Human ITLN2(Intelectin 2) ELISA Kit

Human ITLN2(Intelectin 2) ELISA Kit

To Order Contact us below: 

    Human Intelectin 2 (ITLN2) ELISA Kit

    RDR-ITLN2-Hu-48Tests 48 Tests
    EUR 544

    Human Intelectin 2 (ITLN2) ELISA Kit

    RDR-ITLN2-Hu-96Tests 96 Tests
    EUR 756

    Human Intelectin 2 (ITLN2) ELISA Kit

    RD-ITLN2-Hu-48Tests 48 Tests
    EUR 521

    Human Intelectin 2 (ITLN2) ELISA Kit

    RD-ITLN2-Hu-96Tests 96 Tests
    EUR 723

    Human Intelectin 2 (ITLN2)ELISA Kit

    201-12-2755 96 tests
    EUR 440
    • This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    20-abx151998
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Intelectin 2 (ITLN2) ELISA Kit

    abx252683-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human ITLN2(Intelectin 2) ELISA Kit

    EH3280 96T
    EUR 524.1
    • Detection range: 6.25-400 ng/ml
    • Uniprot ID: Q8WWU7
    • Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml

    Human Intelectin- 2, ITLN2 ELISA KIT

    ELI-28050h 96 Tests
    EUR 824

    Human Intelectin 2(ITLN2)ELISA Kit

    QY-E02126 96T
    EUR 361

    Human Intelectin 2 (ITLN2) ELISA Kit

    SEH773Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    SEH773Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    SEH773Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    SEH773Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    4-SEH773Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2
    • Endothelial lectin HL-2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Intelectin 2 (ITLN2) Antibody

    abx027537-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Intelectin 2 (ITLN2) Antibody

    abx027537-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Intelectin 2 (ITLN2) Antibody

    20-abx177020
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Intelectin 2 (ITLN2) Antibody

    abx037210-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Intelectin 2 (ITLN2) Antibody

    20-abx172969
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Human Intelectin 2 (ITLN2) Protein

    20-abx653899
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    ELISA kit for Human ITLN2 (Intelectin 2)

    E-EL-H5562 1 plate of 96 wells
    EUR 534
    • Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Human ITLN2 (Intelectin 2)

    ELK3892 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2
    • Show more
    Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Intelectin 2 (ITLN2) CLIA Kit

    20-abx495538
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ITLN2 ELISA KIT|Human

    EF006945 96 Tests
    EUR 689

    ITLN2 ELISA Kit (Human) (OKCD01969)

    OKCD01969 96 Wells
    EUR 831
    Description: Description of target: May play a role in the defense system against pathogens.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.06 ng/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    ITLN2 Antibody

    42927-100ul 100ul
    EUR 252

    ITLN2 Antibody

    39630-100ul 100ul
    EUR 390

    ITLN2 antibody

    70R-4496 50 ug
    EUR 467
    Description: Rabbit polyclonal ITLN2 antibody raised against the middle region of ITLN2

    ITLN2 siRNA

    20-abx920956
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Human Intelectin 1 (ITLN1)ELISA Kit

    201-12-2754 96 tests
    EUR 440
    • This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Hu-48T 48T
    EUR 479
    • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Hu-96T 96T
    EUR 621
    • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    20-abx151997
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Intelectin 1 (ITLN1) ELISA Kit

    abx253532-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ELISA kit for Human Intelectin-1

    EK2456 96 tests
    EUR 452
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human ITLN1/ Intelectin-1 ELISA Kit

    E1354Hu 1 Kit
    EUR 537

    Human ITLN1(Intelectin-1 ) ELISA Kit

    EH0564 96T
    EUR 524.1
    • Detection range: 78.125-5000 pg/ml
    • Uniprot ID: Q8WWA0
    • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

    Human Intelectin- 1, ITLN1 ELISA KIT

    ELI-03070h 96 Tests
    EUR 824

    Human Intelectin 1(ITLN1)ELISA Kit

    QY-E02127 96T
    EUR 361

    Human Intelectin 1 ELISA Kit (ITLN1)

    RK01714 96 Tests
    EUR 521

    Human Intelectin 1 (ITLN1) ELISA Kit

    SEA933Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4273.35
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    SEA933Hu-1x48wellstestplate 1x48-wells test plate
    EUR 439.57
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    SEA933Hu-1x96wellstestplate 1x96-wells test plate
    EUR 585.1
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    SEA933Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2332.95
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    4-SEA933Hu
    • EUR 4324.00
    • EUR 2283.00
    • EUR 586.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
    • INTL
    • ITLN
    • LFR
    • HIntL
    • Omentin
    • Intelectin 1, Galactofuranose Binding
    • Intestinal Lactoferrin Receptor
    • Endothelial lectin HL-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Hu-48Tests 48 Tests
    EUR 500

    Human Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Hu-96Tests 96 Tests
    EUR 692

    Human Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Hu-48Tests 48 Tests
    EUR 478

    Human Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Hu-96Tests 96 Tests
    EUR 662

    Human ITLN2 shRNA Plasmid

    20-abx965352
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    ITLN2 Recombinant Protein (Human)

    RP040183 100 ug Ask for price

    ITLN2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1106803 1.0 ug DNA
    EUR 154

    Human Intelectin 1/Omentin (ITLN1) ELISA Kit

    abx055557-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Omentin/intelectin-1 PicoKine ELISA Kit

    EK1849 96 wells
    EUR 425
    Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

    ELISA kit for Human ITLN1 (Intelectin 1)

    ELK2003 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
    • Show more
    Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Intelectin 1/Omentin (ITLN1) ELISA Kit

    abx574465-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    ITLN2 Blocking Peptide

    33R-9353 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN2 antibody, catalog no. 70R-4496

    ITLN2 Conjugated Antibody

    C42927 100ul
    EUR 397

    ITLN2 cloning plasmid

    CSB-CL837867HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 975
    • Sequence: atgctgtccatgctgaggacaatgaccagactctgcttcctgttattcttctctgtggccaccagtgggtgcagtgcagcagcctcttctcttgagatgctctcgagggaattcgaaacctgtgccttctccttttcttccctgcctagaagctgcaaagaaatcaaggaacgctg
    • Show more
    Description: A cloning plasmid for the ITLN2 gene.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Mu-48T 48T
    EUR 489
    • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Mu-96T 96T
    EUR 635
    • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Ra-48T 48T
    EUR 508
    • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Ra-96T 96T
    EUR 661
    • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    20-abx155707
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    20-abx154225
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Intelectin- 1a, Itln1 ELISA KIT

    ELI-03069m 96 Tests
    EUR 865

    Mouse Intelectin 1a (ITLN1) ELISA Kit

    abx575109-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Mouse Intelectin- 1b, Itln1b ELISA KIT

    ELI-39394m 96 Tests
    EUR 865

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    SEA933Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4391.16
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    SEA933Mu-1x48wellstestplate 1x48-wells test plate
    EUR 449.27
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    SEA933Mu-1x96wellstestplate 1x96-wells test plate
    EUR 598.96
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    SEA933Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2395.32
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    4-SEA933Mu
    • EUR 4442.00
    • EUR 2346.00
    • EUR 599.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
    • INTL
    • ITLN
    • LFR
    • HIntL
    • Omentin
    • Intelectin 1, Galactofuranose Binding
    • Intestinal Lactoferrin Receptor
    • Endothelial lectin HL-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    SEA933Ra-10x96wellstestplate 10x96-wells test plate
    EUR 4626.78
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    SEA933Ra-1x48wellstestplate 1x48-wells test plate
    EUR 468.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    SEA933Ra-1x96wellstestplate 1x96-wells test plate
    EUR 626.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    SEA933Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2520.06
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    4-SEA933Ra
    • EUR 4677.00
    • EUR 2471.00
    • EUR 627.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
    • INTL
    • ITLN
    • LFR
    • HIntL
    • Omentin
    • Intelectin 1, Galactofuranose Binding
    • Intestinal Lactoferrin Receptor
    • Endothelial lectin HL-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Mu-48Tests 48 Tests
    EUR 511

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Mu-96Tests 96 Tests
    EUR 709

    Rat Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Ra-48Tests 48 Tests
    EUR 534

    Rat Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Ra-96Tests 96 Tests
    EUR 742

    Mouse Intelectin 1 ELISA Kit (ITLN1)

    RK02963 96 Tests
    EUR 521

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Mu-48Tests 48 Tests
    EUR 489

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Mu-96Tests 96 Tests
    EUR 677

    Rat Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Ra-48Tests 48 Tests
    EUR 511

    Rat Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Ra-96Tests 96 Tests
    EUR 709

    ITLN2 ORF Vector (Human) (pORF)

    ORF013395 1.0 ug DNA
    EUR 354

    AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    ELISA kit for Human ITLN1 (Intelectin 1/Omentin)

    E-EL-H2028 1 plate of 96 wells
    EUR 534
    • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

    Human Intelectin 1 (ITLN1) CLIA Kit

    20-abx492234
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Polyclonal ITLN2 Antibody (Center)

    APR11252G 0.1ml
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN2 (Center). This antibody is tested and proven to work in the following applications:

    Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit

    abx254237-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Rat Intelectin 1/Omentin (ITLN1) ELISA Kit

    abx255780-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.

    ELISA kit for Mouse ITLN1 (Intelectin 1)

    ELK2004 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
    • Show more
    Description: A sandwich ELISA kit for detection of Intelectin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Rat ITLN1 (Intelectin 1)

    ELK2005 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
    • Show more
    Description: A sandwich ELISA kit for detection of Intelectin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human ITLN2(Intelectin 2) ELISA Kit