Human SQLE(Squalene Epoxidase) ELISA Kit

Human SQLE(Squalene Epoxidase) ELISA Kit

To Order Contact us below: 

    Human Squalene Epoxidase (SQLE) ELISA Kit

    RD-SQLE-Hu-48Tests 48 Tests
    EUR 521

    Human Squalene Epoxidase (SQLE) ELISA Kit

    RD-SQLE-Hu-96Tests 96 Tests
    EUR 723

    Human Squalene Epoxidase (SQLE) ELISA Kit

    RDR-SQLE-Hu-48Tests 48 Tests
    EUR 544

    Human Squalene Epoxidase (SQLE) ELISA Kit

    RDR-SQLE-Hu-96Tests 96 Tests
    EUR 756

    Squalene Epoxidase (SQLE) Antibody

    20-abx178464
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Squalene Epoxidase (SQLE) Antibody

    20-abx174630
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    20-abx153163
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    SEH135Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    SEH135Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    SEH135Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    SEH135Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    4-SEH135Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Squalene Epoxidase elisa. Alternative names of the recognized antigen: SE
    • ERG1
    • Squalene monooxygenase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Squalene Epoxidase (SQLE) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Squalene Epoxidase ELISA Kit (SQLE)

    RK02333 96 Tests
    EUR 521

    Human Squalene Epoxidase (SQLE) Protein

    20-abx655125
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human Squalene Epoxidase (SQLE) CLIA Kit

    20-abx495379
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human SQLE (Squalene Epoxidase)

    ELK4164 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Squalene Epoxidase (SQLE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Squalene
    • Show more
    Description: A sandwich ELISA kit for detection of Squalene Epoxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Squalene Epoxidase Antibody

    20-abx115815
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    anti-Squalene Epoxidase

    YF-PA14768 50 ug
    EUR 363
    Description: Mouse polyclonal to Squalene Epoxidase

    anti-Squalene Epoxidase

    YF-PA14769 100 ug
    EUR 403
    Description: Rabbit polyclonal to Squalene Epoxidase

    Human SQLE/ Squalene monooxygenase ELISA Kit

    E2385Hu 1 Kit
    EUR 605

    Human Squalene monooxygenase, SQLE ELISA KIT

    ELI-32784h 96 Tests
    EUR 824

    Squalene Monooxygenase (SQLE) Antibody

    20-abx126641
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Squalene Monooxygenase (SQLE) Antibody

    abx238209-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Mouse Squalene monooxygenase, Sqle ELISA KIT

    ELI-26561m 96 Tests
    EUR 865

    Rat Squalene monooxygenase (SQLE) ELISA Kit

    abx392005-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Squalene monooxygenase (SQLE) ELISA Kit

    abx390641-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    ELISA kit for Human Squalene monooxygenase (SQLE)

    KTE60353-48T 48T
    EUR 332
    • Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Squalene monooxygenase (SQLE)

    KTE60353-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Squalene monooxygenase (SQLE)

    KTE60353-96T 96T
    EUR 539
    • Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Sqle ELISA Kit| Rat Squalene monooxygenase ELISA Kit

    EF019365 96 Tests
    EUR 689

    Sqle ELISA Kit| Mouse Squalene monooxygenase ELISA Kit

    EF016284 96 Tests
    EUR 689

    Sqle/ Rat Sqle ELISA Kit

    ELI-20479r 96 Tests
    EUR 886

    SQLE ELISA KIT|Human

    EF003219 96 Tests
    EUR 689

    Squalene

    HY-N1214 5mg
    EUR 108

    Squalene

    GK9974-10ML 10 ml
    EUR 46

    Squalene

    TBW01759 50mg Ask for price

    Squalene

    VAdv-Ly0007 10 mL
    EUR 1315
    Description: Squalene, a squalene-based oil-in-water nanoemulsion Vaccine adjuvant.

    SQLE ELISA Kit (Human) (OKEH07907)

    OKEH07907 96 Wells
    EUR 896
    Description: Description of target: Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086ng/mL

    SQLE ELISA Kit (Human) (OKCD01945)

    OKCD01945 96 Wells
    EUR 831
    Description: Description of target: Catalyzes the first oxygenation step in sterol biosynthesis and is suggested to be one of the rate-limiting enzymes in this pathway. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

    ELISA kit for Human Squalene synthase

    EK3894 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Squalene synthase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human FDFT1/ Squalene synthase ELISA Kit

    E0886Hu 1 Kit
    EUR 571

    Human Squalene synthase, FDFT1 ELISA KIT

    ELI-05544h 96 Tests
    EUR 824

    Human Squalene synthase (FDFT1) ELISA Kit

    abx574076-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Squalene synthase (FDFT1)

    1-CSB-EP008562HU
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 52 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Squalene synthase(FDFT1),partial expressed in E.coli

    SQLE antibody

    70R-1955 50 ug
    EUR 467
    Description: Rabbit polyclonal SQLE antibody raised against the C terminal of SQLE

    SQLE antibody

    70R-20510 50 ul
    EUR 435
    Description: Rabbit polyclonal SQLE antibody

    SQLE Antibody

    DF12063 200ul
    EUR 304
    Description: SQLE antibody detects endogenous levels of SQLE.

    SQLE Antibody

    1-CSB-PA022645GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against SQLE. Recognizes SQLE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    SQLE siRNA

    20-abx905266
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SQLE siRNA

    20-abx935115
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SQLE siRNA

    20-abx935116
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Rat Fdft1/ Squalene synthase ELISA Kit

    E0355Ra 1 Kit
    EUR 571

    Mouse Squalene synthase, Fdft1 ELISA KIT

    ELI-05541m 96 Tests
    EUR 865

    Bovine Squalene synthase, FDFT1 ELISA KIT

    ELI-05542b 96 Tests
    EUR 928

    Rat Squalene synthase, Fdft1 ELISA KIT

    ELI-05543r 96 Tests
    EUR 886

    Cow Squalene synthase (FDFT1) ELISA Kit

    abx518202-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Squalene synthase (FDFT1) ELISA Kit

    abx518204-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Squalene synthase (FDFT1) ELISA Kit

    abx518205-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Human SQLE shRNA Plasmid

    20-abx954582
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    SQLE Recombinant Protein (Human)

    RP030028 100 ug Ask for price

    SQLE Polyclonal Antibody

    30418-100ul 100ul
    EUR 252

    SQLE Polyclonal Antibody

    30418-50ul 50ul
    EUR 187

    SQLE Blocking Peptide

    33R-4493 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SQLE antibody, catalog no. 70R-1955

    SQLE Blocking Peptide

    DF12063-BP 1mg
    EUR 195

    SQLE cloning plasmid

    CSB-CL613505HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1725
    • Sequence: atgtggacttttctgggcattgccactttcacctatttttataagaagttcggggacttcatcactttggccaacagggaggtcctgttgtgcgtgctggtgttcctctcgctgggcctggtgctctcctaccgctgtcgccaccgaaacgggggtctcctcgggcgccagcaga
    • Show more
    Description: A cloning plasmid for the SQLE gene.

    SQLE Rabbit pAb

    A2428-100ul 100 ul
    EUR 308

    SQLE Rabbit pAb

    A2428-200ul 200 ul
    EUR 459

    SQLE Rabbit pAb

    A2428-20ul 20 ul
    EUR 183

    SQLE Rabbit pAb

    A2428-50ul 50 ul
    EUR 223

    anti- SQLE antibody

    FNab08209 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:200-1:2000
    • IP: 1:200-1:1000
    • IHC: 1:20-1:200
    • IF: 1:20-1:200
    • Immunogen: squalene epoxidase
    • Uniprot ID: Q14534
    • Gene ID: 6713
    • Research Area: Metabolism
    Description: Antibody raised against SQLE

    Anti-SQLE antibody

    PAab08209 100 ug
    EUR 386

    Anti-SQLE antibody

    STJ111151 100 µl
    EUR 277
    Description: Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway.

    SQLE ORF Vector (Human) (pORF)

    ORF010010 1.0 ug DNA
    EUR 95

    Mouse SQLE shRNA Plasmid

    20-abx972883
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat SQLE shRNA Plasmid

    20-abx985364
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    SQLE Polyclonal Conjugated Antibody

    C30418 100ul
    EUR 397

    SQLE Recombinant Protein (Rat)

    RP230987 100 ug Ask for price

    SQLE Recombinant Protein (Mouse)

    RP175334 100 ug Ask for price

    SQLE sgRNA CRISPR Lentivector set (Human)

    K2282801 3 x 1.0 ug
    EUR 339

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Sqle ORF Vector (Rat) (pORF)

    ORF076997 1.0 ug DNA
    EUR 506

    Sqle ORF Vector (Mouse) (pORF)

    ORF058446 1.0 ug DNA
    EUR 506

    SQLE sgRNA CRISPR Lentivector (Human) (Target 1)

    K2282802 1.0 ug DNA
    EUR 154

    SQLE sgRNA CRISPR Lentivector (Human) (Target 2)

    K2282803 1.0 ug DNA
    EUR 154

    SQLE sgRNA CRISPR Lentivector (Human) (Target 3)

    K2282804 1.0 ug DNA
    EUR 154

    SQLE Protein Vector (Human) (pPB-C-His)

    PV040037 500 ng
    EUR 329

    SQLE Protein Vector (Human) (pPB-N-His)

    PV040038 500 ng
    EUR 329

    SQLE Protein Vector (Human) (pPM-C-HA)

    PV040039 500 ng
    EUR 329

    SQLE Protein Vector (Human) (pPM-C-His)

    PV040040 500 ng
    EUR 329

    Squalene (oil-in-water nano emulsion)

    VAdv-Ly0061 10 mL
    EUR 372
    Description: Squalene, a squalene-based oil-in-water nanoemulsion vaccine adjuvant.

    Recombinant Human Squalene synthase Protein, His, E.coli-100ug

    QP6031-ec-100ug 100ug
    EUR 408

    Recombinant Human Squalene synthase Protein, His, E.coli-10ug

    QP6031-ec-10ug 10ug
    EUR 200

    Recombinant Human Squalene synthase Protein, His, E.coli-1mg

    QP6031-ec-1mg 1mg
    EUR 1632

    Recombinant Human Squalene synthase Protein, His, E.coli-200ug

    QP6031-ec-200ug 200ug
    EUR 634

    Recombinant Human Squalene synthase Protein, His, E.coli-500ug

    QP6031-ec-500ug 500ug
    EUR 1060

    Human SQLE(Squalene Epoxidase) ELISA Kit