Human FLOT2(Flotillin 2) ELISA Kit

Human FLOT2(Flotillin 2) ELISA Kit

To Order Contact us below: 

Human Flotillin 2 (FLOT2) ELISA Kit

RDR-FLOT2-Hu-96Tests 96 Tests
EUR 756

Human Flotillin 2 (FLOT2) ELISA Kit

RD-FLOT2-Hu-48Tests 48 Tests
EUR 521

Human Flotillin 2 (FLOT2) ELISA Kit

RD-FLOT2-Hu-96Tests 96 Tests
EUR 723

Human Flotillin 2 (FLOT2) ELISA Kit

20-abx151566
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Flotillin 2 (FLOT2) ELISA Kit

abx252470-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human FLOT2/ Flotillin-2 ELISA Kit

E0924Hu 1 Kit
EUR 605

Human FLOT2(Flotillin 2) ELISA Kit

EH3072 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q14254
  • Alias: FLOT2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Flotillin 2 (FLOT2) ELISA Kit

abx573381-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Flotillin- 2, FLOT2 ELISA KIT

ELI-48451h 96 Tests
EUR 824

Human Flotillin 2(FLOT2)ELISA Kit

QY-E00249 96T
EUR 361

Human Flotillin 2 (FLOT2) ELISA Kit

SEC480Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 2 (FLOT2) ELISA Kit

SEC480Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 2 (FLOT2) ELISA Kit

SEC480Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 2 (FLOT2) ELISA Kit

SEC480Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 2 (FLOT2) ELISA Kit

4-SEC480Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Flotillin 2 elisa. Alternative names of the recognized antigen: ECS1
  • ESA
  • ESA1
  • M17S1
  • Epidermal Surface Antigen 1
  • Membrane Component, Chromosome 17, Surface Marker 1
  • 35kD Protein Identified By Monoclonal Antibody ECS-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Flotillin 2 (FLOT2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Flot2/ Flotillin-2 ELISA Kit

E1069Ra 1 Kit
EUR 646

Mouse Flot2/ Flotillin-2 ELISA Kit

E1641Mo 1 Kit
EUR 632

Mouse Flotillin- 2, Flot2 ELISA KIT

ELI-30886m 96 Tests
EUR 865

Monkey Flotillin 2 (FLOT2) ELISA Kit

abx359518-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Flotillin 2 (FLOT2) ELISA Kit

abx361261-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Flotillin 2 (FLOT2) ELISA Kit

abx363175-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Flotillin 2 (FLOT2) ELISA Kit

abx356124-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Flotillin 2 (FLOT2) ELISA Kit

abx555648-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Flotillin 2 (FLOT2) ELISA Kit

abx555731-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Cow Flotillin 2 (FLOT2) ELISA Kit

abx555829-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine Flotillin- 2, FLOT2 ELISA KIT

ELI-47451b 96 Tests
EUR 928

Flotillin 2 (FLOT2) Antibody

20-abx005055
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

abx215202-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

20-abx176480
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Flotillin 2 (FLOT2) Antibody

20-abx116832
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

20-abx134110
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

abx145182-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

20-abx172450
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Flotillin 2 (FLOT2) Antibody

abx233163-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Flotillin 2 (FLOT2) Antibody

20-abx329759
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

abx330470-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

20-abx327230
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

20-abx322735
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Flotillin 2 (FLOT2) Antibody

abx430926-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

ELISA kit for Human FLOT2 (Flotillin 2)

E-EL-H0388 1 plate of 96 wells
EUR 534
  • Gentaur's FLOT2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FLOT2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FLOT2 (Flotillin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human FLOT2 (Flotillin 2)

ELK4054 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Flotillin 2 (FLOT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Flotillin 2 (F
  • Show more
Description: A sandwich ELISA kit for detection of Flotillin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Flotillin 2 (FLOT2) CLIA Kit

abx195554-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Flotillin 2 (FLOT2) CLIA Kit

20-abx493722
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Flotillin 2 (FLOT2) Protein

20-abx653439
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Guinea pig Flotillin 2 (FLOT2) ELISA Kit

abx357454-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Flot2 ELISA Kit| Rat Flotillin-2 ELISA Kit

EF018701 96 Tests
EUR 689

Flot2 ELISA Kit| Mouse Flotillin-2 ELISA Kit

EF014945 96 Tests
EUR 689

FLOT2 ELISA Kit| Bovine Flotillin-2 ELISA Kit

EF011393 96 Tests
EUR 689

Anti-Flotillin 2/FLOT2 Antibody

PA2034 100ug/vial
EUR 294

Anti-Flotillin 2/FLOT2 Antibody

PB9623 100ug/vial
EUR 334

CLIA kit for Human FLOT2 (Flotillin 2)

E-CL-H0316 1 plate of 96 wells
EUR 584
  • Gentaur's FLOT2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FLOT2 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human FLOT2 (Flotillin 2) in samples from Serum, Plasma, Cell supernatant

Polyclonal FLOT2 / Flotillin 2 Antibody (aa95-144)

AMM05873G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FLOT2 / Flotillin 2 (aa95-144). This antibody is tested and proven to work in the following applications:

Polyclonal FLOT2 / Flotillin 2 Antibody (C-Terminus)

AMM05874G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FLOT2 / Flotillin 2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Anti-Flotillin 2 / FLOT2 (C Term) antibody

STJ70183 100 µg
EUR 359

Polyclonal Goat Anti-Flotillin 2 / FLOT2 (C Term) Antibody

APR12096G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Flotillin 2 / FLOT2 (C Term) . This antibody is tested and proven to work in the following applications:

Flot2/ Rat Flot2 ELISA Kit

ELI-38350r 96 Tests
EUR 886

ELISA kit for Human Flotillin-2

EK5025 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Flotillin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

FLOT2 ELISA KIT|Human

EF008664 96 Tests
EUR 689

Recombinant human Flotillin-2

P1808 100ug Ask for price
  • Uniprot ID: Q14254
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Flotillin-2

FLOT2 ELISA Kit (Human) (OKCD08151)

OKCD08151 96 Wells
EUR 975
Description: Description of target: Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.273ng/mL

FLOT2 ELISA Kit (Human) (OKEH03630)

OKEH03630 96 Wells
EUR 779
Description: Description of target: May act as a scaffolding protein within caveolar membranes, functionally participating in formation of caveolae or caveolae-like vesicles. May be involved in epidermal cell adhesion and epidermal structure and function.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.417 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Flotillin-2 antibody

22214-100ul 100ul
EUR 390

Flotillin 2 antibody

70R-12511 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal Flotillin 2 antibody

Flotillin-2 protein

E20-80124 20ug
EUR 408

anti-Flotillin 2

YF-PA11813 50 ul
EUR 363
Description: Mouse polyclonal to Flotillin 2

anti-Flotillin 2

YF-PA11814 50 ug
EUR 363
Description: Mouse polyclonal to Flotillin 2

anti-Flotillin 2

YF-PA11816 50 ug
EUR 363
Description: Mouse polyclonal to Flotillin 2

Human Flotillin 1(FLOT1) ELISA kit

E01F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Flotillin 1(FLOT1) ELISA kit

E01F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Flotillin 1(FLOT1) ELISA kit

E01F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Flotillin 1 (FLOT1) ELISA Kit

20-abx258590
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Flotillin 1 (FLOT1) ELISA Kit

abx250621-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human FLOT1/ Flotillin-1 ELISA Kit

E0923Hu 1 Kit
EUR 605

ELISA kit for Human Flotillin-1

EK2906 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Flotillin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human FLOT1(Flotillin-1) ELISA Kit

EH1351 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O75955
  • Alias: FLOT1/Flotillin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Flotillin- 1, FLOT1 ELISA KIT

ELI-12892h 96 Tests
EUR 824

Human Flotillin-1(FLOT1) ELISA kit

CSB-EL008727HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Flotillin-1 (FLOT1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Flotillin-1(FLOT1) ELISA kit

1-CSB-EL008727HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Flotillin-1(FLOT1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Flotillin 1(FLOT1)ELISA Kit

QY-E00250 96T
EUR 361

Human Flotillin 1 (FLOT1) ELISA Kit

SEF452Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 1 (FLOT1) ELISA Kit

SEF452Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 1 (FLOT1) ELISA Kit

SEF452Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 1 (FLOT1) ELISA Kit

SEF452Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Flotillin 1 (FLOT1) ELISA Kit

4-SEF452Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Flotillin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Flotillin 1 (FLOT1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Flotillin-2 Polyclonal Antibody

EA257-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

Flotillin-2 Polyclonal Antibody

EA257-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

Flotillin-2 Polyclonal Antibody

ABP51354-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

Flotillin-2 Polyclonal Antibody

ABP51354-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

Flotillin-2 Polyclonal Antibody

ABP51354-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

Flotillin-2 Polyclonal Antibody

ABP57289-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Flotillin-2 Polyclonal Antibody

ABP57289-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Flotillin-2 Polyclonal Antibody

ABP57289-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Flotillin-2 Polyclonal Antibody

ES8286-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

Flotillin-2 Polyclonal Antibody

ES8286-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

Flotillin-2 Polyclonal Antibody

ES2353-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Flotillin-2 Polyclonal Antibody

ES2353-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- Flotillin 2 antibody

FNab03163 100µg
EUR 505.25
  • Immunogen: flotillin 2
  • Uniprot ID: Q14254
  • Research Area: Cell Division and Proliferation, Cardiovascular
Description: Antibody raised against Flotillin 2

Anti-Flotillin 2 antibody

PAab03163 100 ug
EUR 355

Anti-Flotillin-2 antibody

STJ93092 200 µl
EUR 197
Description: Rabbit polyclonal to Flotillin-2.

Anti-Flotillin-2 antibody

STJ97500 200 µl
EUR 197
Description: Rabbit polyclonal to Flotillin-2.

Anti-Flotillin 2 (3G6)

YF-MA13089 100 ug
EUR 363
Description: Mouse monoclonal to Flotillin 2

ELISA kit for Human FLOT1 (Flotillin 1)

ELK5386 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Flotillin 1 (FLOT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Flotillin 1 (F
  • Show more
Description: A sandwich ELISA kit for detection of Flotillin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Flotillin-1 (FLOT1)

KTE62256-48T 48T
EUR 332
  • Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Flotillin-1 (FLOT1)

KTE62256-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Flotillin-1 (FLOT1)

KTE62256-96T 96T
EUR 539
  • Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

FLOT2 antibody

70R-17323 50 ul
EUR 435
Description: Rabbit polyclonal FLOT2 antibody

FLOT2 antibody

39029-100ul 100ul
EUR 252

FLOT2 Antibody

1-CSB-PA002545
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

FLOT2 Antibody

1-CSB-PA080278
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:500-1:2000

FLOT2 Antibody

1-CSB-PA619868ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

FLOT2 Antibody

CSB-PA183922-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

FLOT2 Antibody

CSB-PA183922-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

FLOT2 Antibody

1-CSB-PA008728GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FLOT2 siRNA

20-abx901983
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLOT2 siRNA

20-abx916974
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLOT2 siRNA

20-abx916975
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rat Flotillin 1(FLOT1) ELISA kit

E02F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Flotillin 1(FLOT1) ELISA kit

E02F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Flotillin 1(FLOT1) ELISA kit

E02F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Flot1/ Flotillin-1 ELISA Kit

E0366Ra 1 Kit
EUR 646

Mouse Flotillin 1(FLOT1) ELISA kit

E03F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Flotillin 1(FLOT1) ELISA kit

E03F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Flotillin 1(FLOT1) ELISA kit

E03F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Flotillin 1(FLOT1) ELISA kit

E04F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Flotillin 1(FLOT1) ELISA kit

E04F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Flotillin 1(FLOT1) ELISA kit

E04F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Flot1/ Flotillin-1 ELISA Kit

E0545Mo 1 Kit
EUR 632

Goat Flotillin 1(FLOT1) ELISA kit

E06F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Flotillin 1(FLOT1) ELISA kit

E06F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Flotillin 1(FLOT1) ELISA kit

E06F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Flotillin 1(FLOT1) ELISA kit

E09F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Flotillin 1(FLOT1) ELISA kit

E09F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Flotillin 1(FLOT1) ELISA kit

E09F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Flotillin 1(FLOT1) ELISA kit

E08F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Flotillin 1(FLOT1) ELISA kit

E08F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Flotillin 1(FLOT1) ELISA kit

E08F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Flotillin- 1, Flot1 ELISA KIT

ELI-09848m 96 Tests
EUR 865

Bovine Flotillin- 1, FLOT1 ELISA KIT

ELI-30885b 96 Tests
EUR 928

Rat Flotillin- 1, Flot1 ELISA KIT

ELI-27545r 96 Tests
EUR 886

Porcine Flotillin- 1, FLOT1 ELISA KIT

ELI-07784p 96 Tests
EUR 928

Pig Flotillin 1(FLOT1) ELISA kit

E07F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Flotillin 1(FLOT1) ELISA kit

E07F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Flotillin 1(FLOT1) ELISA kit

E07F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cow Flotillin 1 (FLOT1) ELISA Kit

abx515648-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Flotillin 1 (FLOT1) ELISA Kit

abx515650-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Pig Flotillin 1 (FLOT1) ELISA Kit

abx515651-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Flotillin 1 (FLOT1) ELISA Kit

abx515652-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

FLOT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0787703 1.0 ug DNA
EUR 154

Human FLOT2 shRNA Plasmid

20-abx951624
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FLOT2 Recombinant Protein (Human)

RP012346 100 ug Ask for price

FLOT2 Recombinant Protein (Human)

RP012349 100 ug Ask for price

Flot1 ELISA Kit| Rat Flotillin-1 ELISA Kit

EF018700 96 Tests
EUR 689

Flot1 ELISA Kit| Mouse Flotillin-1 ELISA Kit

EF014944 96 Tests
EUR 689

FLOT1 ELISA Kit| Bovine Flotillin-1 ELISA Kit

EF011392 96 Tests
EUR 689

Human Flotillin 1 (FLOT1) CLIA Kit

20-abx494910
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Anti-human Flotillin antibody

A1510-50
EUR 501

Anti-Flotillin 2 Rabbit Monoclonal Antibody

M06107 100ug/vial
EUR 397
Description: Rabbit Monoclonal Flotillin 2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Guinea pig Flotillin 1(FLOT1) ELISA kit

E05F0369-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Flotillin 1(FLOT1) ELISA kit

E05F0369-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Flotillin 1(FLOT1) ELISA kit

E05F0369-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ESA (FLOT2) Antibody

21603-100ul 100ul
EUR 252

ESA (FLOT2) Antibody

21603-50ul 50ul
EUR 187

FLOT2 Conjugated Antibody

C39029 100ul
EUR 397

FLOT2 cloning plasmid

CSB-CL619868HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Sequence: atgacgttgcagccccgctgcgaggacgtagagacggccgagggggtagctttaactgtgacgggtgtcgcccaggtgaagatcatgacggagaaggaactcctggccgtggcttgtgagcagtttctgggtaagaatgtgcaggacatcaaaaacgtcgtcctgcagaccctgg
  • Show more
Description: A cloning plasmid for the FLOT2 gene.

FLOT2 cloning plasmid

CSB-CL619868HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1158
  • Sequence: atgggcaattgccacacggtggggcccaacgaggcgctggtggtttcagggggctgttgtggttccgactataaacagtacgtgtttggcggctgggcctgggcctggtggtgtatctccgacactcagaggatttccctagagattatgacgttgcagccccgctgcgaggacg
  • Show more
Description: A cloning plasmid for the FLOT2 gene.

FLOT2 Rabbit pAb

A6590-100ul 100 ul
EUR 308

FLOT2 Rabbit pAb

A6590-200ul 200 ul
EUR 459

FLOT2 Rabbit pAb

A6590-20ul 20 ul
EUR 183

FLOT2 Rabbit pAb

A6590-50ul 50 ul
EUR 223

Anti-FLOT2 antibody

STJ28673 100 µl
EUR 277
Description: Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling.

Flotillin 1 Antibody

49861-100ul 100ul
EUR 333

Flotillin 1 Antibody

49861-50ul 50ul
EUR 239

Flotillin 1 Antibody

45017-100ul 100ul
EUR 252

Flotillin 1 Antibody

45017-50ul 50ul
EUR 187

Flotillin 1 Antibody

DF2923 200ul
EUR 304
Description: Flotillin 1 Antibody detects endogenous levels of total Flotillin 1.

Flotillin 1 Antibody

DF12155 200ul
EUR 304
Description: Flotillin 1 antibody detects endogenous levels of Flotillin 1.

Flotillin 1 Antibody

ABD2923 100 ug
EUR 438

anti-Flotillin 1

YF-PA16791 100 ug
EUR 403
Description: Rabbit polyclonal to Flotillin 1

FLOT2 ORF Vector (Human) (pORF)

ORF004116 1.0 ug DNA
EUR 95

FLOT2 ORF Vector (Human) (pORF)

ORF004117 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Flot2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7005203 1.0 ug DNA
EUR 154

Flot2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3813803 1.0 ug DNA
EUR 154

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Rat FLOT2 shRNA Plasmid

20-abx986848
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ESA (FLOT2) Conjugated Antibody

C21603 100ul
EUR 397

Mouse FLOT2 shRNA Plasmid

20-abx970367
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FLOT2 Recombinant Protein (Rat)

RP201533 100 ug Ask for price

FLOT2 Recombinant Protein (Mouse)

RP134792 100 ug Ask for price

FLOT2 Recombinant Protein (Mouse)

RP134795 100 ug Ask for price

FLOT2 sgRNA CRISPR Lentivector set (Human)

K0787701 3 x 1.0 ug
EUR 339

Flotillin 1 Blocking Peptide

DF2923-BP 1mg
EUR 195

Flotillin 1 Blocking Peptide

DF12155-BP 1mg
EUR 195

Flotillin 1 (FLOT1) Antibody

20-abx004751
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Flotillin 1 (FLOT1) Antibody

20-abx116831
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Flotillin 1 (FLOT1) Antibody

abx146106-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Flotillin 1 (FLOT1) Antibody

20-abx141820
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Flotillin 1 Conjugated Antibody

C49861 100ul
EUR 397

Flotillin 1 Conjugated Antibody

C45017 100ul
EUR 397

Flotillin- 1 Mouse mAb

BF9217 100 ug
EUR 438

Flotillin 1 (FLOT1) Antibody

20-abx338908
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Flotillin 1 (FLOT1) Antibody

abx233162-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Flotillin 1 (FLOT1) Antibody

abx431256-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Flotillin-1 Monoclonal Antibody

ABM40157-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

Flotillin-1 Monoclonal Antibody

ABM40157-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

Flotillin-1 Monoclonal Antibody

ABM40157-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

Flotillin 1 Rabbit mAb

A3023-100ul 100 ul
EUR 410

Flotillin 1 Rabbit mAb

A3023-200ul 200 ul
EUR 571

Flotillin 1 Rabbit mAb

A3023-20ul 20 ul
EUR 221

Flotillin 1 Rabbit mAb

A3023-50ul 50 ul
EUR 287

Flotillin-1 Monoclonal Antibody

EM1157-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against Flotillin-1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

Flotillin-1 Monoclonal Antibody

EM1157-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against Flotillin-1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

anti- Flotillin 1 antibody

FNab03162 100µg
EUR 505.25
  • Recommended dilution: WB: 1500-1:2000
  • IF: 1:10-1:100
  • Immunogen: flotillin 1
  • Uniprot ID: O75955
  • Gene ID: 10211
  • Research Area: Cell Division and Proliferation, Cardiovascular
Description: Antibody raised against Flotillin 1

Anti-Flotillin 1 antibody

PAab03162 100 ug
EUR 355

Anti-Flotillin-1 antibody

STJ97059 200 µl
EUR 197
Description: Mouse monoclonal to Flotillin-1.

Anti-Flotillin 1 antibody

STJ70184 100 µg
EUR 359

Anti-Flotillin 1 (4A1)

YF-MA17192 200 ul
EUR 363
Description: Mouse monoclonal to Flotillin 1

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Human Fibrinogen (FBG) AssayMax ELISA Kit

EF1040-2 96 Well Plate
EUR 396

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Dr. P Kit-Solution 2

K2021010-2 6 ml
EUR 120
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Polyclonal FLOT2 Antibody (C-Term)

AMM05875G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FLOT2 (C-Term). This antibody is tested and proven to work in the following applications:

Flot2 ORF Vector (Rat) (pORF)

ORF067179 1.0 ug DNA
EUR 506

Flot2 ORF Vector (Mouse) (pORF)

ORF044932 1.0 ug DNA
EUR 506

Flot2 ORF Vector (Mouse) (pORF)

ORF044933 1.0 ug DNA
EUR 506

FLOT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0787702 1.0 ug DNA
EUR 154

FLOT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0787704 1.0 ug DNA
EUR 154

FLOT2 Protein Vector (Human) (pPB-C-His)

PV016461 500 ng
EUR 329

FLOT2 Protein Vector (Human) (pPB-N-His)

PV016462 500 ng
EUR 329

FLOT2 Protein Vector (Human) (pPM-C-HA)

PV016463 500 ng
EUR 329

FLOT2 Protein Vector (Human) (pPM-C-His)

PV016464 500 ng
EUR 329

FLOT2 Protein Vector (Human) (pPB-C-His)

PV016465 500 ng
EUR 329

FLOT2 Protein Vector (Human) (pPB-N-His)

PV016466 500 ng
EUR 329

FLOT2 Protein Vector (Human) (pPM-C-HA)

PV016467 500 ng
EUR 329

FLOT2 Protein Vector (Human) (pPM-C-His)

PV016468 500 ng
EUR 329

FLOT2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0787707 1.0 ug DNA
EUR 167

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human FLOT2(Flotillin 2) ELISA Kit