Human FLOT2(Flotillin 2) ELISA Kit

Human FLOT2(Flotillin 2) ELISA Kit

To Order Contact us below: 

Human Flotillin 2 (FLOT2) ELISA Kit
RDR-FLOT2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Flotillin 2 (FLOT2) ELISA Kit
RD-FLOT2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Flotillin 2 (FLOT2) ELISA Kit
RD-FLOT2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Flotillin 2 (FLOT2) ELISA Kit
20-abx151566	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Flotillin 2 (FLOT2) ELISA Kit
abx252470-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human FLOT2/ Flotillin-2 ELISA Kit
E0924Hu	Sunlong	1 Kit	EUR 605

Human FLOT2(Flotillin 2) ELISA Kit
EH3072	FN Test	96T	EUR 524.1
Detection range: 0.625-40 ng/ml Uniprot ID: Q14254 Alias: FLOT2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Flotillin 2 (FLOT2) ELISA Kit
abx573381-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Flotillin- 2, FLOT2 ELISA KIT
ELI-48451h	Lifescience Market	96 Tests	EUR 824

Human Flotillin 2(FLOT2)ELISA Kit
QY-E00249	Qayee Biotechnology	96T	EUR 361

Human Flotillin 2 (FLOT2) ELISA Kit
SEC480Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 2 (FLOT2) ELISA Kit
SEC480Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 2 (FLOT2) ELISA Kit
SEC480Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 2 (FLOT2) ELISA Kit
SEC480Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 2 (FLOT2) ELISA Kit
4-SEC480Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Flotillin 2 elisa. Alternative names of the recognized antigen: ECS1 ESA ESA1 M17S1 Epidermal Surface Antigen 1 Membrane Component, Chromosome 17, Surface Marker 1 35kD Protein Identified By Monoclonal Antibody ECS-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Flotillin 2 (FLOT2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Flot2/ Flotillin-2 ELISA Kit
E1069Ra	Sunlong	1 Kit	EUR 646

Mouse Flot2/ Flotillin-2 ELISA Kit
E1641Mo	Sunlong	1 Kit	EUR 632

Mouse Flotillin- 2, Flot2 ELISA KIT
ELI-30886m	Lifescience Market	96 Tests	EUR 865

Monkey Flotillin 2 (FLOT2) ELISA Kit
abx359518-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Flotillin 2 (FLOT2) ELISA Kit
abx361261-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Flotillin 2 (FLOT2) ELISA Kit
abx363175-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Flotillin 2 (FLOT2) ELISA Kit
abx356124-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Flotillin 2 (FLOT2) ELISA Kit
abx555648-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Flotillin 2 (FLOT2) ELISA Kit
abx555731-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Cow Flotillin 2 (FLOT2) ELISA Kit
abx555829-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine Flotillin- 2, FLOT2 ELISA KIT
ELI-47451b	Lifescience Market	96 Tests	EUR 928

Flotillin 2 (FLOT2) Antibody
20-abx005055	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
abx215202-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
20-abx176480	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Flotillin 2 (FLOT2) Antibody
20-abx116832	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
20-abx134110	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
abx145182-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
20-abx172450	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Flotillin 2 (FLOT2) Antibody
abx233163-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Flotillin 2 (FLOT2) Antibody
20-abx329759	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
abx330470-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
20-abx327230	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
20-abx322735	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody
abx430926-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

ELISA kit for Human FLOT2 (Flotillin 2)
E-EL-H0388	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's FLOT2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FLOT2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FLOT2 (Flotillin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human FLOT2 (Flotillin 2)
ELK4054	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Flotillin 2 (FLOT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Flotillin 2 (F Show more
Description: A sandwich ELISA kit for detection of Flotillin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Flotillin 2 (FLOT2) CLIA Kit
abx195554-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Flotillin 2 (FLOT2) CLIA Kit
20-abx493722	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Flotillin 2 (FLOT2) Protein
20-abx653439	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Guinea pig Flotillin 2 (FLOT2) ELISA Kit
abx357454-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Flot2 ELISA Kit| Rat Flotillin-2 ELISA Kit
EF018701	Lifescience Market	96 Tests	EUR 689

Flot2 ELISA Kit| Mouse Flotillin-2 ELISA Kit
EF014945	Lifescience Market	96 Tests	EUR 689

FLOT2 ELISA Kit| Bovine Flotillin-2 ELISA Kit
EF011393	Lifescience Market	96 Tests	EUR 689

Anti-Flotillin 2/FLOT2 Antibody
PA2034	BosterBio	100ug/vial	EUR 294

Anti-Flotillin 2/FLOT2 Antibody
PB9623	BosterBio	100ug/vial	EUR 334

CLIA kit for Human FLOT2 (Flotillin 2)
E-CL-H0316	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's FLOT2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FLOT2 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human FLOT2 (Flotillin 2) in samples from Serum, Plasma, Cell supernatant

Polyclonal FLOT2 / Flotillin 2 Antibody (aa95-144)
AMM05873G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FLOT2 / Flotillin 2 (aa95-144). This antibody is tested and proven to work in the following applications:

Polyclonal FLOT2 / Flotillin 2 Antibody (C-Terminus)
AMM05874G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FLOT2 / Flotillin 2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Anti-Flotillin 2 / FLOT2 (C Term) antibody
STJ70183	St John's Laboratory	100 µg	EUR 359

Polyclonal Goat Anti-Flotillin 2 / FLOT2 (C Term) Antibody
APR12096G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Flotillin 2 / FLOT2 (C Term) . This antibody is tested and proven to work in the following applications:

Flot2/ Rat Flot2 ELISA Kit
ELI-38350r	Lifescience Market	96 Tests	EUR 886

ELISA kit for Human Flotillin-2
EK5025	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Flotillin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

FLOT2 ELISA KIT|Human
EF008664	Lifescience Market	96 Tests	EUR 689

Recombinant human Flotillin-2
P1808	FN Test	100ug	Ask for price
Uniprot ID: Q14254 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Flotillin-2

FLOT2 ELISA Kit (Human) (OKCD08151)
OKCD08151	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.273ng/mL

FLOT2 ELISA Kit (Human) (OKEH03630)
OKEH03630	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: May act as a scaffolding protein within caveolar membranes, functionally participating in formation of caveolae or caveolae-like vesicles. May be involved in epidermal cell adhesion and epidermal structure and function.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.417 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Flotillin-2 antibody
22214-100ul	SAB	100ul	EUR 390

Flotillin 2 antibody
70R-12511	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal Flotillin 2 antibody

Flotillin-2 protein
E20-80124	EnoGene	20ug	EUR 408

anti-Flotillin 2
YF-PA11813	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Flotillin 2

anti-Flotillin 2
YF-PA11814	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Flotillin 2

anti-Flotillin 2
YF-PA11816	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Flotillin 2

Human Flotillin 1(FLOT1) ELISA kit
E01F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Flotillin 1(FLOT1) ELISA kit
E01F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Flotillin 1(FLOT1) ELISA kit
E01F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Flotillin 1 (FLOT1) ELISA Kit
20-abx258590	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Flotillin 1 (FLOT1) ELISA Kit
abx250621-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human FLOT1/ Flotillin-1 ELISA Kit
E0923Hu	Sunlong	1 Kit	EUR 605

ELISA kit for Human Flotillin-1
EK2906	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Flotillin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human FLOT1(Flotillin-1) ELISA Kit
EH1351	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O75955 Alias: FLOT1/Flotillin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Flotillin- 1, FLOT1 ELISA KIT
ELI-12892h	Lifescience Market	96 Tests	EUR 824

Human Flotillin-1(FLOT1) ELISA kit
CSB-EL008727HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Flotillin-1 (FLOT1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Flotillin-1(FLOT1) ELISA kit
1-CSB-EL008727HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Flotillin-1(FLOT1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Flotillin 1(FLOT1)ELISA Kit
QY-E00250	Qayee Biotechnology	96T	EUR 361

Human Flotillin 1 (FLOT1) ELISA Kit
SEF452Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 1 (FLOT1) ELISA Kit
SEF452Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 1 (FLOT1) ELISA Kit
SEF452Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 1 (FLOT1) ELISA Kit
SEF452Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 1 (FLOT1) ELISA Kit
4-SEF452Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Flotillin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Flotillin 1 (FLOT1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Flotillin-2 Polyclonal Antibody
EA257-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

Flotillin-2 Polyclonal Antibody
EA257-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

Flotillin-2 Polyclonal Antibody
ABP51354-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2 Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

Flotillin-2 Polyclonal Antibody
ABP51354-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2 Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

Flotillin-2 Polyclonal Antibody
ABP51354-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2 Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

Flotillin-2 Polyclonal Antibody
ABP57289-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Flotillin-2 Polyclonal Antibody
ABP57289-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Flotillin-2 Polyclonal Antibody
ABP57289-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Flotillin-2 Polyclonal Antibody
ES8286-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

Flotillin-2 Polyclonal Antibody
ES8286-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

Flotillin-2 Polyclonal Antibody
ES2353-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Flotillin-2 Polyclonal Antibody
ES2353-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- Flotillin 2 antibody
FNab03163	FN Test	100µg	EUR 505.25
Immunogen: flotillin 2 Uniprot ID: Q14254 Research Area: Cell Division and Proliferation, Cardiovascular
Description: Antibody raised against Flotillin 2

Anti-Flotillin 2 antibody
PAab03163	Lifescience Market	100 ug	EUR 355

Anti-Flotillin-2 antibody
STJ93092	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Flotillin-2.

Anti-Flotillin-2 antibody
STJ97500	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Flotillin-2.

Anti-Flotillin 2 (3G6)
YF-MA13089	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Flotillin 2

ELISA kit for Human FLOT1 (Flotillin 1)
ELK5386	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Flotillin 1 (FLOT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Flotillin 1 (F Show more
Description: A sandwich ELISA kit for detection of Flotillin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Flotillin-1 (FLOT1)
KTE62256-48T	Abbkine	48T	EUR 332
Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo Show more
Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Flotillin-1 (FLOT1)
KTE62256-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo Show more
Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Flotillin-1 (FLOT1)
KTE62256-96T	Abbkine	96T	EUR 539
Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo Show more
Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

FLOT2 antibody
70R-17323	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FLOT2 antibody

FLOT2 antibody
39029-100ul	SAB	100ul	EUR 252

FLOT2 Antibody
1-CSB-PA002545	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

FLOT2 Antibody
1-CSB-PA080278	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:500-1:2000

FLOT2 Antibody
1-CSB-PA619868ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

FLOT2 Antibody
CSB-PA183922-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

FLOT2 Antibody
CSB-PA183922-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

FLOT2 Antibody
1-CSB-PA008728GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FLOT2 siRNA
20-abx901983	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FLOT2 siRNA
20-abx916974	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FLOT2 siRNA
20-abx916975	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Rat Flotillin 1(FLOT1) ELISA kit
E02F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Flotillin 1(FLOT1) ELISA kit
E02F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Flotillin 1(FLOT1) ELISA kit
E02F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Flot1/ Flotillin-1 ELISA Kit
E0366Ra	Sunlong	1 Kit	EUR 646

Mouse Flotillin 1(FLOT1) ELISA kit
E03F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Flotillin 1(FLOT1) ELISA kit
E03F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Flotillin 1(FLOT1) ELISA kit
E03F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Flotillin 1(FLOT1) ELISA kit
E04F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Flotillin 1(FLOT1) ELISA kit
E04F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Flotillin 1(FLOT1) ELISA kit
E04F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Flot1/ Flotillin-1 ELISA Kit
E0545Mo	Sunlong	1 Kit	EUR 632

Goat Flotillin 1(FLOT1) ELISA kit
E06F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Flotillin 1(FLOT1) ELISA kit
E06F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Flotillin 1(FLOT1) ELISA kit
E06F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Flotillin 1(FLOT1) ELISA kit
E09F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Flotillin 1(FLOT1) ELISA kit
E09F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Flotillin 1(FLOT1) ELISA kit
E09F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Flotillin 1(FLOT1) ELISA kit
E08F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Flotillin 1(FLOT1) ELISA kit
E08F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Flotillin 1(FLOT1) ELISA kit
E08F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Flotillin- 1, Flot1 ELISA KIT
ELI-09848m	Lifescience Market	96 Tests	EUR 865

Bovine Flotillin- 1, FLOT1 ELISA KIT
ELI-30885b	Lifescience Market	96 Tests	EUR 928

Rat Flotillin- 1, Flot1 ELISA KIT
ELI-27545r	Lifescience Market	96 Tests	EUR 886

Porcine Flotillin- 1, FLOT1 ELISA KIT
ELI-07784p	Lifescience Market	96 Tests	EUR 928

Pig Flotillin 1(FLOT1) ELISA kit
E07F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Flotillin 1(FLOT1) ELISA kit
E07F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Flotillin 1(FLOT1) ELISA kit
E07F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cow Flotillin 1 (FLOT1) ELISA Kit
abx515648-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Flotillin 1 (FLOT1) ELISA Kit
abx515650-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Pig Flotillin 1 (FLOT1) ELISA Kit
abx515651-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Flotillin 1 (FLOT1) ELISA Kit
abx515652-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

FLOT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0787703	ABM	1.0 ug DNA	EUR 154

Human FLOT2 shRNA Plasmid
20-abx951624	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FLOT2 Recombinant Protein (Human)
RP012346	ABM	100 ug	Ask for price

FLOT2 Recombinant Protein (Human)
RP012349	ABM	100 ug	Ask for price

Flot1 ELISA Kit| Rat Flotillin-1 ELISA Kit
EF018700	Lifescience Market	96 Tests	EUR 689

Flot1 ELISA Kit| Mouse Flotillin-1 ELISA Kit
EF014944	Lifescience Market	96 Tests	EUR 689

FLOT1 ELISA Kit| Bovine Flotillin-1 ELISA Kit
EF011392	Lifescience Market	96 Tests	EUR 689

Human Flotillin 1 (FLOT1) CLIA Kit
20-abx494910	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Anti-human Flotillin antibody
A1510-50	Biovision		EUR 501

Anti-Flotillin 2 Rabbit Monoclonal Antibody
M06107	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Flotillin 2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Guinea pig Flotillin 1(FLOT1) ELISA kit
E05F0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Flotillin 1(FLOT1) ELISA kit
E05F0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Flotillin 1(FLOT1) ELISA kit
E05F0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ESA (FLOT2) Antibody
21603-100ul	SAB	100ul	EUR 252

ESA (FLOT2) Antibody
21603-50ul	SAB	50ul	EUR 187

FLOT2 Conjugated Antibody
C39029	SAB	100ul	EUR 397

FLOT2 cloning plasmid
CSB-CL619868HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1140 Sequence: atgacgttgcagccccgctgcgaggacgtagagacggccgagggggtagctttaactgtgacgggtgtcgcccaggtgaagatcatgacggagaaggaactcctggccgtggcttgtgagcagtttctgggtaagaatgtgcaggacatcaaaaacgtcgtcctgcagaccctgg Show more
Description: A cloning plasmid for the FLOT2 gene.

FLOT2 cloning plasmid
CSB-CL619868HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1158 Sequence: atgggcaattgccacacggtggggcccaacgaggcgctggtggtttcagggggctgttgtggttccgactataaacagtacgtgtttggcggctgggcctgggcctggtggtgtatctccgacactcagaggatttccctagagattatgacgttgcagccccgctgcgaggacg Show more
Description: A cloning plasmid for the FLOT2 gene.

FLOT2 Rabbit pAb
A6590-100ul	Abclonal	100 ul	EUR 308

FLOT2 Rabbit pAb
A6590-200ul	Abclonal	200 ul	EUR 459

FLOT2 Rabbit pAb
A6590-20ul	Abclonal	20 ul	EUR 183

FLOT2 Rabbit pAb
A6590-50ul	Abclonal	50 ul	EUR 223

Anti-FLOT2 antibody
STJ28673	St John's Laboratory	100 µl	EUR 277
Description: Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling.

Flotillin 1 Antibody
49861-100ul	SAB	100ul	EUR 333

Flotillin 1 Antibody
49861-50ul	SAB	50ul	EUR 239

Flotillin 1 Antibody
45017-100ul	SAB	100ul	EUR 252

Flotillin 1 Antibody
45017-50ul	SAB	50ul	EUR 187

Flotillin 1 Antibody
DF2923	Affbiotech	200ul	EUR 304
Description: Flotillin 1 Antibody detects endogenous levels of total Flotillin 1.

Flotillin 1 Antibody
DF12155	Affbiotech	200ul	EUR 304
Description: Flotillin 1 antibody detects endogenous levels of Flotillin 1.

Flotillin 1 Antibody
ABD2923	Lifescience Market	100 ug	EUR 438

anti-Flotillin 1
YF-PA16791	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Flotillin 1

FLOT2 ORF Vector (Human) (pORF)
ORF004116	ABM	1.0 ug DNA	EUR 95

FLOT2 ORF Vector (Human) (pORF)
ORF004117	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Flot2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7005203	ABM	1.0 ug DNA	EUR 154

Flot2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3813803	ABM	1.0 ug DNA	EUR 154

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat FLOT2 shRNA Plasmid
20-abx986848	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ESA (FLOT2) Conjugated Antibody
C21603	SAB	100ul	EUR 397

Mouse FLOT2 shRNA Plasmid
20-abx970367	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FLOT2 Recombinant Protein (Rat)
RP201533	ABM	100 ug	Ask for price

FLOT2 Recombinant Protein (Mouse)
RP134792	ABM	100 ug	Ask for price

FLOT2 Recombinant Protein (Mouse)
RP134795	ABM	100 ug	Ask for price

FLOT2 sgRNA CRISPR Lentivector set (Human)
K0787701	ABM	3 x 1.0 ug	EUR 339

Flotillin 1 Blocking Peptide
DF2923-BP	Affbiotech	1mg	EUR 195

Flotillin 1 Blocking Peptide
DF12155-BP	Affbiotech	1mg	EUR 195

Flotillin 1 (FLOT1) Antibody
20-abx004751	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Flotillin 1 (FLOT1) Antibody
20-abx116831	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Flotillin 1 (FLOT1) Antibody
abx146106-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Flotillin 1 (FLOT1) Antibody
20-abx141820	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Flotillin 1 Conjugated Antibody
C49861	SAB	100ul	EUR 397

Flotillin 1 Conjugated Antibody
C45017	SAB	100ul	EUR 397

Flotillin- 1 Mouse mAb
BF9217	Lifescience Market	100 ug	EUR 438

Flotillin 1 (FLOT1) Antibody
20-abx338908	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Flotillin 1 (FLOT1) Antibody
abx233162-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Flotillin 1 (FLOT1) Antibody
abx431256-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Flotillin-1 Monoclonal Antibody
ABM40157-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

Flotillin-1 Monoclonal Antibody
ABM40157-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

Flotillin-1 Monoclonal Antibody
ABM40157-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

Flotillin 1 Rabbit mAb
A3023-100ul	Abclonal	100 ul	EUR 410

Flotillin 1 Rabbit mAb
A3023-200ul	Abclonal	200 ul	EUR 571

Flotillin 1 Rabbit mAb
A3023-20ul	Abclonal	20 ul	EUR 221

Flotillin 1 Rabbit mAb
A3023-50ul	Abclonal	50 ul	EUR 287

Flotillin-1 Monoclonal Antibody
EM1157-100ul	ELK Biotech	100ul	EUR 279
Description: A Mouse Monoclonal antibody against Flotillin-1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

Flotillin-1 Monoclonal Antibody
EM1157-50ul	ELK Biotech	50ul	EUR 207
Description: A Mouse Monoclonal antibody against Flotillin-1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

anti- Flotillin 1 antibody
FNab03162	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1500-1:2000 IF: 1:10-1:100 Immunogen: flotillin 1 Uniprot ID: O75955 Gene ID: 10211 Research Area: Cell Division and Proliferation, Cardiovascular
Description: Antibody raised against Flotillin 1

Anti-Flotillin 1 antibody
PAab03162	Lifescience Market	100 ug	EUR 355

Anti-Flotillin-1 antibody
STJ97059	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to Flotillin-1.

Anti-Flotillin 1 antibody
STJ70184	St John's Laboratory	100 µg	EUR 359

Anti-Flotillin 1 (4A1)
YF-MA17192	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to Flotillin 1

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Human Fibrinogen (FBG) AssayMax ELISA Kit
EF1040-2	AssayPro	96 Well Plate	EUR 396

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Dr. P Kit-Solution 2
K2021010-2	Biochain	6 ml	EUR 120
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Polyclonal FLOT2 Antibody (C-Term)
AMM05875G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FLOT2 (C-Term). This antibody is tested and proven to work in the following applications:

Flot2 ORF Vector (Rat) (pORF)
ORF067179	ABM	1.0 ug DNA	EUR 506

Flot2 ORF Vector (Mouse) (pORF)
ORF044932	ABM	1.0 ug DNA	EUR 506

Flot2 ORF Vector (Mouse) (pORF)
ORF044933	ABM	1.0 ug DNA	EUR 506

FLOT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0787702	ABM	1.0 ug DNA	EUR 154

FLOT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0787704	ABM	1.0 ug DNA	EUR 154

FLOT2 Protein Vector (Human) (pPB-C-His)
PV016461	ABM	500 ng	EUR 329

FLOT2 Protein Vector (Human) (pPB-N-His)
PV016462	ABM	500 ng	EUR 329

FLOT2 Protein Vector (Human) (pPM-C-HA)
PV016463	ABM	500 ng	EUR 329

FLOT2 Protein Vector (Human) (pPM-C-His)
PV016464	ABM	500 ng	EUR 329

FLOT2 Protein Vector (Human) (pPB-C-His)
PV016465	ABM	500 ng	EUR 329

FLOT2 Protein Vector (Human) (pPB-N-His)
PV016466	ABM	500 ng	EUR 329

FLOT2 Protein Vector (Human) (pPM-C-HA)
PV016467	ABM	500 ng	EUR 329

FLOT2 Protein Vector (Human) (pPM-C-His)
PV016468	ABM	500 ng	EUR 329

FLOT2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0787707	ABM	1.0 ug DNA	EUR 167

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human FLOT2(Flotillin 2) ELISA Kit