Human FLOT2(Flotillin 2) ELISA Kit

Human FLOT2(Flotillin 2) ELISA Kit

To Order Contact us below: 

    Human Flotillin 2 (FLOT2) ELISA Kit

    RDR-FLOT2-Hu-96Tests 96 Tests
    EUR 756

    Human Flotillin 2 (FLOT2) ELISA Kit

    RD-FLOT2-Hu-48Tests 48 Tests
    EUR 521

    Human Flotillin 2 (FLOT2) ELISA Kit

    RD-FLOT2-Hu-96Tests 96 Tests
    EUR 723

    Human Flotillin 2 (FLOT2) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Flotillin 2 (FLOT2) ELISA Kit

    abx252470-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human FLOT2/ Flotillin-2 ELISA Kit

    E0924Hu 1 Kit
    EUR 605

    Human FLOT2(Flotillin 2) ELISA Kit

    EH3072 96T
    EUR 524.1
    • Detection range: 0.625-40 ng/ml
    • Uniprot ID: Q14254
    • Alias: FLOT2
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

    Human Flotillin 2 (FLOT2) ELISA Kit

    abx573381-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Flotillin- 2, FLOT2 ELISA KIT

    ELI-48451h 96 Tests
    EUR 824

    Human Flotillin 2(FLOT2)ELISA Kit

    QY-E00249 96T
    EUR 361

    Human Flotillin 2 (FLOT2) ELISA Kit

    SEC480Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Flotillin 2 (FLOT2) ELISA Kit

    SEC480Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Flotillin 2 (FLOT2) ELISA Kit

    SEC480Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Flotillin 2 (FLOT2) ELISA Kit

    SEC480Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 2 (FLOT2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 2 (FLOT2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Flotillin 2 (FLOT2) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Flotillin 2 elisa. Alternative names of the recognized antigen: ECS1
    • ESA
    • ESA1
    • M17S1
    • Epidermal Surface Antigen 1
    • Membrane Component, Chromosome 17, Surface Marker 1
    • 35kD Protein Identified By Monoclonal Antibody ECS-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Flotillin 2 (FLOT2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Rat Flot2/ Flotillin-2 ELISA Kit

    E1069Ra 1 Kit
    EUR 646

    Mouse Flot2/ Flotillin-2 ELISA Kit

    E1641Mo 1 Kit
    EUR 632

    Mouse Flotillin- 2, Flot2 ELISA KIT

    ELI-30886m 96 Tests
    EUR 865

    Monkey Flotillin 2 (FLOT2) ELISA Kit

    abx359518-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Pig Flotillin 2 (FLOT2) ELISA Kit

    abx361261-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Rabbit Flotillin 2 (FLOT2) ELISA Kit

    abx363175-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Chicken Flotillin 2 (FLOT2) ELISA Kit

    abx356124-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Mouse Flotillin 2 (FLOT2) ELISA Kit

    abx555648-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Rat Flotillin 2 (FLOT2) ELISA Kit

    abx555731-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Cow Flotillin 2 (FLOT2) ELISA Kit

    abx555829-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Bovine Flotillin- 2, FLOT2 ELISA KIT

    ELI-47451b 96 Tests
    EUR 928

    Flotillin 2 (FLOT2) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    abx215202-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Flotillin 2 (FLOT2) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    • EUR 356.00
    • EUR 537.00
    • EUR 217.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    abx145182-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Flotillin 2 (FLOT2) Antibody

    abx233163-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Flotillin 2 (FLOT2) Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    abx330470-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Flotillin 2 (FLOT2) Antibody

    abx430926-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    ELISA kit for Human FLOT2 (Flotillin 2)

    E-EL-H0388 1 plate of 96 wells
    EUR 534
    • Gentaur's FLOT2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FLOT2. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human FLOT2 (Flotillin 2) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Human FLOT2 (Flotillin 2)

    ELK4054 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Flotillin 2 (FLOT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Flotillin 2 (F
    • Show more
    Description: A sandwich ELISA kit for detection of Flotillin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Flotillin 2 (FLOT2) CLIA Kit

    abx195554-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Flotillin 2 (FLOT2) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Flotillin 2 (FLOT2) Protein

    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Guinea pig Flotillin 2 (FLOT2) ELISA Kit

    abx357454-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Flot2 ELISA Kit| Rat Flotillin-2 ELISA Kit

    EF018701 96 Tests
    EUR 689

    Flot2 ELISA Kit| Mouse Flotillin-2 ELISA Kit

    EF014945 96 Tests
    EUR 689

    FLOT2 ELISA Kit| Bovine Flotillin-2 ELISA Kit

    EF011393 96 Tests
    EUR 689

    Anti-Flotillin 2/FLOT2 Antibody

    PA2034 100ug/vial
    EUR 294

    Anti-Flotillin 2/FLOT2 Antibody

    PB9623 100ug/vial
    EUR 334

    CLIA kit for Human FLOT2 (Flotillin 2)

    E-CL-H0316 1 plate of 96 wells
    EUR 584
    • Gentaur's FLOT2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FLOT2 . Standards or samples are added to the micro CLIA plate wells and combined with th
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Human FLOT2 (Flotillin 2) in samples from Serum, Plasma, Cell supernatant

    Polyclonal FLOT2 / Flotillin 2 Antibody (aa95-144)

    AMM05873G 0.05ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FLOT2 / Flotillin 2 (aa95-144). This antibody is tested and proven to work in the following applications:

    Polyclonal FLOT2 / Flotillin 2 Antibody (C-Terminus)

    AMM05874G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FLOT2 / Flotillin 2 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Anti-Flotillin 2 / FLOT2 (C Term) antibody

    STJ70183 100 µg
    EUR 359

    Polyclonal Goat Anti-Flotillin 2 / FLOT2 (C Term) Antibody

    APR12096G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Flotillin 2 / FLOT2 (C Term) . This antibody is tested and proven to work in the following applications:

    Flot2/ Rat Flot2 ELISA Kit

    ELI-38350r 96 Tests
    EUR 886

    ELISA kit for Human Flotillin-2

    EK5025 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Flotillin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.


    EF008664 96 Tests
    EUR 689

    Recombinant human Flotillin-2

    P1808 100ug Ask for price
    • Uniprot ID: Q14254
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human Flotillin-2

    FLOT2 ELISA Kit (Human) (OKCD08151)

    OKCD08151 96 Wells
    EUR 975
    Description: Description of target: Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.273ng/mL

    FLOT2 ELISA Kit (Human) (OKEH03630)

    OKEH03630 96 Wells
    EUR 779
    Description: Description of target: May act as a scaffolding protein within caveolar membranes, functionally participating in formation of caveolae or caveolae-like vesicles. May be involved in epidermal cell adhesion and epidermal structure and function.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.417 ng/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Flotillin-2 antibody

    22214-100ul 100ul
    EUR 390

    Flotillin 2 antibody

    70R-12511 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal Flotillin 2 antibody

    Flotillin-2 protein

    E20-80124 20ug
    EUR 408

    anti-Flotillin 2

    YF-PA11813 50 ul
    EUR 363
    Description: Mouse polyclonal to Flotillin 2

    anti-Flotillin 2

    YF-PA11814 50 ug
    EUR 363
    Description: Mouse polyclonal to Flotillin 2

    anti-Flotillin 2

    YF-PA11816 50 ug
    EUR 363
    Description: Mouse polyclonal to Flotillin 2

    Human Flotillin 1(FLOT1) ELISA kit

    E01F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Flotillin 1(FLOT1) ELISA kit

    E01F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Flotillin 1(FLOT1) ELISA kit

    E01F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Flotillin 1 (FLOT1) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Flotillin 1 (FLOT1) ELISA Kit

    abx250621-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human FLOT1/ Flotillin-1 ELISA Kit

    E0923Hu 1 Kit
    EUR 605

    ELISA kit for Human Flotillin-1

    EK2906 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Flotillin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human FLOT1(Flotillin-1) ELISA Kit

    EH1351 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: O75955
    • Alias: FLOT1/Flotillin-1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Flotillin- 1, FLOT1 ELISA KIT

    ELI-12892h 96 Tests
    EUR 824

    Human Flotillin-1(FLOT1) ELISA kit

    CSB-EL008727HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Flotillin-1 (FLOT1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Flotillin-1(FLOT1) ELISA kit

    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Flotillin-1(FLOT1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Flotillin 1(FLOT1)ELISA Kit

    QY-E00250 96T
    EUR 361

    Human Flotillin 1 (FLOT1) ELISA Kit

    SEF452Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Flotillin 1 (FLOT1) ELISA Kit

    SEF452Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Flotillin 1 (FLOT1) ELISA Kit

    SEF452Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Flotillin 1 (FLOT1) ELISA Kit

    SEF452Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Flotillin 1 (FLOT1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Flotillin 1 (FLOT1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Flotillin 1 (FLOT1) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Flotillin 1 elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Flotillin 1 (FLOT1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Flotillin-2 Polyclonal Antibody

    EA257-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

    Flotillin-2 Polyclonal Antibody

    EA257-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

    Flotillin-2 Polyclonal Antibody

    ABP51354-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2
    • Applications tips:
    Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

    Flotillin-2 Polyclonal Antibody

    ABP51354-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2
    • Applications tips:
    Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

    Flotillin-2 Polyclonal Antibody

    ABP51354-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from the Internal region of human Flotillin-2
    • Applications tips:
    Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Flotillin-2

    Flotillin-2 Polyclonal Antibody

    ABP57289-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein
    • Applications tips:
    Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Flotillin-2 Polyclonal Antibody

    ABP57289-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein
    • Applications tips:
    Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Flotillin-2 Polyclonal Antibody

    ABP57289-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein
    • Applications tips:
    Description: A polyclonal antibody for detection of Flotillin-2 from Human, Mouse, Rat. This Flotillin-2 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Flotillin-2 Polyclonal Antibody

    ES8286-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    Flotillin-2 Polyclonal Antibody

    ES8286-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    Flotillin-2 Polyclonal Antibody

    ES2353-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Flotillin-2 Polyclonal Antibody

    ES2353-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Flotillin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    anti- Flotillin 2 antibody

    FNab03163 100µg
    EUR 505.25
    • Immunogen: flotillin 2
    • Uniprot ID: Q14254
    • Research Area: Cell Division and Proliferation, Cardiovascular
    Description: Antibody raised against Flotillin 2

    Anti-Flotillin 2 antibody

    PAab03163 100 ug
    EUR 355

    Anti-Flotillin-2 antibody

    STJ93092 200 µl
    EUR 197
    Description: Rabbit polyclonal to Flotillin-2.

    Anti-Flotillin-2 antibody

    STJ97500 200 µl
    EUR 197
    Description: Rabbit polyclonal to Flotillin-2.

    Anti-Flotillin 2 (3G6)

    YF-MA13089 100 ug
    EUR 363
    Description: Mouse monoclonal to Flotillin 2

    ELISA kit for Human FLOT1 (Flotillin 1)

    ELK5386 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Flotillin 1 (FLOT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Flotillin 1 (F
    • Show more
    Description: A sandwich ELISA kit for detection of Flotillin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Flotillin-1 (FLOT1)

    KTE62256-48T 48T
    EUR 332
    • Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Flotillin-1 (FLOT1)

    KTE62256-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Flotillin-1 (FLOT1)

    KTE62256-96T 96T
    EUR 539
    • Flot1 encodes a deduced 428-amino acid protein with a predicted molecular mass of 47 kD. It contains 2 hydrophobic domains and several potential phosphorylation sites. Flot1 shares 47% amino acid identity with both mouse and human FLOT2. Northern blo
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Flotillin-1 (FLOT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    FLOT2 antibody

    70R-17323 50 ul
    EUR 435
    Description: Rabbit polyclonal FLOT2 antibody

    FLOT2 antibody

    39029-100ul 100ul
    EUR 252

    FLOT2 Antibody

    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

    FLOT2 Antibody

    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
    Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:500-1:2000

    FLOT2 Antibody

    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

    FLOT2 Antibody

    EUR 335
    • Form: liquid
    • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
    • Show more
    Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

    FLOT2 Antibody

    CSB-PA183922-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
    • Show more
    Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

    FLOT2 Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against FLOT2. Recognizes FLOT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    FLOT2 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FLOT2 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FLOT2 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Rat Flotillin 1(FLOT1) ELISA kit

    E02F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Flotillin 1(FLOT1) ELISA kit

    E02F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Flotillin 1(FLOT1) ELISA kit

    E02F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Flot1/ Flotillin-1 ELISA Kit

    E0366Ra 1 Kit
    EUR 646

    Mouse Flotillin 1(FLOT1) ELISA kit

    E03F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Flotillin 1(FLOT1) ELISA kit

    E03F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Flotillin 1(FLOT1) ELISA kit

    E03F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Flotillin 1(FLOT1) ELISA kit

    E04F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Flotillin 1(FLOT1) ELISA kit

    E04F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Flotillin 1(FLOT1) ELISA kit

    E04F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Flot1/ Flotillin-1 ELISA Kit

    E0545Mo 1 Kit
    EUR 632

    Goat Flotillin 1(FLOT1) ELISA kit

    E06F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Flotillin 1(FLOT1) ELISA kit

    E06F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Flotillin 1(FLOT1) ELISA kit

    E06F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Flotillin 1(FLOT1) ELISA kit

    E09F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Flotillin 1(FLOT1) ELISA kit

    E09F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Flotillin 1(FLOT1) ELISA kit

    E09F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Flotillin 1(FLOT1) ELISA kit

    E08F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Flotillin 1(FLOT1) ELISA kit

    E08F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Flotillin 1(FLOT1) ELISA kit

    E08F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Flotillin- 1, Flot1 ELISA KIT

    ELI-09848m 96 Tests
    EUR 865

    Bovine Flotillin- 1, FLOT1 ELISA KIT

    ELI-30885b 96 Tests
    EUR 928

    Rat Flotillin- 1, Flot1 ELISA KIT

    ELI-27545r 96 Tests
    EUR 886

    Porcine Flotillin- 1, FLOT1 ELISA KIT

    ELI-07784p 96 Tests
    EUR 928

    Pig Flotillin 1(FLOT1) ELISA kit

    E07F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Flotillin 1(FLOT1) ELISA kit

    E07F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Flotillin 1(FLOT1) ELISA kit

    E07F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Cow Flotillin 1 (FLOT1) ELISA Kit

    abx515648-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Flotillin 1 (FLOT1) ELISA Kit

    abx515650-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Pig Flotillin 1 (FLOT1) ELISA Kit

    abx515651-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Flotillin 1 (FLOT1) ELISA Kit

    abx515652-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.


    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    FLOT2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0787703 1.0 ug DNA
    EUR 154

    Human FLOT2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    FLOT2 Recombinant Protein (Human)

    RP012346 100 ug Ask for price

    FLOT2 Recombinant Protein (Human)

    RP012349 100 ug Ask for price

    Flot1 ELISA Kit| Rat Flotillin-1 ELISA Kit

    EF018700 96 Tests
    EUR 689

    Flot1 ELISA Kit| Mouse Flotillin-1 ELISA Kit

    EF014944 96 Tests
    EUR 689

    FLOT1 ELISA Kit| Bovine Flotillin-1 ELISA Kit

    EF011392 96 Tests
    EUR 689

    Human Flotillin 1 (FLOT1) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Anti-human Flotillin antibody

    EUR 501

    Anti-Flotillin 2 Rabbit Monoclonal Antibody

    M06107 100ug/vial
    EUR 397
    Description: Rabbit Monoclonal Flotillin 2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

    Guinea pig Flotillin 1(FLOT1) ELISA kit

    E05F0369-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Flotillin 1(FLOT1) ELISA kit

    E05F0369-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Flotillin 1(FLOT1) ELISA kit

    E05F0369-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Flotillin 1(FLOT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ESA (FLOT2) Antibody

    21603-100ul 100ul
    EUR 252

    ESA (FLOT2) Antibody

    21603-50ul 50ul
    EUR 187

    FLOT2 Conjugated Antibody

    C39029 100ul
    EUR 397

    FLOT2 cloning plasmid

    CSB-CL619868HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1140
    • Sequence: atgacgttgcagccccgctgcgaggacgtagagacggccgagggggtagctttaactgtgacgggtgtcgcccaggtgaagatcatgacggagaaggaactcctggccgtggcttgtgagcagtttctgggtaagaatgtgcaggacatcaaaaacgtcgtcctgcagaccctgg
    • Show more
    Description: A cloning plasmid for the FLOT2 gene.

    FLOT2 cloning plasmid

    CSB-CL619868HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1158
    • Sequence: atgggcaattgccacacggtggggcccaacgaggcgctggtggtttcagggggctgttgtggttccgactataaacagtacgtgtttggcggctgggcctgggcctggtggtgtatctccgacactcagaggatttccctagagattatgacgttgcagccccgctgcgaggacg
    • Show more
    Description: A cloning plasmid for the FLOT2 gene.

    FLOT2 Rabbit pAb

    A6590-100ul 100 ul
    EUR 308

    FLOT2 Rabbit pAb

    A6590-200ul 200 ul
    EUR 459

    FLOT2 Rabbit pAb

    A6590-20ul 20 ul
    EUR 183

    FLOT2 Rabbit pAb

    A6590-50ul 50 ul
    EUR 223

    Anti-FLOT2 antibody

    STJ28673 100 µl
    EUR 277
    Description: Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling.

    Flotillin 1 Antibody

    49861-100ul 100ul
    EUR 333

    Flotillin 1 Antibody

    49861-50ul 50ul
    EUR 239

    Flotillin 1 Antibody

    45017-100ul 100ul
    EUR 252

    Flotillin 1 Antibody

    45017-50ul 50ul
    EUR 187

    Flotillin 1 Antibody

    DF2923 200ul
    EUR 304
    Description: Flotillin 1 Antibody detects endogenous levels of total Flotillin 1.

    Flotillin 1 Antibody

    DF12155 200ul
    EUR 304
    Description: Flotillin 1 antibody detects endogenous levels of Flotillin 1.

    Flotillin 1 Antibody

    ABD2923 100 ug
    EUR 438

    anti-Flotillin 1

    YF-PA16791 100 ug
    EUR 403
    Description: Rabbit polyclonal to Flotillin 1

    FLOT2 ORF Vector (Human) (pORF)

    ORF004116 1.0 ug DNA
    EUR 95

    FLOT2 ORF Vector (Human) (pORF)

    ORF004117 1.0 ug DNA
    EUR 95

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Flot2 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7005203 1.0 ug DNA
    EUR 154

    Flot2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3813803 1.0 ug DNA
    EUR 154

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Rat FLOT2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    ESA (FLOT2) Conjugated Antibody

    C21603 100ul
    EUR 397

    Mouse FLOT2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    FLOT2 Recombinant Protein (Rat)

    RP201533 100 ug Ask for price

    FLOT2 Recombinant Protein (Mouse)

    RP134792 100 ug Ask for price

    FLOT2 Recombinant Protein (Mouse)

    RP134795 100 ug Ask for price

    FLOT2 sgRNA CRISPR Lentivector set (Human)

    K0787701 3 x 1.0 ug
    EUR 339

    Flotillin 1 Blocking Peptide

    DF2923-BP 1mg
    EUR 195

    Flotillin 1 Blocking Peptide

    DF12155-BP 1mg
    EUR 195

    Flotillin 1 (FLOT1) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Flotillin 1 (FLOT1) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Flotillin 1 (FLOT1) Antibody

    abx146106-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Flotillin 1 (FLOT1) Antibody

    • EUR 370.00
    • EUR 606.00
    • EUR 300.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Flotillin 1 Conjugated Antibody

    C49861 100ul
    EUR 397

    Flotillin 1 Conjugated Antibody

    C45017 100ul
    EUR 397

    Flotillin- 1 Mouse mAb

    BF9217 100 ug
    EUR 438

    Flotillin 1 (FLOT1) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Flotillin 1 (FLOT1) Antibody

    abx233162-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Flotillin 1 (FLOT1) Antibody

    abx431256-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Flotillin-1 Monoclonal Antibody

    ABM40157-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthetic Peptide
    • Applications tips:
    Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

    Flotillin-1 Monoclonal Antibody

    ABM40157-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthetic Peptide
    • Applications tips:
    Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

    Flotillin-1 Monoclonal Antibody

    ABM40157-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthetic Peptide
    • Applications tips:
    Description: A monoclonal antibody for detection of Flotillin-1 from Human, Mouse, Rat. This Flotillin-1 antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

    Flotillin 1 Rabbit mAb

    A3023-100ul 100 ul
    EUR 410

    Flotillin 1 Rabbit mAb

    A3023-200ul 200 ul
    EUR 571

    Flotillin 1 Rabbit mAb

    A3023-20ul 20 ul
    EUR 221

    Flotillin 1 Rabbit mAb

    A3023-50ul 50 ul
    EUR 287

    Flotillin-1 Monoclonal Antibody

    EM1157-100ul 100ul
    EUR 279
    Description: A Mouse Monoclonal antibody against Flotillin-1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

    Flotillin-1 Monoclonal Antibody

    EM1157-50ul 50ul
    EUR 207
    Description: A Mouse Monoclonal antibody against Flotillin-1 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

    anti- Flotillin 1 antibody

    FNab03162 100µg
    EUR 505.25
    • Recommended dilution: WB: 1500-1:2000
    • IF: 1:10-1:100
    • Immunogen: flotillin 1
    • Uniprot ID: O75955
    • Gene ID: 10211
    • Research Area: Cell Division and Proliferation, Cardiovascular
    Description: Antibody raised against Flotillin 1

    Anti-Flotillin 1 antibody

    PAab03162 100 ug
    EUR 355

    Anti-Flotillin-1 antibody

    STJ97059 200 µl
    EUR 197
    Description: Mouse monoclonal to Flotillin-1.

    Anti-Flotillin 1 antibody

    STJ70184 100 µg
    EUR 359

    Anti-Flotillin 1 (4A1)

    YF-MA17192 200 ul
    EUR 363
    Description: Mouse monoclonal to Flotillin 1

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Human Fibrinogen (FBG) AssayMax ELISA Kit

    EF1040-2 96 Well Plate
    EUR 396

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Dr. P Kit-Solution 2

    K2021010-2 6 ml
    EUR 120
    Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    Polyclonal FLOT2 Antibody (C-Term)

    AMM05875G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FLOT2 (C-Term). This antibody is tested and proven to work in the following applications:

    Flot2 ORF Vector (Rat) (pORF)

    ORF067179 1.0 ug DNA
    EUR 506

    Flot2 ORF Vector (Mouse) (pORF)

    ORF044932 1.0 ug DNA
    EUR 506

    Flot2 ORF Vector (Mouse) (pORF)

    ORF044933 1.0 ug DNA
    EUR 506

    FLOT2 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0787702 1.0 ug DNA
    EUR 154

    FLOT2 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0787704 1.0 ug DNA
    EUR 154

    FLOT2 Protein Vector (Human) (pPB-C-His)

    PV016461 500 ng
    EUR 329

    FLOT2 Protein Vector (Human) (pPB-N-His)

    PV016462 500 ng
    EUR 329

    FLOT2 Protein Vector (Human) (pPM-C-HA)

    PV016463 500 ng
    EUR 329

    FLOT2 Protein Vector (Human) (pPM-C-His)

    PV016464 500 ng
    EUR 329

    FLOT2 Protein Vector (Human) (pPB-C-His)

    PV016465 500 ng
    EUR 329

    FLOT2 Protein Vector (Human) (pPB-N-His)

    PV016466 500 ng
    EUR 329

    FLOT2 Protein Vector (Human) (pPM-C-HA)

    PV016467 500 ng
    EUR 329

    FLOT2 Protein Vector (Human) (pPM-C-His)

    PV016468 500 ng
    EUR 329

    FLOT2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

    K0787707 1.0 ug DNA
    EUR 167

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    Human FLOT2(Flotillin 2) ELISA Kit