that mammalian Plxnb3 is a high-affinity semaphorin-5A (SEMA5A) receptor. Plxnb3 was activate
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-B3 (PLXNB3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-B3 (PLXNB3)

KTE61201-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tamagnone et al. (1999) identified the cDNA sequence of a novel member of the plexin gene family, which they called plexin B3.Artigiani et al. (2004) showed that mammalian Plxnb3 is a high-affinity semaphorin-5A (SEMA5A) receptor. Plxnb3 was activate
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-B3 (PLXNB3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-B3 (PLXNB3)

KTE61201-96T 96T
EUR 539
  • Tamagnone et al. (1999) identified the cDNA sequence of a novel member of the plexin gene family, which they called plexin B3.Artigiani et al. (2004) showed that mammalian Plxnb3 is a high-affinity semaphorin-5A (SEMA5A) receptor. Plxnb3 was activate
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-B3 (PLXNB3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-B2 (PLXNB2)

KTE61202-48T 48T
EUR 332
  • Members of the B class of plexins, such as PLXNB2 is related to human SEP (PLXNB1). RT-PCR detected highest PLXNB2 expression in testis and ovary, followed by placenta, lung, liver, and kidney. Much lower expression was detected in prostate and small
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-B2 (PLXNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-B2 (PLXNB2)

KTE61202-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Members of the B class of plexins, such as PLXNB2 is related to human SEP (PLXNB1). RT-PCR detected highest PLXNB2 expression in testis and ovary, followed by placenta, lung, liver, and kidney. Much lower expression was detected in prostate and small
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-B2 (PLXNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-B2 (PLXNB2)

KTE61202-96T 96T
EUR 539
  • Members of the B class of plexins, such as PLXNB2 is related to human SEP (PLXNB1). RT-PCR detected highest PLXNB2 expression in testis and ovary, followed by placenta, lung, liver, and kidney. Much lower expression was detected in prostate and small
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-B2 (PLXNB2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-A2 (PLXNA2)

KTE61203-48T 48T
EUR 332
  • Plexin-A2 is a protein that in humans is coded by the PLXNA2 gene. This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-A2 (PLXNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-A2 (PLXNA2)

KTE61203-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Plexin-A2 is a protein that in humans is coded by the PLXNA2 gene. This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-A2 (PLXNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Plexin-A2 (PLXNA2)

KTE61203-96T 96T
EUR 539
  • Plexin-A2 is a protein that in humans is coded by the PLXNA2 gene. This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Plexin-A2 (PLXNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Plexin B2 (Plexin B2) Antibody

abx236545-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human PLXNB1 shRNA Plasmid

20-abx953601
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Vitamin B1 ELISA kit

E01V0026-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Vitamin B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vitamin B1 ELISA kit

E01V0026-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Vitamin B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vitamin B1 ELISA kit

E01V0026-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Vitamin B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase B1 ELISA kit

E01C0730-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase B1 ELISA kit

E01C0730-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase B1 ELISA kit

E01C0730-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ephrin B1 ELISA KIT|Human

EF009414 96 Tests
EUR 689

Human Vitamin B1 Elisa Kit

QY-E05439 96T
EUR 361

Guinea pig Plexin C1 ELISA kit

E05P1025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Plexin C1 ELISA kit

E05P1025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Plexin C1 ELISA kit

E05P1025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Plexin C1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Plexin A1 PicoKine ELISA Kit

EK1818 96 wells
EUR 425
Description: For quantitative detection of mouse Plexin A1 in cell culture supernates, serum and plasma (heparin, EDTA).

Rat Plexin A1 PicoKine ELISA Kit

EK1819 96 wells
EUR 425
Description: For quantitative detection of rat Plexin A1 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Plexin C1 PicoKine ELISA Kit

EK1829 96 wells
EUR 425
Description: For quantitative detection of mouse Plexin C1 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Plexin B2 PicoKine ELISA Kit

EK1882 96 wells
EUR 425
Description: For quantitative detection of mouse Plexin B2 in cell culture supernates, serum and plasma (heparin, EDTA).

Rat Plexin B2 PicoKine ELISA Kit

EK1883 96 wells
EUR 425
Description: For quantitative detection of rat Plexin B2 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Plexin- A1, Plxna1 ELISA KIT

ELI-19688m 96 Tests
EUR 865

Mouse Plexin- A3, Plxna3 ELISA KIT

ELI-21706m 96 Tests
EUR 865

Mouse Plexin- A2, Plxna2 ELISA KIT

ELI-22960m 96 Tests
EUR 865

Mouse Plexin- A4, Plxna4 ELISA KIT

ELI-16335m 96 Tests
EUR 865

Mouse Plexin- C1, Plxnc1 ELISA KIT

ELI-37319m 96 Tests
EUR 865

Mouse Plexin- B3, Plxnb3 ELISA KIT

ELI-43581m 96 Tests
EUR 865

for Plexin D1 (PLXND1)ELISA kit

SEH362Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Plexin D1 (PLXND1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Plexin D1 (PLXND1) in Tissue homogenates, cell lysates and other biological fluids.

for Plexin D1 (PLXND1)ELISA kit

SEH362Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Plexin D1 (PLXND1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Plexin D1 (PLXND1) in Tissue homogenates, cell lysates and other biological fluids.

for Plexin D1 (PLXND1)ELISA kit

SEH362Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Plexin D1 (PLXND1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Plexin D1 (PLXND1) in Tissue homogenates, cell lysates and other biological fluids.

for Plexin D1 (PLXND1)ELISA kit

SEH362Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Plexin D1 (PLXND1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Plexin D1 (PLXND1) in Tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for Plexin D1 (PLXND1)

4-SEH362Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Plexin D1 elisa. Alternative names of the recognized antigen: PLEXD1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Plexin D1 (PLXND1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Bovine Insulin ELISA Kit, 96 tests, Quantitative, 96 tests

0030-10-B1 1 kit
EUR 651

PLXNB1 Conjugated Antibody

C37836 100ul
EUR 397

PLXNB1 cloning plasmid

CSB-CL018222HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 255
  • Sequence: ATGCCATTCCGGCACAAGCCTGGGAGTGTGTTCTCCGTGGAGGGGGAGAACCTGGACCTTGCAATGTCCAAGGAGGAGGTGGTGGCTATGATAGGGGATGGCCCCTGTGTGGTGAAGACGCTGACGCGGCACCACCTGTACTGCGAGCCCCCCGTGGAGCAGCCCCTGCCACGGCA
  • Show more
Description: A cloning plasmid for the PLXNB1 gene.

anti- PLXNB1 antibody

FNab06566 100µg
EUR 548.75
  • Immunogen: plexin B1
  • Uniprot ID: O43157
  • Gene ID: 5364
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against PLXNB1

PLXNB1 Rabbit pAb

A10010-100ul 100 ul
EUR 308

PLXNB1 Rabbit pAb

A10010-200ul 200 ul
EUR 459

PLXNB1 Rabbit pAb

A10010-20ul 20 ul
EUR 183

PLXNB1 Rabbit pAb

A10010-50ul 50 ul
EUR 223

Anti-PLXNB1 antibody

PAab06566 100 ug
EUR 386

Anti-PLXNB1 antibody

STJ112050 100 µl
EUR 277

Plexin A3

GT15211 100 ug
EUR 526

Human Plexin Domain Containing 2 (PLXDC2) ELISA Kit

abx382306-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PLXNB1 ORF Vector (Human) (pORF)

ORF014104 1.0 ug DNA
EUR 354

Human Plexin-A1 (PLXNA1)

1-CSB-YP883448HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 20.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Plexin-A1(PLXNA1),partial expressed in Yeast

Human Plexin-A1 (PLXNA1)

1-CSB-RP143094h(A)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 33.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Plexin-A1(PLXNA1),partial expressed in E.coli

Human Plexin-A1 (PLXNA1)

1-CSB-RP143094h(B)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Plexin-A1(PLXNA1),partial expressed in E.coli

Human Plexin-A4 (PLXNA4)

1-CSB-EP862071HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 60 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Plexin-A4(PLXNA4),partial expressed in E.coli

Recombinant human Plexin-A1

P1674 100ug Ask for price
  • Uniprot ID: Q9UIW2
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Plexin-A1

Recombinant human Plexin-C1

P2224 100ug Ask for price
  • Uniprot ID: O60486
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Plexin-C1

Fumonisin B1 ELISA Kit

E4749-100
EUR 620

Aflatoxin B1 ELISA kit

55R-2236 1 kit
EUR 631
Description: Aflatoxin B1 ELISA kit for use in research laboratory

Aflatoxin B1 ELISA Kit

DEIA051 96T
EUR 792
Description: This kit can be used for qualitative and quantitative analysis of aflatoxin B1 in feed.

Aflatoxin B1 ELISA Kit

DEIA054 96T
EUR 954
Description: The Aflatoxin ELISA Test Kit is a competitive enzyme immunoassay for the quantitative analysis of Aflatoxin in feed, rice, maize, beans, peanuts, peanuts butter, cooking oil and other sample.

ELISA kit for Mouse Plexin-C1 (PLXNC1)

KTE70722-48T 48T
EUR 332
  • Tandem mass spectrometry of receptor peptides yielded partial amino acid sequences that allowed the identification of cDNA clones corresponding to the A39R receptor, called VESPR, The VESPR protein contains 1,568 amino acids and has a molecular mass
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plexin-C1 (PLXNC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Plexin-C1 (PLXNC1)

KTE70722-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Tandem mass spectrometry of receptor peptides yielded partial amino acid sequences that allowed the identification of cDNA clones corresponding to the A39R receptor, called VESPR, The VESPR protein contains 1,568 amino acids and has a molecular mass
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plexin-C1 (PLXNC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Plexin-C1 (PLXNC1)

KTE70722-96T 96T
EUR 539
  • Tandem mass spectrometry of receptor peptides yielded partial amino acid sequences that allowed the identification of cDNA clones corresponding to the A39R receptor, called VESPR, The VESPR protein contains 1,568 amino acids and has a molecular mass
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plexin-C1 (PLXNC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Plexin-A1 (PLXNA1)

KTE70723-48T 48T
EUR 332
  • PLXN1 alone did not bind semaphorin-3A (SEMA3A), but the NRP1/PLXN1 complex had a higher affinity for SEMA3A than did NRP1 alone. While SEMA3A binding to NRP1 did not alter nonneuronal cell morphology, SEMA3A interaction with NRP1/PLXN1 complexes ind
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plexin-A1 (PLXNA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Plexin-A1 (PLXNA1)

KTE70723-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PLXN1 alone did not bind semaphorin-3A (SEMA3A), but the NRP1/PLXN1 complex had a higher affinity for SEMA3A than did NRP1 alone. While SEMA3A binding to NRP1 did not alter nonneuronal cell morphology, SEMA3A interaction with NRP1/PLXN1 complexes ind
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plexin-A1 (PLXNA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Plexin-A1 (PLXNA1)

KTE70723-96T 96T
EUR 539
  • PLXN1 alone did not bind semaphorin-3A (SEMA3A), but the NRP1/PLXN1 complex had a higher affinity for SEMA3A than did NRP1 alone. While SEMA3A binding to NRP1 did not alter nonneuronal cell morphology, SEMA3A interaction with NRP1/PLXN1 complexes ind
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Plexin-A1 (PLXNA1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Vitamin B1, VB1 ELISA Kit

CELI-66015h 96 Tests
EUR 824

Human Lamin B1 (LMNB1) ELISA Kit

abx572522-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Chymotrypsinogen B1 (CTRB1) ELISA Kit

abx573972-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human Lamin-B1

EK2915 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Lamin-B1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CPB1(Carboxypeptidase B1) ELISA Kit

EH4304 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Alias: Carboxypeptidase B1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human EFNB1(Ephrin B1)ELISA Kit

EH8271 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human LMNB1/ Lamin-B1 ELISA Kit

E1480Hu 1 Kit
EUR 605

Human LMNB1(Lamin-B1) ELISA Kit

EH1359 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P20700
  • Alias: LMNB1(Lamin-B1)/ADLD/LMN2/lamin B1/LMN/LMNB
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Limkain- b1, LKAP ELISA KIT

ELI-12373h 96 Tests
EUR 824

Human Ephrin- B1, EFNB1 ELISA KIT

ELI-26084h 96 Tests
EUR 824

Human Endophilin- B1, SH3GLB1 ELISA KIT

ELI-52454h 96 Tests
EUR 824

Human Lamin- B1, LMNB1 ELISA KIT

ELI-31680h 96 Tests
EUR 824

Human Chymotrypsinogen B1 (CTRB1) ELISA Kit

20-abx151071
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ephrin B1 (EFNB1) ELISA Kit

20-abx151431
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Carboxypeptidase B1 (CPB1) ELISA Kit

abx055595-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Human Carboxypeptidase B1 (CPB1) ELISA Kit

abx257718-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Carboxypeptidase B1 (CPB1) ELISA Kit

abx257754-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Lamin B1 (LMNB1) ELISA Kit

abx250629-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Golgin B1 (GOLGB1)ELISA Kit

201-12-2733 96 tests
EUR 440
  • This Golgin B1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Lamin B1 (LMNB1) ELISA Kit

DLR-LMNB1-Hu-48T 48T
EUR 517
  • Should the Human Lamin B1 (LMNB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lamin B1 (LMNB1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lamin B1 (LMNB1) ELISA Kit

DLR-LMNB1-Hu-96T 96T
EUR 673
  • Should the Human Lamin B1 (LMNB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lamin B1 (LMNB1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chymotrypsinogen B1 (CTRB1) ELISA Kit

DLR-CTRB1-Hu-48T 48T
EUR 517
  • Should the Human Chymotrypsinogen B1 (CTRB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chymotrypsinogen B1 (CTRB1) in samples from serum, plasma or other biological fluids.

Human Chymotrypsinogen B1 (CTRB1) ELISA Kit

DLR-CTRB1-Hu-96T 96T
EUR 673
  • Should the Human Chymotrypsinogen B1 (CTRB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chymotrypsinogen B1 (CTRB1) in samples from serum, plasma or other biological fluids.

Human PLXNB1(Plexin B1) ELISA Kit