Human ITLN2(Intelectin 2) ELISA Kit

Human ITLN2(Intelectin 2) ELISA Kit

To Order Contact us below: 

Human Intelectin 2 (ITLN2) ELISA Kit
RDR-ITLN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Intelectin 2 (ITLN2) ELISA Kit
RDR-ITLN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Intelectin 2 (ITLN2) ELISA Kit
RD-ITLN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Intelectin 2 (ITLN2) ELISA Kit
RD-ITLN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Intelectin 2 (ITLN2)ELISA Kit
201-12-2755	SunredBio	96 tests	EUR 440
This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
20-abx151998	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Intelectin 2 (ITLN2) ELISA Kit
abx252683-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit
EH3280	FN Test	96T	EUR 524.1
Detection range: 6.25-400 ng/ml Uniprot ID: Q8WWU7 Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml

Human Intelectin- 2, ITLN2 ELISA KIT
ELI-28050h	Lifescience Market	96 Tests	EUR 824

Human Intelectin 2(ITLN2)ELISA Kit
QY-E02126	Qayee Biotechnology	96T	EUR 361

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
4-SEH773Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2 Endothelial lectin HL-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Intelectin 2 (ITLN2) Antibody
abx027537-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
abx027537-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
20-abx177020	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Intelectin 2 (ITLN2) Antibody
abx037210-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
20-abx172969	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

ELISA kit for Human ITLN2 (Intelectin 2)
E-EL-H5562	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ITLN2 (Intelectin 2)
ELK3892	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2 Show more
Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 2 (ITLN2) Protein
20-abx653899	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Intelectin 2 (ITLN2) CLIA Kit
20-abx495538	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ITLN2 ELISA KIT|Human
EF006945	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

ITLN2 Antibody
42927-100ul	SAB	100ul	EUR 252

ITLN2 Antibody
39630-100ul	SAB	100ul	EUR 390

ITLN2 antibody
70R-4496	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ITLN2 antibody raised against the middle region of ITLN2

ITLN2 siRNA
20-abx920956	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human Intelectin 1 (ITLN1)ELISA Kit
201-12-2754	SunredBio	96 tests	EUR 440
This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
20-abx151997	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Intelectin 1 (ITLN1) ELISA Kit
abx253532-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Intelectin-1
EK2456	SAB	96 tests	EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ITLN1/ Intelectin-1 ELISA Kit
E1354Hu	Sunlong	1 Kit	EUR 537

Human ITLN1(Intelectin-1 ) ELISA Kit
EH0564	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: Q8WWA0 Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Intelectin- 1, ITLN1 ELISA KIT
ELI-03070h	Lifescience Market	96 Tests	EUR 824

Human Intelectin 1(ITLN1)ELISA Kit
QY-E02127	Qayee Biotechnology	96T	EUR 361

Human Intelectin 1 ELISA Kit (ITLN1)
RK01714	Abclonal	96 Tests	EUR 521

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1 INTL ITLN LFR HIntL Omentin Intelectin 1, Galactofuranose Binding Intestinal Lactoferrin Receptor Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human ITLN2 shRNA Plasmid
20-abx965352	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ITLN2 Recombinant Protein (Human)
RP040183	ABM	100 ug	Ask for price

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1106803	ABM	1.0 ug DNA	EUR 154

Human Intelectin 1/Omentin (ITLN1) ELISA Kit
abx055557-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Omentin/intelectin-1 PicoKine ELISA Kit
EK1849	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

ELISA kit for Human ITLN1 (Intelectin 1)
ELK2003	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1 Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 1/Omentin (ITLN1) ELISA Kit
abx574465-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

ITLN2 Blocking Peptide
33R-9353	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN2 antibody, catalog no. 70R-4496

ITLN2 Conjugated Antibody
C42927	SAB	100ul	EUR 397

ITLN2 cloning plasmid
CSB-CL837867HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 975 Sequence: atgctgtccatgctgaggacaatgaccagactctgcttcctgttattcttctctgtggccaccagtgggtgcagtgcagcagcctcttctcttgagatgctctcgagggaattcgaaacctgtgccttctccttttcttccctgcctagaagctgcaaagaaatcaaggaacgctg Show more
Description: A cloning plasmid for the ITLN2 gene.

Mouse Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
20-abx155707	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Intelectin 1 (ITLN1) ELISA Kit
20-abx154225	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Intelectin- 1a, Itln1 ELISA KIT
ELI-03069m	Lifescience Market	96 Tests	EUR 865

Mouse Intelectin 1a (ITLN1) ELISA Kit
abx575109-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Intelectin- 1b, Itln1b ELISA KIT
ELI-39394m	Lifescience Market	96 Tests	EUR 865

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1 INTL ITLN LFR HIntL Omentin Intelectin 1, Galactofuranose Binding Intestinal Lactoferrin Receptor Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Ra	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1 INTL ITLN LFR HIntL Omentin Intelectin 1, Galactofuranose Binding Intestinal Lactoferrin Receptor Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Mouse Intelectin 1 ELISA Kit (ITLN1)
RK02963	Abclonal	96 Tests	EUR 521

Mouse Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

ITLN2 ORF Vector (Human) (pORF)
ORF013395	ABM	1.0 ug DNA	EUR 354

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ELISA kit for Human ITLN1 (Intelectin 1/Omentin)
E-EL-H2028	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Human Intelectin 1 (ITLN1) CLIA Kit
20-abx492234	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Polyclonal ITLN2 Antibody (Center)
APR11252G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN2 (Center). This antibody is tested and proven to work in the following applications:

Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit
abx254237-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit
abx255780-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

ELISA kit for Mouse ITLN1 (Intelectin 1)
ELK2004	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1 Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat ITLN1 (Intelectin 1)
ELK2005	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1 Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Monkey Intelectin 1/Omentin (ITLN1) ELISA Kit
abx359483-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Intelectin 1/Omentin (ITLN1) ELISA Kit
abx361255-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Intelectin 1/Omentin (ITLN1) ELISA Kit
abx362579-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Intelectin 1/Omentin (ITLN1) ELISA Kit
abx356771-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit
abx576145-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse ITLN1(Intelectin 1/Omentin) ELISA Kit
EM1180	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: O88310 Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Rat ITLN1(Intelectin 1/Omentin) ELISA Kit
ER1117	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

ELISA kit for Mouse Intelectin 1 (ITLN1)
KTE71460-48T	Abbkine	48T	EUR 332
Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)
KTE71460-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)
KTE71460-96T	Abbkine	96T	EUR 539
Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ITLN1 ELISA Kit| Rat Intelectin 1/Omentin ELISA Kit
EF017857	Lifescience Market	96 Tests	EUR 689

ITLN1 ELISA Kit| Mouse Intelectin 1/Omentin ELISA Kit
EF013735	Lifescience Market	96 Tests	EUR 689

ITLN2 sgRNA CRISPR Lentivector set (Human)
K1106801	ABM	3 x 1.0 ug	EUR 339

Human Intelectin 1/Omentin (ITLN1) CLIA Kit
abx195758-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Intelectin 1 (ITLN1) Protein
20-abx067298	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse ITLN1 (Intelectin 1/Omentin)
E-EL-M0857	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ITLN1 (Intelectin 1/Omentin)
E-EL-R0689	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Guinea pig Intelectin 1/Omentin (ITLN1) ELISA Kit
abx357571-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse Intelectin 1 (ITLN1) CLIA Kit
20-abx492235	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Intelectin 1 (ITLN1) CLIA Kit
20-abx492236	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1106802	ABM	1.0 ug DNA	EUR 154

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1106804	ABM	1.0 ug DNA	EUR 154

ITLN2 Protein Vector (Human) (pPB-C-His)
PV053577	ABM	500 ng	EUR 481

ITLN2 Protein Vector (Human) (pPB-N-His)
PV053578	ABM	500 ng	EUR 481

ITLN2 Protein Vector (Human) (pPM-C-HA)
PV053579	ABM	500 ng	EUR 481

ITLN2 Protein Vector (Human) (pPM-C-His)
PV053580	ABM	500 ng	EUR 481

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

CLIA kit for Human ITLN1 (Intelectin 1/Omentin)
E-CL-H1228	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Intelectin 1 (ITLN1) Antibody
20-abx177019	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Intelectin 1 (ITLN1) Antibody
20-abx212528	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101091	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101092	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101093	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx172967	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Intelectin 1 (ITLN1) Antibody
20-abx172968	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Intelectin 1 (ITLN1)
4-RPA933Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8WWA0 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.4kDa Isoelectric Point: 7.2
Description: Recombinant Human Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)
4-RPA933Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O88310 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.7kDa Isoelectric Point: 8.8
Description: Recombinant Mouse Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)
4-RPA933Ra01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q499T8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.4kDa Isoelectric Point: Inquire
Description: Recombinant Rat Intelectin 1 expressed in: E.coli

ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1106807	ABM	1.0 ug DNA	EUR 167

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human Fibrinogen (FBG) AssayMax ELISA Kit
EF1040-2	AssayPro	96 Well Plate	EUR 396

Mouse Intelectin 1/Omentin (ITLN1) CLIA Kit
abx195759-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) CLIA Kit
abx195760-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Dr. P Kit-Solution 2
K2021010-2	Biochain	6 ml	EUR 120
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Intelectin 1/Omentin (ITLN1) Antibody
20-abx005461	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody
20-abx113197	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody
abx036572-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody
20-abx137227	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Mouse Intelectin 1 (ITLN1) Protein
20-abx067296	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Intelectin 1 (ITLN1) Protein
20-abx067297	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)
20-abx272759	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)
20-abx273225	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Intelectin 1/Omentin (ITLN1) Antibody
abx234415-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Intelectin 1/Omentin (ITLN1) Antibody
20-abx225255	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse)
4-PAA933Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ITLN1 (Cys31~Gly253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1)

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

IL-2 Interleukin-2 Human Recombinant Protein, His Tag
PROTP60568-2	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5101-2	AssayPro	96 Well Plate	EUR 417

Human Factor X (Factor 10) AssayMax ELISA Kit
EF1010-2	AssayPro	96 Well Plate	EUR 477

Recombinant Human TFF-2 Protein
PROTQ03403-2	BosterBio	20ug	EUR 317
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds.

Recombinant Human BD-2 Protein
PROTO15263-2	BosterBio	20ug	EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Recombinant Human Relaxin-2 Protein
PROTP04090-2	BosterBio	25ug	EUR 317
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain.

Recombinant Human PAI-2 Protein
PROTP05120-2	BosterBio	10ug	EUR 317
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein.

Recombinant Human MMP-2 Protein
PROTP08253-2	BosterBio	10ug	EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids).

ITLN2 3'UTR GFP Stable Cell Line
TU061353	ABM	1.0 ml	EUR 1394

ITLN2 3'UTR Luciferase Stable Cell Line
TU011353	ABM	1.0 ml	EUR 1394

CLIA kit for Mouse ITLN1 (Intelectin 1/Omentin)
E-CL-M0525	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Rat ITLN1 (Intelectin 1/Omentin)
E-CL-R0491	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer
PROTP12643-2	BosterBio	Regular: 20ug	EUR 317
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit
EA8011-2	AssayPro	96 Well Plate	EUR 417

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit
DLR-LAB7-2-Hu-48T	DL Develop	48T	EUR 425
Should the Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit
DLR-LAB7-2-Hu-96T	DL Develop	96T	EUR 548
Should the Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit
RDR-LAB7-2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit
RDR-LAB7-2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit
RD-LAB7-2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 418

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit
RD-LAB7-2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 575

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

ErbB2 ErbB-2 Human Recombinant Protein
PROTP04626-2	BosterBio	Regular: 20ug	EUR 317
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli.

Human ITLN2(Intelectin 2) ELISA Kit