Human ITLN2(Intelectin 2) ELISA Kit

Human ITLN2(Intelectin 2) ELISA Kit

To Order Contact us below: 

    Human Intelectin 2 (ITLN2) ELISA Kit

    RDR-ITLN2-Hu-48Tests 48 Tests
    EUR 544

    Human Intelectin 2 (ITLN2) ELISA Kit

    RDR-ITLN2-Hu-96Tests 96 Tests
    EUR 756

    Human Intelectin 2 (ITLN2) ELISA Kit

    RD-ITLN2-Hu-48Tests 48 Tests
    EUR 521

    Human Intelectin 2 (ITLN2) ELISA Kit

    RD-ITLN2-Hu-96Tests 96 Tests
    EUR 723

    Human Intelectin 2 (ITLN2)ELISA Kit

    201-12-2755 96 tests
    EUR 440
    • This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Intelectin 2 (ITLN2) ELISA Kit

    abx252683-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human ITLN2(Intelectin 2) ELISA Kit

    EH3280 96T
    EUR 524.1
    • Detection range: 6.25-400 ng/ml
    • Uniprot ID: Q8WWU7
    • Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml

    Human Intelectin- 2, ITLN2 ELISA KIT

    ELI-28050h 96 Tests
    EUR 824

    Human Intelectin 2 (ITLN2) ELISA Kit

    SEH773Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    SEH773Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    SEH773Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    SEH773Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

    Human Intelectin 2 (ITLN2) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2
    • Endothelial lectin HL-2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Intelectin 2(ITLN2)ELISA Kit

    QY-E02126 96T
    EUR 361

    Intelectin 2 (ITLN2) Antibody

    abx027537-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Intelectin 2 (ITLN2) Antibody

    abx027537-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Intelectin 2 (ITLN2) Antibody

    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Intelectin 2 (ITLN2) Antibody

    abx037210-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Intelectin 2 (ITLN2) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Human Intelectin 2 (ITLN2) Protein

    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human Intelectin 2 (ITLN2) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human ITLN2 (Intelectin 2)

    E-EL-H5562 1 plate of 96 wells
    EUR 534
    • Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Human ITLN2 (Intelectin 2)

    ELK3892 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2
    • Show more
    Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.


    EF006945 96 Tests
    EUR 689

    ITLN2 ELISA Kit (Human) (OKCD01969)

    OKCD01969 96 Wells
    EUR 831
    Description: Description of target: May play a role in the defense system against pathogens.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.06 ng/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    ITLN2 Antibody

    42927-100ul 100ul
    EUR 252

    ITLN2 Antibody

    39630-100ul 100ul
    EUR 390

    ITLN2 antibody

    70R-4496 50 ug
    EUR 467
    Description: Rabbit polyclonal ITLN2 antibody raised against the middle region of ITLN2

    ITLN2 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Human ITLN2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    ITLN2 Recombinant Protein (Human)

    RP040183 100 ug Ask for price

    Human Intelectin 1 (ITLN1)ELISA Kit

    201-12-2754 96 tests
    EUR 440
    • This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Hu-48T 48T
    EUR 479
    • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Hu-96T 96T
    EUR 621
    • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Intelectin 1 (ITLN1) ELISA Kit

    abx253532-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ELISA kit for Human Intelectin-1

    EK2456 96 tests
    EUR 452
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human ITLN1/ Intelectin-1 ELISA Kit

    E1354Hu 1 Kit
    EUR 537

    Human ITLN1(Intelectin-1 ) ELISA Kit

    EH0564 96T
    EUR 524.1
    • Detection range: 78.125-5000 pg/ml
    • Uniprot ID: Q8WWA0
    • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

    Human Intelectin- 1, ITLN1 ELISA KIT

    ELI-03070h 96 Tests
    EUR 824

    Human Intelectin 1(ITLN1)ELISA Kit

    QY-E02127 96T
    EUR 361

    Human Intelectin 1 ELISA Kit (ITLN1)

    RK01714 96 Tests
    EUR 521

    Human Intelectin 1 (ITLN1) ELISA Kit

    SEA933Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4273.35
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    SEA933Hu-1x48wellstestplate 1x48-wells test plate
    EUR 439.57
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    SEA933Hu-1x96wellstestplate 1x96-wells test plate
    EUR 585.1
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    SEA933Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2332.95
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Intelectin 1 (ITLN1) ELISA Kit

    • EUR 4324.00
    • EUR 2283.00
    • EUR 586.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
    • INTL
    • ITLN
    • LFR
    • HIntL
    • Omentin
    • Intelectin 1, Galactofuranose Binding
    • Intestinal Lactoferrin Receptor
    • Endothelial lectin HL-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Hu-48Tests 48 Tests
    EUR 500

    Human Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Hu-96Tests 96 Tests
    EUR 692

    Human Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Hu-48Tests 48 Tests
    EUR 478

    Human Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Hu-96Tests 96 Tests
    EUR 662

    ITLN2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1106803 1.0 ug DNA
    EUR 154

    ITLN2 Blocking Peptide

    33R-9353 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN2 antibody, catalog no. 70R-4496

    ITLN2 Conjugated Antibody

    C42927 100ul
    EUR 397

    ITLN2 cloning plasmid

    CSB-CL837867HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 975
    • Sequence: atgctgtccatgctgaggacaatgaccagactctgcttcctgttattcttctctgtggccaccagtgggtgcagtgcagcagcctcttctcttgagatgctctcgagggaattcgaaacctgtgccttctccttttcttccctgcctagaagctgcaaagaaatcaaggaacgctg
    • Show more
    Description: A cloning plasmid for the ITLN2 gene.

    Human Intelectin 1/Omentin (ITLN1) ELISA Kit

    abx055557-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Omentin/intelectin-1 PicoKine ELISA Kit

    EK1849 96 wells
    EUR 425
    Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

    ELISA kit for Human ITLN1 (Intelectin 1)

    ELK2003 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
    • Show more
    Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Intelectin 1/Omentin (ITLN1) ELISA Kit

    abx574465-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    ITLN2 ORF Vector (Human) (pORF)

    ORF013395 1.0 ug DNA
    EUR 354


    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Mu-48T 48T
    EUR 489
    • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Mu-96T 96T
    EUR 635
    • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Ra-48T 48T
    EUR 508
    • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    DLR-ITLN1-Ra-96T 96T
    EUR 661
    • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Intelectin- 1a, Itln1 ELISA KIT

    ELI-03069m 96 Tests
    EUR 865

    Mouse Intelectin 1a (ITLN1) ELISA Kit

    abx575109-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Mouse Intelectin- 1b, Itln1b ELISA KIT

    ELI-39394m 96 Tests
    EUR 865

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    SEA933Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4391.16
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    SEA933Mu-1x48wellstestplate 1x48-wells test plate
    EUR 449.27
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    SEA933Mu-1x96wellstestplate 1x96-wells test plate
    EUR 598.96
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    SEA933Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2395.32
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    • EUR 4442.00
    • EUR 2346.00
    • EUR 599.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
    • INTL
    • ITLN
    • LFR
    • HIntL
    • Omentin
    • Intelectin 1, Galactofuranose Binding
    • Intestinal Lactoferrin Receptor
    • Endothelial lectin HL-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    SEA933Ra-10x96wellstestplate 10x96-wells test plate
    EUR 4626.78
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    SEA933Ra-1x48wellstestplate 1x48-wells test plate
    EUR 468.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    SEA933Ra-1x96wellstestplate 1x96-wells test plate
    EUR 626.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    SEA933Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2520.06
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

    Rat Intelectin 1 (ITLN1) ELISA Kit

    • EUR 4677.00
    • EUR 2471.00
    • EUR 627.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
    • INTL
    • ITLN
    • LFR
    • HIntL
    • Omentin
    • Intelectin 1, Galactofuranose Binding
    • Intestinal Lactoferrin Receptor
    • Endothelial lectin HL-1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Mu-48Tests 48 Tests
    EUR 511

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Mu-96Tests 96 Tests
    EUR 709

    Rat Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Ra-48Tests 48 Tests
    EUR 534

    Rat Intelectin 1 (ITLN1) ELISA Kit

    RDR-ITLN1-Ra-96Tests 96 Tests
    EUR 742

    Mouse Intelectin 1 ELISA Kit (ITLN1)

    RK02963 96 Tests
    EUR 521

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Mu-48Tests 48 Tests
    EUR 489

    Mouse Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Mu-96Tests 96 Tests
    EUR 677

    Rat Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Ra-48Tests 48 Tests
    EUR 511

    Rat Intelectin 1 (ITLN1) ELISA Kit

    RD-ITLN1-Ra-96Tests 96 Tests
    EUR 709

    Human Intelectin 1 (ITLN1) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Polyclonal ITLN2 Antibody (Center)

    APR11252G 0.1ml
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN2 (Center). This antibody is tested and proven to work in the following applications:

    ELISA kit for Human ITLN1 (Intelectin 1/Omentin)

    E-EL-H2028 1 plate of 96 wells
    EUR 534
    • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

    ITLN2 sgRNA CRISPR Lentivector set (Human)

    K1106801 3 x 1.0 ug
    EUR 339

    Human Intelectin 1 (ITLN1) Protein

    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit

    abx254237-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Rat Intelectin 1/Omentin (ITLN1) ELISA Kit

    abx255780-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.

    Human ITLN2(Intelectin 2) ELISA Kit