Human SQLE(Squalene Epoxidase) ELISA Kit

Human SQLE(Squalene Epoxidase) ELISA Kit

To Order Contact us below: 

    Human Squalene Epoxidase (SQLE) ELISA Kit

    RD-SQLE-Hu-48Tests 48 Tests
    EUR 521

    Human Squalene Epoxidase (SQLE) ELISA Kit

    RD-SQLE-Hu-96Tests 96 Tests
    EUR 723

    Human Squalene Epoxidase (SQLE) ELISA Kit

    RDR-SQLE-Hu-48Tests 48 Tests
    EUR 544

    Human Squalene Epoxidase (SQLE) ELISA Kit

    RDR-SQLE-Hu-96Tests 96 Tests
    EUR 756

    Squalene Epoxidase (SQLE) Antibody

    20-abx174630
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Squalene Epoxidase (SQLE) Antibody

    20-abx178464
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    20-abx153163
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Squalene Epoxidase ELISA Kit (SQLE)

    RK02333 96 Tests
    EUR 521

    Human Squalene Epoxidase (SQLE) ELISA Kit

    SEH135Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    SEH135Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    SEH135Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    SEH135Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Squalene Epoxidase (SQLE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Squalene Epoxidase (SQLE) in Tissue homogenates, cell lysates and other biological fluids.

    Human Squalene Epoxidase (SQLE) ELISA Kit

    4-SEH135Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Squalene Epoxidase elisa. Alternative names of the recognized antigen: SE
    • ERG1
    • Squalene monooxygenase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Squalene Epoxidase (SQLE) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Squalene Epoxidase (SQLE) Protein

    20-abx655125
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human Squalene Epoxidase (SQLE) CLIA Kit

    20-abx495379
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human SQLE (Squalene Epoxidase)

    ELK4164 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Squalene Epoxidase (SQLE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Squalene
    • Show more
    Description: A sandwich ELISA kit for detection of Squalene Epoxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Squalene Epoxidase Antibody

    20-abx115815
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    anti-Squalene Epoxidase

    YF-PA14768 50 ug
    EUR 363
    Description: Mouse polyclonal to Squalene Epoxidase

    anti-Squalene Epoxidase

    YF-PA14769 100 ug
    EUR 403
    Description: Rabbit polyclonal to Squalene Epoxidase

    Human SQLE/ Squalene monooxygenase ELISA Kit

    E2385Hu 1 Kit
    EUR 605

    Human Squalene monooxygenase, SQLE ELISA KIT

    ELI-32784h 96 Tests
    EUR 824

    Mouse Squalene monooxygenase, Sqle ELISA KIT

    ELI-26561m 96 Tests
    EUR 865

    Mouse Squalene monooxygenase (SQLE) ELISA Kit

    abx390641-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Squalene monooxygenase (SQLE) ELISA Kit

    abx392005-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    ELISA kit for Human Squalene monooxygenase (SQLE)

    KTE60353-48T 48T
    EUR 332
    • Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Squalene monooxygenase (SQLE)

    KTE60353-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Squalene monooxygenase (SQLE)

    KTE60353-96T 96T
    EUR 539
    • Squalene epoxidase (EC 1.14.99.7) catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Squalene Monooxygenase (SQLE) Antibody

    20-abx126641
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Squalene Monooxygenase (SQLE) Antibody

    abx238209-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Sqle ELISA Kit| Rat Squalene monooxygenase ELISA Kit

    EF019365 96 Tests
    EUR 689

    Sqle ELISA Kit| Mouse Squalene monooxygenase ELISA Kit

    EF016284 96 Tests
    EUR 689

    Sqle/ Rat Sqle ELISA Kit

    ELI-20479r 96 Tests
    EUR 886

    SQLE ELISA KIT|Human

    EF003219 96 Tests
    EUR 689

    Squalene

    GK9974-10ML 10 ml
    EUR 46

    Squalene

    HY-N1214 5mg
    EUR 108

    Squalene

    TBW01759 50mg Ask for price

    Squalene

    VAdv-Ly0007 10 mL
    EUR 1315
    Description: Squalene, a squalene-based oil-in-water nanoemulsion Vaccine adjuvant.

    SQLE ELISA Kit (Human) (OKCD01945)

    OKCD01945 96 Wells
    EUR 831
    Description: Description of target: Catalyzes the first oxygenation step in sterol biosynthesis and is suggested to be one of the rate-limiting enzymes in this pathway. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

    SQLE ELISA Kit (Human) (OKEH07907)

    OKEH07907 96 Wells
    EUR 896
    Description: Description of target: Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086ng/mL

    Human Squalene synthase (FDFT1) ELISA Kit

    abx574076-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ELISA kit for Human Squalene synthase

    EK3894 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Squalene synthase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human FDFT1/ Squalene synthase ELISA Kit

    E0886Hu 1 Kit
    EUR 571

    Human Squalene synthase, FDFT1 ELISA KIT

    ELI-05544h 96 Tests
    EUR 824

    Cow Squalene synthase (FDFT1) ELISA Kit

    abx518202-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Squalene synthase (FDFT1) ELISA Kit

    abx518204-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Squalene synthase (FDFT1) ELISA Kit

    abx518205-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Fdft1/ Squalene synthase ELISA Kit

    E0355Ra 1 Kit
    EUR 571

    Mouse Squalene synthase, Fdft1 ELISA KIT

    ELI-05541m 96 Tests
    EUR 865

    Bovine Squalene synthase, FDFT1 ELISA KIT

    ELI-05542b 96 Tests
    EUR 928

    Rat Squalene synthase, Fdft1 ELISA KIT

    ELI-05543r 96 Tests
    EUR 886

    Human Squalene synthase (FDFT1)

    1-CSB-EP008562HU
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 52 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Squalene synthase(FDFT1),partial expressed in E.coli

    SQLE siRNA

    20-abx905266
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SQLE antibody

    70R-1955 50 ug
    EUR 467
    Description: Rabbit polyclonal SQLE antibody raised against the C terminal of SQLE

    SQLE antibody

    70R-20510 50 ul
    EUR 435
    Description: Rabbit polyclonal SQLE antibody

    SQLE siRNA

    20-abx935115
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SQLE siRNA

    20-abx935116
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SQLE Antibody

    DF12063 200ul
    EUR 304
    Description: SQLE antibody detects endogenous levels of SQLE.

    SQLE Antibody

    1-CSB-PA022645GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against SQLE. Recognizes SQLE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Human SQLE shRNA Plasmid

    20-abx954582
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    SQLE Recombinant Protein (Human)

    RP030028 100 ug Ask for price

    SQLE cloning plasmid

    CSB-CL613505HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1725
    • Sequence: atgtggacttttctgggcattgccactttcacctatttttataagaagttcggggacttcatcactttggccaacagggaggtcctgttgtgcgtgctggtgttcctctcgctgggcctggtgctctcctaccgctgtcgccaccgaaacgggggtctcctcgggcgccagcaga
    • Show more
    Description: A cloning plasmid for the SQLE gene.

    anti- SQLE antibody

    FNab08209 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:200-1:2000
    • IP: 1:200-1:1000
    • IHC: 1:20-1:200
    • IF: 1:20-1:200
    • Immunogen: squalene epoxidase
    • Uniprot ID: Q14534
    • Gene ID: 6713
    • Research Area: Metabolism
    Description: Antibody raised against SQLE

    SQLE Rabbit pAb

    A2428-50ul 50 ul
    EUR 223

    SQLE Rabbit pAb

    A2428-100ul 100 ul
    EUR 308

    SQLE Rabbit pAb

    A2428-200ul 200 ul
    EUR 459

    SQLE Rabbit pAb

    A2428-20ul 20 ul
    EUR 183

    SQLE Blocking Peptide

    33R-4493 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SQLE antibody, catalog no. 70R-1955

    SQLE Polyclonal Antibody

    30418-100ul 100ul
    EUR 252

    SQLE Polyclonal Antibody

    30418-50ul 50ul
    EUR 187

    SQLE Blocking Peptide

    DF12063-BP 1mg
    EUR 195

    Anti-SQLE antibody

    PAab08209 100 ug
    EUR 386

    Anti-SQLE antibody

    STJ111151 100 µl
    EUR 277
    Description: Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway.

    SQLE ORF Vector (Human) (pORF)

    ORF010010 1.0 ug DNA
    EUR 95

    SQLE Polyclonal Conjugated Antibody

    C30418 100ul
    EUR 397

    Rat SQLE shRNA Plasmid

    20-abx985364
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse SQLE shRNA Plasmid

    20-abx972883
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    SQLE Recombinant Protein (Rat)

    RP230987 100 ug Ask for price

    SQLE Recombinant Protein (Mouse)

    RP175334 100 ug Ask for price

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    SQLE sgRNA CRISPR Lentivector set (Human)

    K2282801 3 x 1.0 ug
    EUR 339

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    Sqle ORF Vector (Mouse) (pORF)

    ORF058446 1.0 ug DNA
    EUR 506

    Sqle ORF Vector (Rat) (pORF)

    ORF076997 1.0 ug DNA
    EUR 506

    Squalene (oil-in-water nano emulsion)

    VAdv-Ly0061 10 mL
    EUR 372
    Description: Squalene, a squalene-based oil-in-water nanoemulsion vaccine adjuvant.

    SQLE sgRNA CRISPR Lentivector (Human) (Target 1)

    K2282802 1.0 ug DNA
    EUR 154

    SQLE sgRNA CRISPR Lentivector (Human) (Target 2)

    K2282803 1.0 ug DNA
    EUR 154

    SQLE sgRNA CRISPR Lentivector (Human) (Target 3)

    K2282804 1.0 ug DNA
    EUR 154

    SQLE Protein Vector (Human) (pPB-C-His)

    PV040037 500 ng
    EUR 329

    SQLE Protein Vector (Human) (pPB-N-His)

    PV040038 500 ng
    EUR 329

    SQLE Protein Vector (Human) (pPM-C-HA)

    PV040039 500 ng
    EUR 329

    SQLE Protein Vector (Human) (pPM-C-His)

    PV040040 500 ng
    EUR 329

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Recombinant Human Squalene synthase Protein, His, E.coli-100ug

    QP6031-ec-100ug 100ug
    EUR 408

    Recombinant Human Squalene synthase Protein, His, E.coli-10ug

    QP6031-ec-10ug 10ug
    EUR 200

    Recombinant Human Squalene synthase Protein, His, E.coli-1mg

    QP6031-ec-1mg 1mg
    EUR 1632

    Recombinant Human Squalene synthase Protein, His, E.coli-200ug

    QP6031-ec-200ug 200ug
    EUR 634

    Recombinant Human Squalene synthase Protein, His, E.coli-500ug

    QP6031-ec-500ug 500ug
    EUR 1060

    Recombinant Human Squalene synthase Protein, His, E.coli-50ug

    QP6031-ec-50ug 50ug
    EUR 263

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    Sqle sgRNA CRISPR Lentivector set (Mouse)

    K3423501 3 x 1.0 ug
    EUR 339

    Sqle sgRNA CRISPR Lentivector set (Rat)

    K6811201 3 x 1.0 ug
    EUR 339

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    vWF Acty. Kit

    ABP-ACT-KIT 12 x 8 microwells
    EUR 428

    vWF Ant. Kit

    ABP-TOT-KIT 12 x 8 microwells
    EUR 394

    Squalene (oil-in-water nano emulsion);vaccine adjuvant

    AV-3020-10 10 ml
    EUR 286

    Sqle sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3423502 1.0 ug DNA
    EUR 154

    Sqle sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3423503 1.0 ug DNA
    EUR 154

    Sqle sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3423504 1.0 ug DNA
    EUR 154

    Sqle sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6811202 1.0 ug DNA
    EUR 154

    Sqle sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6811203 1.0 ug DNA
    EUR 154

    Sqle sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6811204 1.0 ug DNA
    EUR 154

    SQLE Protein Vector (Rat) (pPB-C-His)

    PV307986 500 ng
    EUR 603

    SQLE Protein Vector (Rat) (pPB-N-His)

    PV307987 500 ng
    EUR 603

    SQLE Protein Vector (Rat) (pPM-C-HA)

    PV307988 500 ng
    EUR 603

    SQLE Protein Vector (Rat) (pPM-C-His)

    PV307989 500 ng
    EUR 603

    SQLE Protein Vector (Mouse) (pPB-C-His)

    PV233782 500 ng
    EUR 603

    SQLE Protein Vector (Mouse) (pPB-N-His)

    PV233783 500 ng
    EUR 603

    SQLE Protein Vector (Mouse) (pPM-C-HA)

    PV233784 500 ng
    EUR 603

    SQLE Protein Vector (Mouse) (pPM-C-His)

    PV233785 500 ng
    EUR 603

    Sqle 3'UTR GFP Stable Cell Line

    TU169664 1.0 ml Ask for price

    Sqle 3'UTR Luciferase Stable Cell Line

    TU119664 1.0 ml Ask for price

    SQLE 3'UTR GFP Stable Cell Line

    TU074565 1.0 ml
    EUR 1394

    SQLE 3'UTR Luciferase Stable Cell Line

    TU024565 1.0 ml
    EUR 1394

    Sqle 3'UTR Luciferase Stable Cell Line

    TU221151 1.0 ml Ask for price

    Sqle 3'UTR GFP Stable Cell Line

    TU271151 1.0 ml Ask for price

    hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

    CAS620A-KIT 1 kit
    EUR 2152
    • Category: Cas9
    Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PrecisionX Multiplex gRNA Cloning Kit

    CAS9-GRNA-KIT 10 rxn
    EUR 445
    • Category: Cas9

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    SQLE sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

    K2282805 3 x 1.0 ug
    EUR 376

    SQLE Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

    LV684811 1.0 ug DNA
    EUR 682

    SQLE Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

    LV684815 1.0 ug DNA
    EUR 682

    SQLE Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

    LV684816 1.0 ug DNA
    EUR 682

    SQLE sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

    K2282806 1.0 ug DNA
    EUR 167

    SQLE sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

    K2282807 1.0 ug DNA
    EUR 167

    SQLE sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

    K2282808 1.0 ug DNA
    EUR 167

    CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

    CASCL9-100A-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Sqle sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

    K3423505 3 x 1.0 ug
    EUR 376

    Sqle sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

    K6811205 3 x 1.0 ug
    EUR 376

    Sqle sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

    K3423506 1.0 ug DNA
    EUR 167

    Sqle sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

    K3423507 1.0 ug DNA
    EUR 167

    Sqle sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

    K3423508 1.0 ug DNA
    EUR 167

    SQLE Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

    LV684812 1.0 ug DNA
    EUR 682

    SQLE Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

    LV684813 1.0 ug DNA
    EUR 740

    SQLE Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

    LV684814 1.0 ug DNA
    EUR 740

    Sqle sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

    K6811206 1.0 ug DNA
    EUR 167

    Sqle sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

    K6811207 1.0 ug DNA
    EUR 167

    Sqle sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

    K6811208 1.0 ug DNA
    EUR 167

    AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

    AP-STR-KIT-P 1/pk
    EUR 721
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Human Kit ELISA Kit

    ELA-E0121h 96 Tests
    EUR 824

    Human KIT/SCFR ELISA kit

    LF-EK50791 1×96T
    EUR 648

    KIT ELISA Kit (Human) (OKAN04574)

    OKAN04574 96 Wells
    EUR 792
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

    KIT ELISA Kit (Human) (OKCD06003)

    OKCD06003 96 Wells
    EUR 648
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

    Classical Adjuvant Combo Pak-1 (contains 10 ml each CFA (#AV-3010-10); IFA (AV-3015-10), and Squalene (#AV-3020-10)

    AV-3000-PK-1 1 pk
    EUR 225

    Human Biopterin ELISA Kit

    CELI-66011h 96 Tests
    EUR 824

    Human lipopolysaccharides ELISA Kit

    CELI-66031h 96 Tests
    EUR 824

    Human Microlbumin ELISA Kit

    abx517025-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Trypsin ELISA kit

    E01T0139-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Trypsin ELISA kit

    E01T0139-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Trypsin ELISA kit

    E01T0139-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Talin ELISA kit

    E01T0222-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Talin ELISA kit

    E01T0222-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Talin ELISA kit

    E01T0222-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thrombomodulin ELISA kit

    E01T0229-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thrombomodulin ELISA kit

    E01T0229-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thrombomodulin ELISA kit

    E01T0229-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thioredoxin ELISA kit

    E01T0336-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thioredoxin ELISA kit

    E01T0336-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thioredoxin ELISA kit

    E01T0336-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transthyretin ELISA kit

    E01T0362-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transthyretin ELISA kit

    E01T0362-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transthyretin ELISA kit

    E01T0362-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kisspeptin ELISA kit

    E01T0490-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kisspeptin ELISA kit

    E01T0490-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kisspeptin ELISA kit

    E01T0490-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tenascin ELISA kit

    E01T0523-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tenascin ELISA kit

    E01T0523-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tenascin ELISA kit

    E01T0523-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptase ELISA kit

    E01T0532-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptase ELISA kit

    E01T0532-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptase ELISA kit

    E01T0532-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tafazzin ELISA kit

    E01T0752-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tafazzin ELISA kit

    E01T0752-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tafazzin ELISA kit

    E01T0752-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transketolase ELISA kit

    E01T0759-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transketolase ELISA kit

    E01T0759-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transketolase ELISA kit

    E01T0759-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ubiquitin ELISA kit

    E01U0007-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ubiquitin ELISA kit

    E01U0007-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ubiquitin ELISA kit

    E01U0007-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urokinase ELISA kit

    E01U0010-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urokinase ELISA kit

    E01U0010-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urokinase ELISA kit

    E01U0010-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Proteinuria ELISA kit

    E01U0011-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Proteinuria ELISA kit

    E01U0011-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Proteinuria ELISA kit

    E01U0011-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Utrophin ELISA kit

    E01U0030-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Utrophin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Utrophin ELISA kit

    E01U0030-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Utrophin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Utrophin ELISA kit

    E01U0030-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Utrophin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urocortin ELISA kit

    E01U0032-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urocortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urocortin ELISA kit

    E01U0032-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urocortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urocortin ELISA kit

    E01U0032-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urocortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Uromodulin ELISA kit

    E01U0077-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Uromodulin ELISA kit

    E01U0077-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Uromodulin ELISA kit

    E01U0077-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Visfatin ELISA kit

    E01V0003-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Visfatin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Visfatin ELISA kit

    E01V0003-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Visfatin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Visfatin ELISA kit

    E01V0003-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Visfatin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vitellogenin ELISA kit

    E01V0020-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vitellogenin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human SQLE(Squalene Epoxidase) ELISA Kit