Human CRY1(Cryptochrome 1) ELISA Kit

Human CRY1(Cryptochrome 1) ELISA Kit

To Order Contact us below: 

Human Cryptochrome 1 (CRY1) ELISA Kit
RDR-CRY1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Cryptochrome 1 (CRY1) ELISA Kit
RDR-CRY1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Cryptochrome 1 (CRY1) ELISA Kit
RD-CRY1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Cryptochrome 1 (CRY1) ELISA Kit
RD-CRY1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human CRY1(Cryptochrome 1) ELISA Kit
EH2887	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q16526 Alias: CRY1/Cryptochrome I/PHLL1/cryptochrome 1(photolyase-like)/PHLL1cryptochrome-1/photolyase-like cryptochrome 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Cryptochrome- 1, CRY1 ELISA KIT
ELI-25756h	Lifescience Market	96 Tests	EUR 824

Human Cryptochrome 1 (CRY1) ELISA Kit
20-abx151190	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cryptochrome 1 (CRY1) ELISA Kit
abx252276-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Cryptochrome 1 (CRY1) ELISA Kit
SEC407Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cryptochrome 1 (CRY1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cryptochrome 1 (CRY1) in tissue homogenates, cell lysates and other biological fluids.

Human Cryptochrome 1 (CRY1) ELISA Kit
SEC407Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cryptochrome 1 (CRY1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cryptochrome 1 (CRY1) in tissue homogenates, cell lysates and other biological fluids.

Human Cryptochrome 1 (CRY1) ELISA Kit
SEC407Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cryptochrome 1 (CRY1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cryptochrome 1 (CRY1) in tissue homogenates, cell lysates and other biological fluids.

Human Cryptochrome 1 (CRY1) ELISA Kit
SEC407Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cryptochrome 1 (CRY1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cryptochrome 1 (CRY1) in tissue homogenates, cell lysates and other biological fluids.

Human Cryptochrome 1 (CRY1) ELISA Kit
4-SEC407Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Cryptochrome 1 elisa. Alternative names of the recognized antigen: PHLL1 Photolyase-like 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cryptochrome 1 (CRY1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Cryptochrome 1 ELISA Kit (CRY1)
RK01190	Abclonal	96 Tests	EUR 521

Pig Cryptochrome 1 (CRY1) ELISA Kit
abx361170-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Cryptochrome 1 (CRY1) ELISA Kit
abx362767-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Cryptochrome 1 (CRY1) ELISA Kit
abx364136-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Mouse Cryptochrome- 1, Cry1 ELISA KIT
ELI-09333m	Lifescience Market	96 Tests	EUR 865

Chicken Cryptochrome- 1, CRY1 ELISA KIT
ELI-47519c	Lifescience Market	96 Tests	EUR 928

Mouse Cryptochrome 1 (CRY1) ELISA Kit
abx352637-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Cryptochrome 1 (CRY1) ELISA Kit
abx353624-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Chicken Cryptochrome 1 (CRY1) ELISA Kit
abx356412-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Cryptochrome 1 (CRY1) ELISA Kit
abx359399-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Cryptochrome 1 (CRY1) Antibody
20-abx123152	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Cryptochrome 1 (CRY1) Antibody
20-abx116812	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cryptochrome 1 (CRY1) Antibody
20-abx128412	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cryptochrome 1 (CRY1) Antibody
abx145286-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Cryptochrome 1 (Cry1) Antibody
abx032696-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Cryptochrome 1 (Cry1) Antibody
abx032696-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Cryptochrome 1 (CRY1) Antibody
20-abx006397	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Cryptochrome 1 (CRY1) Antibody
20-abx320338	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Cryptochrome 1 (CRY1) Antibody
abx332831-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Cryptochrome 1 (CRY1) Antibody
20-abx225124	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Cryptochrome 1 (CRY1) Antibody
abx232007-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Cryptochrome 1 (CRY1) Antibody
20-abx171952	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Cryptochrome 1 (CRY1)
4-RPC407Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q16526 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 45.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Cryptochrome 1 expressed in: E.coli

ELISA kit for Human CRY1 (Cryptochrome 1)
E-EL-H2250	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CRY1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CRY1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CRY1 (Cryptochrome 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human CRY1 (Cryptochrome 1)
ELK3896	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cryptochrome 1 (CRY1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cryptochrome Show more
Description: A sandwich ELISA kit for detection of Cryptochrome 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cryptochrome 1 (CRY1) CLIA Kit
abx196570-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Cryptochrome 1 (CRY1) CLIA Kit
20-abx493666	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Cryptochrome 1 (CRY1) Protein
20-abx166728	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse CRY1 (Cryptochrome 1)
E-EL-M0364	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CRY1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CRY1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CRY1 (Cryptochrome 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat CRY1 (Cryptochrome 1)
E-EL-R0282	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CRY1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CRY1. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CRY1 (Cryptochrome 1) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Human CRY1 (Cryptochrome 1)
E-CL-H1330	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's CRY1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CRY1 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CRY1 (Cryptochrome 1) in samples from Serum, Plasma, Cell supernatant

Cryptochrome 1 (CRY1) polyclonal antibody
ABP-PAB-10597	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Cryptochrome 1 (CRY1) Polyclonal Antibody (Human)
4-PAC407Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRY1 (Val3~Leu132) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1)

Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), APC
4-PAC407Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRY1 (Val3~Leu132) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with APC.

Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), Biotinylated
4-PAC407Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRY1 (Val3~Leu132) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with Biotin.

Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), Cy3
4-PAC407Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRY1 (Val3~Leu132) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with Cy3.

Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), FITC
4-PAC407Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRY1 (Val3~Leu132) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with FITC.

Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), HRP
4-PAC407Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRY1 (Val3~Leu132) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with HRP.

Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), PE
4-PAC407Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRY1 (Val3~Leu132) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with PE.

Anti-Cryptochrome I/CRY1 Antibody
PB9540	BosterBio	100ug/vial	EUR 334

Cryptochrome 1 (CRY1) Polyclonal Antibody (Human), APC-Cy7
4-PAC407Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CRY1 (Val3~Leu132) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cryptochrome 1 (CRY1). This antibody is labeled with APC-Cy7.

Mouse Cryptochrome 1 (CRY1) Control/blocking peptide # 1
CRY11-P	Alpha Diagnostics	100 ug	EUR 164

Rabbit Anti-Mouse Cryptochrome 1 (CRY1) antiserum # 1
CRY11-S	Alpha Diagnostics	100 ul	EUR 457

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Rabbit Anti-Mouse Cryptochrome 1 (CRY1) IgG # 1, aff pure
CRY11-A	Alpha Diagnostics	100 ug	EUR 482

Human Cryptochrome 1 ELISA kit
E01C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cryptochrome 1 ELISA kit
E01C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cryptochrome 1 ELISA kit
E01C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cry1/ Rat Cry1 ELISA Kit
ELI-25757r	Lifescience Market	96 Tests	EUR 886

Human CRY1 ELISA Kit
EHC0575	Abclonal	96Tests	EUR 521

CRY1 ELISA KIT|Human
EF008930	Lifescience Market	96 Tests	EUR 689

Goat Cryptochrome 1 ELISA kit
E06C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cryptochrome 1 ELISA kit
E06C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cryptochrome 1 ELISA kit
E06C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cryptochrome 1 ELISA kit
E02C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cryptochrome 1 ELISA kit
E02C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cryptochrome 1 ELISA kit
E02C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cryptochrome 1 ELISA kit
E03C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cryptochrome 1 ELISA kit
E03C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cryptochrome 1 ELISA kit
E03C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cryptochrome 1 ELISA kit
E04C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cryptochrome 1 ELISA kit
E04C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cryptochrome 1 ELISA kit
E04C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cryptochrome 1 ELISA kit
E07C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cryptochrome 1 ELISA kit
E07C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cryptochrome 1 ELISA kit
E07C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cryptochrome 1 ELISA kit
E08C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cryptochrome 1 ELISA kit
E08C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cryptochrome 1 ELISA kit
E08C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cryptochrome 1 ELISA kit
E09C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cryptochrome 1 ELISA kit
E09C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cryptochrome 1 ELISA kit
E09C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cryptochrome 2 ELISA KIT|Human
EF008867	Lifescience Market	96 Tests	EUR 689

Guinea pig Cryptochrome 1 ELISA kit
E05C0568-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cryptochrome 1 ELISA kit
E05C0568-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cryptochrome 1 ELISA kit
E05C0568-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cryptochrome 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CRY1 ELISA Kit
EGTC0575	Abclonal	96Tests	EUR 521

Canine CRY1 ELISA Kit
ECC0575	Abclonal	96Tests	EUR 521

Chicken CRY1 ELISA Kit
ECKC0575	Abclonal	96Tests	EUR 521

Bovine CRY1 ELISA Kit
EBC0575	Abclonal	96Tests	EUR 521

Anserini CRY1 ELISA Kit
EAC0575	Abclonal	96Tests	EUR 521

Porcine CRY1 ELISA Kit
EPC0575	Abclonal	96Tests	EUR 521

Rat CRY1 ELISA Kit
ERC0575	Abclonal	96Tests	EUR 521

Rabbit CRY1 ELISA Kit
ERTC0575	Abclonal	96Tests	EUR 521

Sheep CRY1 ELISA Kit
ESC0575	Abclonal	96Tests	EUR 521

Mouse CRY1 ELISA Kit
EMC0575	Abclonal	96Tests	EUR 521

Monkey CRY1 ELISA Kit
EMKC0575	Abclonal	96Tests	EUR 521

Human Cryptochrome 2(CRY2) ELISA kit
E01C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cryptochrome 2(CRY2) ELISA kit
E01C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cryptochrome 2(CRY2) ELISA kit
E01C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cryptochrome- 2, CRY2 ELISA KIT
ELI-09026h	Lifescience Market	96 Tests	EUR 824

Human Cryptochrome 2 (CRY2) ELISA Kit
abx352379-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Cryptochrome 2(CRY2)ELISA Kit
QY-E00418	Qayee Biotechnology	96T	EUR 361

Cryptochrome 2 (Cryptochrome 2) Antibody
abx232008-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Guinea Pig CRY1 ELISA Kit
EGC0575	Abclonal	96Tests	EUR 521

anti- Cryptochrome 1 antibody
FNab02007	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 IF: 1:10-1:100 Immunogen: cryptochrome 1(photolyase-like) Uniprot ID: Q16526 Gene ID: 1407 Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against Cryptochrome 1

Anti-Cryptochrome 1 antibody
PAab02007	Lifescience Market	100 ug	EUR 355

ELISA kit for Human CRY2 (Cryptochrome 2)
E-EL-H5568	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CRY2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CRY2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CRY2 (Cryptochrome 2) in samples from Serum, Plasma, Cell supernatant

Goat Cryptochrome 2(CRY2) ELISA kit
E06C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cryptochrome 2(CRY2) ELISA kit
E06C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cryptochrome 2(CRY2) ELISA kit
E06C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cryptochrome 2(CRY2) ELISA kit
E02C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cryptochrome 2(CRY2) ELISA kit
E02C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cryptochrome 2(CRY2) ELISA kit
E02C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cryptochrome 2(CRY2) ELISA kit
E03C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cryptochrome 2(CRY2) ELISA kit
E03C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cryptochrome 2(CRY2) ELISA kit
E03C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cryptochrome 2(CRY2) ELISA kit
E04C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cryptochrome 2(CRY2) ELISA kit
E04C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cryptochrome 2(CRY2) ELISA kit
E04C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cryptochrome 2(CRY2) ELISA kit
E08C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cryptochrome 2(CRY2) ELISA kit
E08C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cryptochrome 2(CRY2) ELISA kit
E08C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cryptochrome 2(CRY2) ELISA kit
E09C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cryptochrome 2(CRY2) ELISA kit
E09C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cryptochrome 2(CRY2) ELISA kit
E09C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cryptochrome 2(CRY2) ELISA kit
E07C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cryptochrome 2(CRY2) ELISA kit
E07C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cryptochrome 2(CRY2) ELISA kit
E07C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Cryptochrome- 2, CRY2 ELISA KIT
ELI-33774c	Lifescience Market	96 Tests	EUR 928

Mouse Cryptochrome- 2, Cry2 ELISA KIT
ELI-47520m	Lifescience Market	96 Tests	EUR 865

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

CRY1 siRNA
20-abx901272	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRY1 Antibody
ABD8932	Lifescience Market	100 ug	EUR 438

CRY1 siRNA
20-abx912858	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRY1 siRNA
20-abx912859	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Cry1 antibody
10R-10534	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal Cry1 antibody

Cry1 antibody
10R-10535	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal Cry1 antibody

Cry1 antibody
10R-10536	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal Cry1 antibody

CRY1 Antibody
21414-100ul	SAB	100ul	EUR 252

CRY1 Antibody
21414-50ul	SAB	50ul	EUR 187

CRY1 antibody
10R-1729	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal CRY1 antibody

CRY1 antibody
20R-2489	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal CRY1 antibody

CRY1 antibody
70R-16603	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CRY1 antibody

CRY1 Antibody
DF8932	Affbiotech	200ul	EUR 304
Description: CRY1 Antibody detects endogenous levels of total CRY1.

CRY1 Antibody
1-CSB-PA006005GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CRY1. Recognizes CRY1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CRY1 Antibody
1-CSB-PA621957DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRY1. Recognizes CRY1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CRY1 Antibody
CSB-PA096933-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against CRY1. Recognizes CRY1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CRY1 Antibody
CSB-PA096933-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against CRY1. Recognizes CRY1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Human CRY1 shRNA Plasmid
20-abx950989	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CRY1 Recombinant Protein (Human)
RP008083	ABM	100 ug	Ask for price

Guinea pig Cryptochrome 2(CRY2) ELISA kit
E05C2085-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cryptochrome 2(CRY2) ELISA kit
E05C2085-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cryptochrome 2(CRY2) ELISA kit
E05C2085-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cryptochrome 2(CRY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CRY1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0511002	ABM	1.0 ug DNA	EUR 154

Cryptochrome 2 antibody
70R-4034	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Cryptochrome 2 antibody

Cryptochrome 2 Antibody
DF12919	Affbiotech	200ul	EUR 304
Description: Cryptochrome 2 Antibody detects endogenous levels of Cryptochrome 2.

anti-Cryptochrome I
YF-PA11099	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Cryptochrome I

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

CRY1 Polyclonal Antibody
ES9135-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CRY1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CRY1 Polyclonal Antibody
ES9135-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CRY1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CRY1 Polyclonal Antibody
ABP58276-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200 Applications tips:
Description: A polyclonal antibody for detection of CRY1 from Human, Mouse, Rat. This CRY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200

CRY1 Polyclonal Antibody
ABP58276-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200 Applications tips:
Description: A polyclonal antibody for detection of CRY1 from Human, Mouse, Rat. This CRY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200

CRY1 Polyclonal Antibody
ABP58276-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200 Applications tips:
Description: A polyclonal antibody for detection of CRY1 from Human, Mouse, Rat. This CRY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRY1 protein at amino acid sequence of 120-200

CRY1 Rabbit pAb
A13662-100ul	Abclonal	100 ul	EUR 308

CRY1 Rabbit pAb
A13662-200ul	Abclonal	200 ul	EUR 459

CRY1 Rabbit pAb
A13662-20ul	Abclonal	20 ul	EUR 183

CRY1 Rabbit pAb
A13662-50ul	Abclonal	50 ul	EUR 223

CRY1 Rabbit pAb
A13666-100ul	Abclonal	100 ul	EUR 308

CRY1 Rabbit pAb
A13666-200ul	Abclonal	200 ul	EUR 459

CRY1 Rabbit pAb
A13666-20ul	Abclonal	20 ul	EUR 183

CRY1 Rabbit pAb
A13666-50ul	Abclonal	50 ul	EUR 223

CRY1 Rabbit pAb
A6807-100ul	Abclonal	100 ul	EUR 308

CRY1 Rabbit pAb
A6807-200ul	Abclonal	200 ul	EUR 459

CRY1 Rabbit pAb
A6807-20ul	Abclonal	20 ul	Ask for price

CRY1 Rabbit pAb
A6807-50ul	Abclonal	50 ul	Ask for price

CRY1 Rabbit pAb
A6890-100ul	Abclonal	100 ul	EUR 308

CRY1 Rabbit pAb
A6890-200ul	Abclonal	200 ul	EUR 459

CRY1 Rabbit pAb
A6890-20ul	Abclonal	20 ul	EUR 183

CRY1 Rabbit pAb
A6890-50ul	Abclonal	50 ul	EUR 223

CRY1 Blocking Peptide
DF8932-BP	Affbiotech	1mg	EUR 195

CRY1 cloning plasmid
CSB-CL621957HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1761 Sequence: atgggggtgaacgccgtgcactggttccgaaaggggctccggctccacgacaaccccgccctgaaggagtgcattcagggcgccgacaccatccgctgcgtctacatcctggacccctggttcgccggctcctccaatgtgggcatcaacaggtggcgatttttgcttcagtgtc Show more
Description: A cloning plasmid for the CRY1 gene.

pECMV-CRY1-3
PVT17810	Lifescience Market	2 ug	EUR 258

Anti-CRY1 antibody
STJ28890	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.

Anti-CRY1 antibody
STJ28970	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.

Anti-CRY1 antibody
STJ11100001	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.

Anti-CRY1 antibody
STJ190293	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CRY1

Anti-CRY1 antibody
STJ115618	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.

Anti-CRY1 antibody
STJ115622	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

CRY1 ORF Vector (Human) (pORF)
ORF002695	ABM	1.0 ug DNA	EUR 95

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Human CRY1(Cryptochrome 1) ELISA Kit