Human CRY1(Cryptochrome 1) ELISA Kit

Human CRY1(Cryptochrome 1) ELISA Kit

To Order Contact us below: 

    Human Cryptochrome 1 (CRY1) ELISA Kit
    RDR-CRY1-Hu-48Tests 48 Tests
    EUR 544
    Human Cryptochrome 1 (CRY1) ELISA Kit
    RDR-CRY1-Hu-96Tests 96 Tests
    EUR 756
    Human Cryptochrome 1 (CRY1) ELISA Kit
    RD-CRY1-Hu-48Tests 48 Tests
    EUR 521
    Human Cryptochrome 1 (CRY1) ELISA Kit
    RD-CRY1-Hu-96Tests 96 Tests
    EUR 723
    Human CRY1(Cryptochrome 1) ELISA Kit
    EH2887 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q16526
    • Alias: CRY1/Cryptochrome I/PHLL1/cryptochrome 1(photolyase-like)/PHLL1cryptochrome-1/photolyase-like cryptochrome 1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
    Human Cryptochrome- 1, CRY1 ELISA KIT
    ELI-25756h 96 Tests
    EUR 824
    Human Cryptochrome 1 (CRY1) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Cryptochrome 1 (CRY1) ELISA Kit
    abx252276-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human Cryptochrome 1 (CRY1) ELISA Kit
    SEC407Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cryptochrome 1 (CRY1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cryptochrome 1 (CRY1) in tissue homogenates, cell lysates and other biological fluids.
    Human Cryptochrome 1 (CRY1) ELISA Kit
    SEC407Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cryptochrome 1 (CRY1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cryptochrome 1 (CRY1) in tissue homogenates, cell lysates and other biological fluids.
    Human Cryptochrome 1 (CRY1) ELISA Kit
    SEC407Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cryptochrome 1 (CRY1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cryptochrome 1 (CRY1) in tissue homogenates, cell lysates and other biological fluids.
    Human Cryptochrome 1 (CRY1) ELISA Kit
    SEC407Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cryptochrome 1 (CRY1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cryptochrome 1 (CRY1) in tissue homogenates, cell lysates and other biological fluids.
    Human Cryptochrome 1 (CRY1) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Cryptochrome 1 elisa. Alternative names of the recognized antigen: PHLL1
    • Photolyase-like 1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cryptochrome 1 (CRY1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Cryptochrome 1 ELISA Kit (CRY1)
    RK01190 96 Tests
    EUR 521
    Pig Cryptochrome 1 (CRY1) ELISA Kit
    abx361170-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Rabbit Cryptochrome 1 (CRY1) ELISA Kit
    abx362767-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Sheep Cryptochrome 1 (CRY1) ELISA Kit
    abx364136-96tests 96 tests
    EUR 926
    • Shipped within 5-12 working days.
    Mouse Cryptochrome- 1, Cry1 ELISA KIT
    ELI-09333m 96 Tests
    EUR 865
    Chicken Cryptochrome- 1, CRY1 ELISA KIT
    ELI-47519c 96 Tests
    EUR 928
    Mouse Cryptochrome 1 (CRY1) ELISA Kit
    abx352637-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.
    Rat Cryptochrome 1 (CRY1) ELISA Kit
    abx353624-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.
    Chicken Cryptochrome 1 (CRY1) ELISA Kit
    abx356412-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Monkey Cryptochrome 1 (CRY1) ELISA Kit
    abx359399-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Cryptochrome 1 (CRY1) Antibody
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.
    Cryptochrome 1 (CRY1) Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Cryptochrome 1 (CRY1) Antibody
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Cryptochrome 1 (CRY1) Antibody
    abx145286-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Cryptochrome 1 (Cry1) Antibody
    abx032696-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Cryptochrome 1 (Cry1) Antibody
    abx032696-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Cryptochrome 1 (CRY1) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Cryptochrome 1 (CRY1) Antibody
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Cryptochrome 1 (CRY1) Antibody
    abx332831-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.
    Cryptochrome 1 (CRY1) Antibody
    • EUR 370.00
    • EUR 606.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Cryptochrome 1 (CRY1) Antibody
    abx232007-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Cryptochrome 1 (CRY1) Antibody
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Recombinant Cryptochrome 1 (CRY1)
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q16526
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 45.0kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Cryptochrome 1 expressed in: E.coli
    ELISA kit for Human CRY1 (Cryptochrome 1)
    E-EL-H2250 1 plate of 96 wells
    EUR 534
    • Gentaur's CRY1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CRY1. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human CRY1 (Cryptochrome 1) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for Human CRY1 (Cryptochrome 1)
    ELK3896 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cryptochrome 1 (CRY1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cryptochrome
    • Show more
    Description: A sandwich ELISA kit for detection of Cryptochrome 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Human Cryptochrome 1 (CRY1) CLIA Kit
    abx196570-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Human Cryptochrome 1 (CRY1) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Human Cryptochrome 1 (CRY1) Protein
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    ELISA kit for Mouse CRY1 (Cryptochrome 1)
    E-EL-M0364 1 plate of 96 wells
    EUR 534
    • Gentaur's CRY1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CRY1. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Mouse CRY1 (Cryptochrome 1) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for Rat CRY1 (Cryptochrome 1)
    E-EL-R0282 1 plate of 96 wells
    EUR 534
    • Gentaur's CRY1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CRY1. Standards or samples are added to the micro ELISA plate wells and combined with the
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Rat CRY1 (Cryptochrome 1) in samples from Serum, Plasma, Cell supernatant
    Cryptochrome 1 (CRY1) polyclonal antibody
    ABP-PAB-10597 100 ug Ask for price
      • Product line: Miscellaneous
      • Brand:
    CLIA kit for Human CRY1 (Cryptochrome 1)
    E-CL-H1330 1 plate of 96 wells
    EUR 584
    • Gentaur's CRY1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CRY1 . Standards or samples are added to the micro CLIA plate wells and combined with the
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Human CRY1 (Cryptochrome 1) in samples from Serum, Plasma, Cell supernatant
    Cryptochrome 1 (CRY1) Polyclonal Antibody (Human)
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CRY1 (Val3~Leu132)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1)
    Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CRY1 (Val3~Leu132)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with APC.
    Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), Biotinylated
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CRY1 (Val3~Leu132)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with Biotin.
    Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CRY1 (Val3~Leu132)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with Cy3.
    Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CRY1 (Val3~Leu132)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with FITC.
    Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CRY1 (Val3~Leu132)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with HRP.
    Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CRY1 (Val3~Leu132)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with PE.
    Anti-Cryptochrome I/CRY1 Antibody
    PB9540 100ug/vial
    EUR 334
    Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CRY1 (Val3~Leu132)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with APC-Cy7.
    Mouse Cryptochrome 1 (CRY1) Control/blocking peptide # 1
    CRY11-P 100 ug
    EUR 164
    Rabbit Anti-Mouse Cryptochrome 1 (CRY1) antiserum # 1
    CRY11-S 100 ul
    EUR 457
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Rabbit Anti-Mouse Cryptochrome 1 (CRY1) IgG # 1, aff pure
    CRY11-A 100 ug
    EUR 482
    Human Cryptochrome 1 ELISA kit
    E01C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cryptochrome 1 ELISA kit
    E01C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cryptochrome 1 ELISA kit
    E01C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Cry1/ Rat Cry1 ELISA Kit
    ELI-25757r 96 Tests
    EUR 886
    Goat Cryptochrome 1 ELISA kit
    E06C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Cryptochrome 1 ELISA kit
    E06C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Cryptochrome 1 ELISA kit
    E06C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Cryptochrome 1 ELISA kit
    E02C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Cryptochrome 1 ELISA kit
    E02C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Cryptochrome 1 ELISA kit
    E02C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Cryptochrome 1 ELISA kit
    E03C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Cryptochrome 1 ELISA kit
    E03C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Cryptochrome 1 ELISA kit
    E03C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Cryptochrome 1 ELISA kit
    E04C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Cryptochrome 1 ELISA kit
    E04C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Cryptochrome 1 ELISA kit
    E04C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Cryptochrome 1 ELISA kit
    E07C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Cryptochrome 1 ELISA kit
    E07C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Cryptochrome 1 ELISA kit
    E07C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Cryptochrome 1 ELISA kit
    E08C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Cryptochrome 1 ELISA kit
    E08C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Cryptochrome 1 ELISA kit
    E08C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Cryptochrome 1 ELISA kit
    E09C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Cryptochrome 1 ELISA kit
    E09C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Cryptochrome 1 ELISA kit
    E09C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human CRY1 ELISA Kit
    EHC0575 96Tests
    EUR 521
    CRY1 ELISA KIT|Human
    EF008930 96 Tests
    EUR 689
    Cryptochrome 2 ELISA KIT|Human
    EF008867 96 Tests
    EUR 689
    Guinea pig Cryptochrome 1 ELISA kit
    E05C0568-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Cryptochrome 1 ELISA kit
    E05C0568-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Cryptochrome 1 ELISA kit
    E05C0568-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    CRY1 ELISA Kit (Human) (OKCD01672)
    OKCD01672 96 Wells
    EUR 831
    Description: Description of target: Transcriptional repressor which forms a core component of the circadian clock. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL
    Goat CRY1 ELISA Kit
    EGTC0575 96Tests
    EUR 521
    Canine CRY1 ELISA Kit
    ECC0575 96Tests
    EUR 521
    Chicken CRY1 ELISA Kit
    ECKC0575 96Tests
    EUR 521
    Bovine CRY1 ELISA Kit
    EBC0575 96Tests
    EUR 521
    Anserini CRY1 ELISA Kit
    EAC0575 96Tests
    EUR 521
    Porcine CRY1 ELISA Kit
    EPC0575 96Tests
    EUR 521
    Rat CRY1 ELISA Kit
    ERC0575 96Tests
    EUR 521
    Rabbit CRY1 ELISA Kit
    ERTC0575 96Tests
    EUR 521
    Sheep CRY1 ELISA Kit
    ESC0575 96Tests
    EUR 521
    Mouse CRY1 ELISA Kit
    EMC0575 96Tests
    EUR 521
    Monkey CRY1 ELISA Kit
    EMKC0575 96Tests
    EUR 521
    Human Cryptochrome 2(CRY2) ELISA kit
    E01C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cryptochrome 2(CRY2) ELISA kit
    E01C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cryptochrome 2(CRY2) ELISA kit
    E01C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cryptochrome- 2, CRY2 ELISA KIT
    ELI-09026h 96 Tests
    EUR 824
    Human Cryptochrome 2 (CRY2) ELISA Kit
    abx352379-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.
    Human Cryptochrome 2(CRY2)ELISA Kit
    QY-E00418 96T
    EUR 361
    Cryptochrome 2 (Cryptochrome 2) Antibody
    abx232008-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Guinea Pig CRY1 ELISA Kit
    EGC0575 96Tests
    EUR 521
    CRY1 ELISA Kit (Mouse) (OKEI00434)
    OKEI00434 96 Wells
    EUR 767
    Description: Description of target: Transcriptional repressor which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers'). The predominant Zeitgeber for the central clock is light, which is sensed by retina and signals directly to the SCN. The central clock entrains the peripheral clocks through neuronal and hormonal signals, body temperature and feeding-related cues, aligning all clocks with the external light/dark cycle. Circadian rhythms allow an organism to achieve temporal homeostasis with its environment at the molecular level by regulating gene expression to create a peak of protein expression once every 24 hours to control when a particular physiological process is most active with respect to the solar day. Transcription and translation of core clock components (CLOCK, NPAS2, ARNTL/BMAL1, ARNTL2/BMAL2, PER1, PER2, PER3, CRY1 and CRY2) plays a critical role in rhythm generation, whereas delays imposed by post-translational modifications (PTMs) are important for determining the period (tau) of the rhythms (tau refers to the period of a rhythm and is the length, in time, of one complete cycle). A diurnal rhythm is synchronized with the day/night cycle, while the ultradian and infradian rhythms have a period shorter and longer than 24 hours, respectively. Disruptions in the circadian rhythms contribute to the pathology of cardiovascular diseases, cancer, metabolic syndromes and aging. A transcription/translation feedback loop (TTFL) forms the core of the molecular circadian clock mechanism. Transcription factors, CLOCK or NPAS2 and ARNTL/BMAL1 or ARNTL2/BMAL2, form the positive limb of the feedback loop, act in the form of a heterodimer and activate the transcription of core clock genes and clock-controlled genes (involved in key metabolic processes), harboring E-box elements (5'-CACGTG-3') within their promoters. The core clock genes: PER1/2/3 and CRY1/2 which are transcriptional repressors form the negative limb of the feedback loop and interact with the CLOCK|NPAS2-ARNTL/BMAL1|ARNTL2/BMAL2 heterodimer inhibiting its activity and thereby negatively regulating their own expression. This heterodimer also activates nuclear receptors NR1D1/2 and RORA/B/G, which form a second feedback loop and which activate and repress ARNTL/BMAL1 transcription, respectively. CRY1 and CRY2 have redundant functions but also differential and selective contributions at least in defining the pace of the SCN circadian clock and its circadian transcriptional outputs. More potent transcriptional repressor in cerebellum and liver than CRY2, though more effective in lengthening the period of the SCN oscillator. On its side, CRY2 seems to play a critical role in tuning SCN circadian period by opposing the action of CRY1. With CRY2, is dispensable for circadian rhythm generation but necessary for the development of intercellular networks for rhythm synchrony. Capable of translocating circadian clock core proteins such as PER proteins to the nucleus. Interacts with CLOCK-ARNTL/BMAL1 independently of PER proteins and is found atCLOCK-ARNTL/BMAL1-bound sites, suggesting that CRY may act as a molecular gatekeeper to maintain CLOCK-ARNTL/BMAL1 in a poised and repressed state until the proper time for transcriptional activation. Represses the CLOCK-ARNTL/BMAL1 induced transcription of BHLHE40/DEC1, ATF4, MTA1, KLF10 and NAMPT. May repress circadian target genes expression in collaboration with HDAC1 and HDAC2 through histone deacetylation. Mediates the clock-control activation of ATR and modulates ATR-mediated DNA damage checkpoint. In liver, mediates circadian regulation of cAMP signaling and gluconeogenesis by binding to membrane-coupled G proteins and blocking glucagon-mediated increases in intracellular cAMP concentrations and CREB1 phosphorylation. Besides its role in the maintenance of the circadian clock, is also involved in the regulation of other processes. Represses glucocorticoid receptor NR3C1/GR-induced transcriptional activity by binding to glucocorticoid response elements (GREs). Plays a key role in glucose and lipid metabolism modulation, in part, through the transcriptional regulation of genes involved in these pathways, such as LEP or ACSL4.2;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL
    CRY1 ELISA Kit (Rat) (OKEI00743)
    OKEI00743 96 Wells
    EUR 767
    Description: Description of target: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL
    anti- Cryptochrome 1 antibody
    FNab02007 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:1000
    • IHC: 1:50-1:500
    • IF: 1:10-1:100
    • Immunogen: cryptochrome 1(photolyase-like)
    • Uniprot ID: Q16526
    • Gene ID: 1407
    • Research Area: Neuroscience, Cardiovascular, Metabolism
    Description: Antibody raised against Cryptochrome 1
    Anti-Cryptochrome 1 antibody
    PAab02007 100 ug
    EUR 355
    ELISA kit for Human CRY2 (Cryptochrome 2)
    E-EL-H5568 1 plate of 96 wells
    EUR 534
    • Gentaur's CRY2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CRY2. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human CRY2 (Cryptochrome 2) in samples from Serum, Plasma, Cell supernatant
    Goat Cryptochrome 2(CRY2) ELISA kit
    E06C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Cryptochrome 2(CRY2) ELISA kit
    E06C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Cryptochrome 2(CRY2) ELISA kit
    E06C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Cryptochrome 2(CRY2) ELISA kit
    E02C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Cryptochrome 2(CRY2) ELISA kit
    E02C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Cryptochrome 2(CRY2) ELISA kit
    E02C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Cryptochrome 2(CRY2) ELISA kit
    E03C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Cryptochrome 2(CRY2) ELISA kit
    E03C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Cryptochrome 2(CRY2) ELISA kit
    E03C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Cryptochrome 2(CRY2) ELISA kit
    E04C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Cryptochrome 2(CRY2) ELISA kit
    E04C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Cryptochrome 2(CRY2) ELISA kit
    E04C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Cryptochrome 2(CRY2) ELISA kit
    E08C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Cryptochrome 2(CRY2) ELISA kit
    E08C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Cryptochrome 2(CRY2) ELISA kit
    E08C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Cryptochrome 2(CRY2) ELISA kit
    E09C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Cryptochrome 2(CRY2) ELISA kit
    E09C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Cryptochrome 2(CRY2) ELISA kit
    E09C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Cryptochrome 2(CRY2) ELISA kit
    E07C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Cryptochrome 2(CRY2) ELISA kit
    E07C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Cryptochrome 2(CRY2) ELISA kit
    E07C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Chicken Cryptochrome- 2, CRY2 ELISA KIT
    ELI-33774c 96 Tests
    EUR 928
    Mouse Cryptochrome- 2, Cry2 ELISA KIT
    ELI-47520m 96 Tests
    EUR 865
    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes
    mRNAExpress mRNA Synthesis kit (5 reactions)
    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products
    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    CRY1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CRY1 Antibody
    ABD8932 100 ug
    EUR 438
    CRY1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CRY1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Cry1 antibody
    10R-10534 100 ug
    EUR 435
    Description: Mouse monoclonal Cry1 antibody
    Cry1 antibody
    10R-10535 100 ug
    EUR 435
    Description: Mouse monoclonal Cry1 antibody
    Cry1 antibody
    10R-10536 100 ug
    EUR 435
    Description: Mouse monoclonal Cry1 antibody
    CRY1 Antibody
    21414-100ul 100ul
    EUR 252
    CRY1 Antibody
    21414-50ul 50ul
    EUR 187
    CRY1 antibody
    10R-1729 100 ug
    EUR 512
    Description: Mouse monoclonal CRY1 antibody
    CRY1 antibody
    20R-2489 50 ug
    EUR 281
    Description: Rabbit polyclonal CRY1 antibody
    CRY1 antibody
    70R-16603 50 ul
    EUR 435
    Description: Rabbit polyclonal CRY1 antibody
    CRY1 Antibody
    DF8932 200ul
    EUR 304
    Description: CRY1 Antibody detects endogenous levels of total CRY1.
    CRY1 Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against CRY1. Recognizes CRY1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
    CRY1 Antibody
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against CRY1. Recognizes CRY1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    CRY1 Antibody
    EUR 335
    • Form: liquid
    • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
    • Show more
    Description: A polyclonal antibody against CRY1. Recognizes CRY1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    CRY1 Antibody
    CSB-PA096933-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
    • Show more
    Description: A polyclonal antibody against CRY1. Recognizes CRY1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    Human CRY1 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    CRY1 Recombinant Protein (Human)
    RP008083 100 ug Ask for price
    Guinea pig Cryptochrome 2(CRY2) ELISA kit
    E05C2085-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Cryptochrome 2(CRY2) ELISA kit
    E05C2085-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Cryptochrome 2(CRY2) ELISA kit
    E05C2085-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Cryptochrome 2 antibody
    70R-4034 50 ug
    EUR 467
    Description: Rabbit polyclonal Cryptochrome 2 antibody
    Cryptochrome 2 Antibody
    DF12919 200ul
    EUR 304
    Description: Cryptochrome 2 Antibody detects endogenous levels of Cryptochrome 2.
    anti-Cryptochrome I
    YF-PA11099 50 ug
    EUR 363
    Description: Mouse polyclonal to Cryptochrome I
    CRY1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K0511002 1.0 ug DNA
    EUR 154
    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools
    CRY1 Polyclonal Antibody
    ES9135-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CRY1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    CRY1 Polyclonal Antibody
    ES9135-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CRY1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    CRY1 Polyclonal Antibody
    ABP58276-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200
    • Applications tips:
    Description: A polyclonal antibody for detection of CRY1 from Human, Mouse, Rat. This CRY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200
    CRY1 Polyclonal Antibody
    ABP58276-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200
    • Applications tips:
    Description: A polyclonal antibody for detection of CRY1 from Human, Mouse, Rat. This CRY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200
    CRY1 Polyclonal Antibody
    ABP58276-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200
    • Applications tips:
    Description: A polyclonal antibody for detection of CRY1 from Human, Mouse, Rat. This CRY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200
    CRY1 Rabbit pAb
    A13662-100ul 100 ul
    EUR 308
    CRY1 Rabbit pAb
    A13662-200ul 200 ul
    EUR 459
    CRY1 Rabbit pAb
    A13662-20ul 20 ul
    EUR 183
    CRY1 Rabbit pAb
    A13662-50ul 50 ul
    EUR 223
    CRY1 Rabbit pAb
    A13666-100ul 100 ul
    EUR 308
    CRY1 Rabbit pAb
    A13666-200ul 200 ul
    EUR 459
    CRY1 Rabbit pAb
    A13666-20ul 20 ul
    EUR 183
    CRY1 Rabbit pAb
    A13666-50ul 50 ul
    EUR 223
    CRY1 Rabbit pAb
    A6807-100ul 100 ul
    EUR 308
    CRY1 Rabbit pAb
    A6807-200ul 200 ul
    EUR 459
    CRY1 Rabbit pAb
    A6807-20ul 20 ul Ask for price
    CRY1 Rabbit pAb
    A6807-50ul 50 ul Ask for price
    CRY1 Rabbit pAb
    A6890-100ul 100 ul
    EUR 308
    CRY1 Rabbit pAb
    A6890-200ul 200 ul
    EUR 459
    CRY1 Rabbit pAb
    A6890-20ul 20 ul
    EUR 183
    CRY1 Rabbit pAb
    A6890-50ul 50 ul
    EUR 223
    CRY1 Blocking Peptide
    DF8932-BP 1mg
    EUR 195
    CRY1 cloning plasmid
    CSB-CL621957HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1761
    • Sequence: atgggggtgaacgccgtgcactggttccgaaaggggctccggctccacgacaaccccgccctgaaggagtgcattcagggcgccgacaccatccgctgcgtctacatcctggacccctggttcgccggctcctccaatgtgggcatcaacaggtggcgatttttgcttcagtgtc
    • Show more
    Description: A cloning plasmid for the CRY1 gene.
    PVT17810 2 ug
    EUR 258
    Anti-CRY1 antibody
    STJ28890 100 µl
    EUR 277
    Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.
    Anti-CRY1 antibody
    STJ28970 100 µl
    EUR 277
    Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.
    Anti-CRY1 antibody
    STJ11100001 100 µl
    EUR 413
    Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.
    Anti-CRY1 antibody
    STJ190293 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to CRY1
    Anti-CRY1 antibody
    STJ115618 100 µl
    EUR 277
    Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.
    Anti-CRY1 antibody
    STJ115622 100 µl
    EUR 277
    Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.
    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
    CRY1 ORF Vector (Human) (pORF)
    ORF002695 1.0 ug DNA
    EUR 95

    Human CRY1(Cryptochrome 1) ELISA Kit