Human STH(Saitohin) ELISA Kit

Human STH(Saitohin) ELISA Kit

To Order Contact us below: 

    Human Saitohin (STH) ELISA Kit
    RD-STH-Hu-48Tests 48 Tests
    EUR 521
    Human Saitohin (STH) ELISA Kit
    RD-STH-Hu-96Tests 96 Tests
    EUR 723
    Human Saitohin (STH) ELISA Kit
    RDR-STH-Hu-48Tests 48 Tests
    EUR 544
    Human Saitohin (STH) ELISA Kit
    RDR-STH-Hu-96Tests 96 Tests
    EUR 756
    Human Saitohin (STH)
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 29.7 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Saitohin(STH) expressed in E.coli
    Human Saitohin (STH) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Saitohin (STH) ELISA Kit
    abx253789-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.
    Human STH/ Saitohin ELISA Kit
    E2415Hu 1 Kit
    EUR 571
    Human STH(Saitohin) ELISA Kit
    EH0832 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: Q8IWL8
    • Alias: STH/Saitohin
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    Human Saitohin (STH) ELISA Kit
    abx572659-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Saitohin(STH)ELISA Kit
    QY-E04614 96T
    EUR 361
    Human Saitohin (STH) ELISA Kit
    SEE158Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.
    Human Saitohin (STH) ELISA Kit
    SEE158Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.
    Human Saitohin (STH) ELISA Kit
    SEE158Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.
    Human Saitohin (STH) ELISA Kit
    SEE158Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.
    Human Saitohin (STH) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Saitohin elisa. Alternative names of the recognized antigen: MAPTIT
    • Microtubule-Associated Protein Tau Intronic Transcript
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Saitohin (STH) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Saitohin (STH) Antibody
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Saitohin (STH) Antibody
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Human Saitohin (STH) Protein
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Human Saitohin (STH) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human STH (Saitohin)
    ELK3836 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Saitohin (STH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Saitohin (STH). Nex
    • Show more
    Description: A sandwich ELISA kit for detection of Saitohin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Saitohin (STH)
    KTE60386-48T 48T
    EUR 332
    • During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Saitohin (STH)
    KTE60386-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Saitohin (STH)
    KTE60386-96T 96T
    EUR 539
    • During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Human STH ELISA Kit
    ELA-E0304h 96 Tests
    EUR 824
    EF000551 96 Tests
    EUR 689
    STH ELISA Kit (Human) (OKEH04189)
    OKEH04189 96 Wells
    EUR 662
    Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL
    STH ELISA Kit (Human) (OKCD08609)
    OKCD08609 96 Wells
    EUR 975
    Description: Description of target: The function of this protein remains unknown.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.103ng/mL
    STH Antibody
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000
    STH siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Human STH shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    STH Recombinant Protein (Human)
    RP043813 100 ug Ask for price
    STH cloning plasmid
    CSB-CL022827HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 387
    • Sequence: atgagtgagggtggaggccaagtctcatgcatttttgcagcccccacaagactgtgcaggtggccggccctcattgaatgcggggttaatttaactcagcctctgtgtgagtggatgattcaggttgccagagacagaaccctcagcttagcatgggaagtagcttccctgttgac
    • Show more
    Description: A cloning plasmid for the STH gene.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    STH ORF Vector (Human) (pORF)
    ORF014605 1.0 ug DNA
    EUR 354
    STH Antibody, HRP conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    STH Antibody, FITC conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    STH Antibody, Biotin conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    STH sgRNA CRISPR Lentivector set (Human)
    K2302001 3 x 1.0 ug
    EUR 339
    STH sgRNA CRISPR Lentivector (Human) (Target 1)
    K2302002 1.0 ug DNA
    EUR 154
    STH sgRNA CRISPR Lentivector (Human) (Target 2)
    K2302003 1.0 ug DNA
    EUR 154
    STH sgRNA CRISPR Lentivector (Human) (Target 3)
    K2302004 1.0 ug DNA
    EUR 154
    STH Protein Vector (Human) (pPB-C-His)
    PV058417 500 ng
    EUR 481
    STH Protein Vector (Human) (pPB-N-His)
    PV058418 500 ng
    EUR 481
    STH Protein Vector (Human) (pPM-C-HA)
    PV058419 500 ng
    EUR 481
    STH Protein Vector (Human) (pPM-C-His)
    PV058420 500 ng
    EUR 481
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
    Recombinant Human Saitohin Protein, His-SUMO, E.coli-100ug
    QP6736-ec-100ug 100ug
    EUR 408
    Recombinant Human Saitohin Protein, His-SUMO, E.coli-10ug
    QP6736-ec-10ug 10ug
    EUR 200
    Recombinant Human Saitohin Protein, His-SUMO, E.coli-1mg
    QP6736-ec-1mg 1mg
    EUR 1632
    Recombinant Human Saitohin Protein, His-SUMO, E.coli-200ug
    QP6736-ec-200ug 200ug
    EUR 634
    Recombinant Human Saitohin Protein, His-SUMO, E.coli-500ug
    QP6736-ec-500ug 500ug
    EUR 1060
    Recombinant Human Saitohin Protein, His-SUMO, E.coli-50ug
    QP6736-ec-50ug 50ug
    EUR 263
    Column Packing Kit
    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
    PCR Mycoplasma Detection Kit
    M034-Kit Kit
    EUR 266
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9
    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    STH 3'UTR Luciferase Stable Cell Line
    TU024803 1.0 ml
    EUR 2333
    STH 3'UTR GFP Stable Cell Line
    TU074803 1.0 ml
    EUR 2333
    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing
    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing
    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing
    STH sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
    K2302005 3 x 1.0 ug
    EUR 376
    hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
    CAS620A-KIT 1 kit
    EUR 2152
    • Category: Cas9
    Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    Human STH(Saitohin) ELISA Kit