Human STH(Saitohin) ELISA Kit

Human STH(Saitohin) ELISA Kit

To Order Contact us below: 

Human Saitohin (STH) ELISA Kit
RD-STH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Saitohin (STH) ELISA Kit
RD-STH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Saitohin (STH) ELISA Kit
RDR-STH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Saitohin (STH) ELISA Kit
RDR-STH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Saitohin (STH)
1-CSB-EP022827HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 29.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Saitohin(STH) expressed in E.coli

Human Saitohin (STH) ELISA Kit
20-abx153012	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Saitohin (STH) ELISA Kit
abx253789-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human STH/ Saitohin ELISA Kit
E2415Hu	Sunlong	1 Kit	EUR 571

Human STH(Saitohin) ELISA Kit
EH0832	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q8IWL8 Alias: STH/Saitohin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Saitohin (STH) ELISA Kit
abx572659-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Saitohin(STH)ELISA Kit
QY-E04614	Qayee Biotechnology	96T	EUR 361

Human Saitohin (STH) ELISA Kit
SEE158Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.

Human Saitohin (STH) ELISA Kit
SEE158Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.

Human Saitohin (STH) ELISA Kit
SEE158Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.

Human Saitohin (STH) ELISA Kit
SEE158Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.

Human Saitohin (STH) ELISA Kit
4-SEE158Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Saitohin elisa. Alternative names of the recognized antigen: MAPTIT Microtubule-Associated Protein Tau Intronic Transcript
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Saitohin (STH) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Saitohin (STH) Antibody
20-abx178306	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Saitohin (STH) Antibody
20-abx174455	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Human Saitohin (STH) Protein
20-abx654985	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Saitohin (STH) CLIA Kit
20-abx494522	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human STH (Saitohin)
ELK3836	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Saitohin (STH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Saitohin (STH). Nex Show more
Description: A sandwich ELISA kit for detection of Saitohin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Saitohin (STH)
KTE60386-48T	Abbkine	48T	EUR 332
During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes Show more
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Saitohin (STH)
KTE60386-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes Show more
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Saitohin (STH)
KTE60386-96T	Abbkine	96T	EUR 539
During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes Show more
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human STH ELISA Kit
ELA-E0304h	Lifescience Market	96 Tests	EUR 824

STH ELISA KIT|Human
EF000551	Lifescience Market	96 Tests	EUR 689

STH ELISA Kit (Human) (OKEH04189)
OKEH04189	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL

STH ELISA Kit (Human) (OKCD08609)
OKCD08609	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The function of this protein remains unknown.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.103ng/mL

STH Antibody
1-CSB-PA022827LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

STH siRNA
20-abx935443	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human STH shRNA Plasmid
20-abx966624	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STH Recombinant Protein (Human)
RP043813	ABM	100 ug	Ask for price

STH cloning plasmid
CSB-CL022827HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 387 Sequence: atgagtgagggtggaggccaagtctcatgcatttttgcagcccccacaagactgtgcaggtggccggccctcattgaatgcggggttaatttaactcagcctctgtgtgagtggatgattcaggttgccagagacagaaccctcagcttagcatgggaagtagcttccctgttgac Show more
Description: A cloning plasmid for the STH gene.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

STH ORF Vector (Human) (pORF)
ORF014605	ABM	1.0 ug DNA	EUR 354

STH Antibody, HRP conjugated
1-CSB-PA022827LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STH Antibody, FITC conjugated
1-CSB-PA022827LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STH Antibody, Biotin conjugated
1-CSB-PA022827LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

STH sgRNA CRISPR Lentivector set (Human)
K2302001	ABM	3 x 1.0 ug	EUR 339

STH sgRNA CRISPR Lentivector (Human) (Target 1)
K2302002	ABM	1.0 ug DNA	EUR 154

STH sgRNA CRISPR Lentivector (Human) (Target 2)
K2302003	ABM	1.0 ug DNA	EUR 154

STH sgRNA CRISPR Lentivector (Human) (Target 3)
K2302004	ABM	1.0 ug DNA	EUR 154

STH Protein Vector (Human) (pPB-C-His)
PV058417	ABM	500 ng	EUR 481

STH Protein Vector (Human) (pPB-N-His)
PV058418	ABM	500 ng	EUR 481

STH Protein Vector (Human) (pPM-C-HA)
PV058419	ABM	500 ng	EUR 481

STH Protein Vector (Human) (pPM-C-His)
PV058420	ABM	500 ng	EUR 481

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Recombinant Human Saitohin Protein, His-SUMO, E.coli-100ug
QP6736-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Saitohin Protein, His-SUMO, E.coli-10ug
QP6736-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Saitohin Protein, His-SUMO, E.coli-1mg
QP6736-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Saitohin Protein, His-SUMO, E.coli-200ug
QP6736-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Saitohin Protein, His-SUMO, E.coli-500ug
QP6736-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Saitohin Protein, His-SUMO, E.coli-50ug
QP6736-ec-50ug	EnQuireBio	50ug	EUR 263

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

STH 3'UTR Luciferase Stable Cell Line
TU024803	ABM	1.0 ml	EUR 2333

STH 3'UTR GFP Stable Cell Line
TU074803	ABM	1.0 ml	EUR 2333

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

STH sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2302005	ABM	3 x 1.0 ug	EUR 376

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Human STH(Saitohin) ELISA Kit