Human PVALB(Parvalbumin) ELISA Kit

Human PVALB(Parvalbumin) ELISA Kit

To Order Contact us below: 

    Human Parvalbumin (PVALB) ELISA Kit

    RDR-PVALB-Hu-96Tests 96 Tests
    EUR 756

    Human Parvalbumin (PVALB) ELISA Kit

    RD-PVALB-Hu-48Tests 48 Tests
    EUR 521

    Human Parvalbumin (PVALB) ELISA Kit

    RD-PVALB-Hu-96Tests 96 Tests
    EUR 723

    Rat Parvalbumin (PVALB) ELISA Kit

    DLR-PVALB-Ra-48T 48T
    EUR 549
    • Should the Rat Parvalbumin (PVALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Parvalbumin (PVALB) in samples from serum, plasma or other biological fluids.

    Rat Parvalbumin (PVALB) ELISA Kit

    DLR-PVALB-Ra-96T 96T
    EUR 718
    • Should the Rat Parvalbumin (PVALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Parvalbumin (PVALB) in samples from serum, plasma or other biological fluids.

    Rat Parvalbumin (PVALB) ELISA Kit

    RDR-PVALB-Ra-48Tests 48 Tests
    EUR 583

    Rat Parvalbumin (PVALB) ELISA Kit

    RDR-PVALB-Ra-96Tests 96 Tests
    EUR 811

    Rat Parvalbumin (PVALB) ELISA Kit

    RD-PVALB-Ra-48Tests 48 Tests
    EUR 557

    Rat Parvalbumin (PVALB) ELISA Kit

    RD-PVALB-Ra-96Tests 96 Tests
    EUR 775

    Human Parvalbumin (PVALB)ELISA Kit

    201-12-2942 96 tests
    EUR 440
    • This Parvalbumin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Parvalbumin (PVALB) ELISA Kit

    20-abx152652
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Parvalbumin(PVALB)ELISA Kit

    QY-E00855 96T
    EUR 361

    Human Parvalbumin ELISA Kit (PVALB)

    RK02169 96 Tests
    EUR 521

    Human Parvalbumin (PVALB) ELISA Kit

    SEG439Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Parvalbumin (PVALB) ELISA Kit

    SEG439Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Parvalbumin (PVALB) ELISA Kit

    SEG439Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Parvalbumin (PVALB) ELISA Kit

    SEG439Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Parvalbumin (PVALB) ELISA Kit

    4-SEG439Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Parvalbumin elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Parvalbumin (PVALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Rat Parvalbumin (PVALB) ELISA Kit

    20-abx155947
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Rat Parvalbumin(PVALB)ELISA kit

    QY-E10201 96T
    EUR 361

    Mouse Parvalbumin(PVALB)ELISA kit

    QY-E21141 96T
    EUR 361

    Rat Parvalbumin (PVALB) ELISA Kit

    SEG439Ra-10x96wellstestplate 10x96-wells test plate
    EUR 5124.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

    Rat Parvalbumin (PVALB) ELISA Kit

    SEG439Ra-1x48wellstestplate 1x48-wells test plate
    EUR 509.64
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

    Rat Parvalbumin (PVALB) ELISA Kit

    SEG439Ra-1x96wellstestplate 1x96-wells test plate
    EUR 685.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

    Rat Parvalbumin (PVALB) ELISA Kit

    SEG439Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2783.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

    Rat Parvalbumin (PVALB) ELISA Kit

    4-SEG439Ra
    • EUR 5175.00
    • EUR 2734.00
    • EUR 686.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Parvalbumin elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Parvalbumin (PVALB) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Parvalbumin alpha (PVALB) ELISA Kit

    abx250713-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human PVALB/ Parvalbumin alpha ELISA Kit

    E2099Hu 1 Kit
    EUR 605

    Human PVALB(Parvalbumin alpha) ELISA Kit

    EH1436 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: P20472
    • Alias: PVALB/Parvalbumin alpha
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human Parvalbumin alpha, PVALB ELISA KIT

    ELI-15681h 96 Tests
    EUR 824

    ELISA kit for Human PVALB (Parvalbumin)

    ELK4148 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Parvalbumin (PVALB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Parvalbumin (P
    • Show more
    Description: A sandwich ELISA kit for detection of Parvalbumin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Parvalbumin (PVALB) Antibody

    20-abx214662
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Parvalbumin (PVALB) Antibody

    20-abx218086
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Parvalbumin (PVALB) Antibody

    20-abx177926
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Parvalbumin (PVALB) Antibody

    20-abx177927
    • EUR 1302.00
    • EUR 620.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Parvalbumin (PVALB) Antibody

    20-abx173965
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Parvalbumin (PVALB) Antibody

    20-abx173966
    • EUR 913.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Parvalbumin (PVALB) Antibody

    abx239836-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Parvalbumin (PVALB) Antibody

    20-abx242310
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Parvalbumin (PVALB) Antibody

    abx433095-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Human Parvalbumin (PVALB) CLIA Kit

    20-abx495197
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Parvalbumin alpha (PVALB)

    1-CSB-EP019092HU
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 27.9 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Parvalbumin alpha(PVALB) expressed in E.coli

    Human Parvalbumin (PVALB) Protein

    20-abx654662
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Rat Parvalbumin alpha (PVALB) ELISA Kit

    abx256462-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Rat Pvalb/ Parvalbumin alpha ELISA Kit

    E0824Ra 1 Kit
    EUR 646

    Mouse Pvalb/ Parvalbumin alpha ELISA Kit

    E1232Mo 1 Kit
    EUR 632

    Rabbit Parvalbumin alpha, PVALB ELISA KIT

    ELI-16808Ra 96 Tests
    EUR 928

    Bovine Parvalbumin alpha, PVALB ELISA KIT

    ELI-22372b 96 Tests
    EUR 928

    Mouse Parvalbumin alpha, Pvalb ELISA KIT

    ELI-30562m 96 Tests
    EUR 865

    Cow Parvalbumin alpha (PVALB) ELISA Kit

    abx516082-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Parvalbumin alpha (PVALB) ELISA Kit

    abx516084-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    ELISA kit for Rat PVALB (Parvalbumin)

    ELK6317 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Parvalbumin (PVALB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Parvalbumin (P
    • Show more
    Description: A sandwich ELISA kit for detection of Parvalbumin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Rat Pvalb(Parvalbumin alpha) ELISA Kit

    ER0485 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P02625
    • Alias: Pvalb/PVALB
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

    Rat Parvalbumin (PVALB) CLIA Kit

    20-abx495198
    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Parvalbumin Alpha (PVALB) Antibody

    20-abx318361
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Rat Parvalbumin (PVALB) Protein

    20-abx654663
    • EUR 885.00
    • EUR 328.00
    • EUR 2834.00
    • EUR 1052.00
    • EUR 606.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Parvalbumin Alpha (PVALB) Antibody

    20-abx002095
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Human Parvalbumin alpha (PVALB) Antibody

    32295-05111 150 ug
    EUR 261

    PVALB Parvalbumin Human Recombinant Protein

    PROTP20472 Regular: 25ug
    EUR 317
    Description: PVALB Human Recombinant fused with a 24 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 134 amino acids (1-110 a.a.) and having a molecular mass of 14.6kDa. The PVALB is purified by proprietary chromatographic techniques.

    Pvalb ELISA Kit| Rat Parvalbumin alpha ELISA Kit

    EF017325 96 Tests
    EUR 689

    Pvalb ELISA Kit| Mouse Parvalbumin alpha ELISA Kit

    EF015801 96 Tests
    EUR 689

    PVALB ELISA Kit| Bovine Parvalbumin alpha ELISA Kit

    EF011716 96 Tests
    EUR 689

    Parvalbumin Alpha (PVALB) Antibody (HRP)

    20-abx305003
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Parvalbumin Alpha (PVALB) Antibody (FITC)

    20-abx305004
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Parvalbumin Alpha (PVALB) Antibody (Biotin)

    20-abx305005
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    PVALB Parvalbumin Rat Recombinant Protein

    PROTP02625 Regular: 10ug
    EUR 441
    Description: Recombinant Rat Parvalbumin produced in E.Coli.;The Rat Parvalbumin is purified by proprietary chromatographic techniques.

    Human Parvalbumin alpha (PVALB) Antibody (Biotin Conjugate)

    32295-05121 150 ug
    EUR 369

    Recombinant Human Parvalbumin α/PVALB (C-6His)

    C157-10ug 10ug
    EUR 156
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Parvalbumin α/PVALB (C-6His)

    C157-1mg 1mg
    EUR 2283
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Parvalbumin α/PVALB (C-6His)

    C157-500ug 500ug
    EUR 1613
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Parvalbumin α/PVALB (C-6His)

    C157-50ug 50ug
    EUR 369
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Polyclonal PVALB / Parvalbumin Antibody (aa51-100)

    APR13030G 0.05ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PVALB / Parvalbumin (aa51-100). This antibody is tested and proven to work in the following applications:

    Polyclonal PVALB / Parvalbumin Antibody (C-Terminus)

    APR13031G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PVALB / Parvalbumin (C-Terminus). This antibody is tested and proven to work in the following applications:

    Human Parvalbumin alpha (PVALB) AssayLite Antibody (FITC Conjugate)

    32295-05141 150 ug
    EUR 428

    Human Parvalbumin alpha (PVALB) AssayLite Antibody (RPE Conjugate)

    32295-05151 150 ug
    EUR 428

    Human Parvalbumin alpha (PVALB) AssayLite Antibody (APC Conjugate)

    32295-05161 150 ug
    EUR 428

    Human Parvalbumin alpha (PVALB) AssayLite Antibody (PerCP Conjugate)

    32295-05171 150 ug
    EUR 471

    Pvalb/ Rat Pvalb ELISA Kit

    ELI-52399r 96 Tests
    EUR 886

    Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-100ug

    QP6558-ec-100ug 100ug
    EUR 408

    Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-10ug

    QP6558-ec-10ug 10ug
    EUR 200

    Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-1mg

    QP6558-ec-1mg 1mg
    EUR 1632

    Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-200ug

    QP6558-ec-200ug 200ug
    EUR 634

    Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-500ug

    QP6558-ec-500ug 500ug
    EUR 1060

    Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-50ug

    QP6558-ec-50ug 50ug
    EUR 263

    Human PVALB ELISA Kit

    ELA-E12618h 96 Tests
    EUR 824

    PVALB ELISA KIT|Human

    EF004871 96 Tests
    EUR 689

    PVALB ELISA Kit (Human) (OKAN05410)

    OKAN05410 96 Wells
    EUR 792
    Description: Description of target: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.62 ng/mL

    PVALB ELISA Kit (Human) (OKCD08933)

    OKCD08933 96 Wells
    EUR 975
    Description: Description of target: PVALB Human Recombinant fused with a 24 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 134 amino acids (1-110 a.a.) and having a molecular mass of 14.6kDa. The PVALB is purified by proprietary chromatographic techniques.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.62ng/mL

    PVALB ELISA Kit (Human) (OKEH02252)

    OKEH02252 96 Wells
    EUR 662
    Description: Description of target: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.17 ng/mL

    Human Parvalbumin a ELISA kit

    E01P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Parvalbumin a ELISA kit

    E01P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Parvalbumin a ELISA kit

    E01P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Human Parvalbumin alpha

    EK3078 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

    Parvalbumin

    AT210 1mg
    EUR 1114

    Parvalbumin

    CH22119 100 ul
    EUR 435

    Parvalbumin

    AG210 1 mg
    EUR 523

    Parvalbumin

    MO22149 100 ul
    EUR 435

    Parvalbumin

    RA24428 100 ul
    EUR 539

    PVALB ELISA Kit (Rat) (OKCD08934)

    OKCD08934 96 Wells
    EUR 1053
    Description: Description of target: binds two calcium ions; may have evolved from an ancestral four domain calcium binding protein.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL

    PVALB ELISA Kit (Bovine) (OKEH07861)

    OKEH07861 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    PVALB ELISA Kit (Mouse) (OKEH03616)

    OKEH03616 96 Wells
    EUR 779
    Description: Description of target: In muscle, parvalbumin is thought to be involved in relaxation after contraction. It binds two calcium ions.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.3 pg/mL

    PVALB ELISA Kit (Rat) (OKEH03617)

    OKEH03617 96 Wells
    EUR 779
    Description: Description of target: In muscle, parvalbumin is thought to be involved in relaxation after contraction. It binds two calcium ions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

    Rat Parvalbumin a ELISA kit

    E02P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Parvalbumin a ELISA kit

    E02P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Parvalbumin a ELISA kit

    E02P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Parvalbumin a ELISA kit

    E04P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Parvalbumin a ELISA kit

    E04P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Parvalbumin a ELISA kit

    E04P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Parvalbumin a ELISA kit

    E03P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Parvalbumin a ELISA kit

    E03P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Parvalbumin a ELISA kit

    E03P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Parvalbumin a ELISA kit

    E08P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Parvalbumin a ELISA kit

    E08P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Parvalbumin a ELISA kit

    E08P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Parvalbumin a ELISA kit

    E06P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Parvalbumin a ELISA kit

    E06P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Parvalbumin a ELISA kit

    E06P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Parvalbumin a ELISA kit

    E07P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Parvalbumin a ELISA kit

    E07P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Parvalbumin a ELISA kit

    E07P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Parvalbumin a ELISA kit

    E09P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Parvalbumin a ELISA kit

    E09P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Parvalbumin a ELISA kit

    E09P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Recombinant Human Parvalbumin

    7-05803 5µg Ask for price

    Recombinant Human Parvalbumin

    7-05804 25µg Ask for price

    Recombinant Human Parvalbumin

    7-05805 1mg Ask for price

    PVALB Antibody

    35902-100ul 100ul
    EUR 252

    PVALB antibody

    38467-100ul 100ul
    EUR 252

    PVALB Antibody

    1-CSB-PA648142
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

    PVALB Antibody

    DF7083 200ul
    EUR 304
    Description: PVALB Antibody detects endogenous levels of total PVALB.

    PVALB Antibody

    1-CSB-PA263723
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

    PVALB Antibody

    1-CSB-PA019092HA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

    PVALB siRNA

    20-abx904386
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PVALB siRNA

    20-abx930475
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PVALB siRNA

    20-abx930476
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PVALB Antibody

    ABD7083 100 ug
    EUR 438

    Guinea pig Parvalbumin a ELISA kit

    E05P0002-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Parvalbumin a ELISA kit

    E05P0002-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Parvalbumin a ELISA kit

    E05P0002-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Mouse Parvalbumin alpha

    EK3076 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Rat Parvalbumin alpha

    EK3077 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

    Parvalbumin Antibody

    49428-100ul 100ul
    EUR 333

    Parvalbumin Antibody

    49428-50ul 50ul
    EUR 239

    Parvalbumin Antibody

    45060-100ul 100ul
    EUR 252

    Parvalbumin Antibody

    45060-50ul 50ul
    EUR 187

    Parvalbumin Antibody

    DF7544 200ul
    EUR 304
    Description: Parvalbumin Antibody detects endogenous levels of total Parvalbumin.

    Parvalbumin Protein

    20-abx260065
    • EUR 3042.00
    • EUR 495.00
    • EUR 230.00
    • 100 ug
    • 10 ug
    • 2 µg
    • Shipped within 5-10 working days.

    Parvalbumin Protein

    20-abx261700
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 25 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Parvalbumin Antibody

    ABD7544 100 ug
    EUR 438

    Parvalbumin antibody

    PAab09811 100 ug
    EUR 386

    Human PVALB shRNA Plasmid

    20-abx953931
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PVALB Recombinant Protein (Human)

    RP025294 100 ug Ask for price

    PVALB Rabbit pAb

    A13538-100ul 100 ul
    EUR 308

    PVALB Rabbit pAb

    A13538-200ul 200 ul
    EUR 459

    PVALB Rabbit pAb

    A13538-20ul 20 ul
    EUR 183

    PVALB Rabbit pAb

    A13538-50ul 50 ul
    EUR 223

    PVALB Blocking Peptide

    DF7083-BP 1mg
    EUR 195

    Polyclonal PVALB Antibody

    APR13032G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PVALB . This antibody is tested and proven to work in the following applications:

    PVALB Conjugated Antibody

    C35902 100ul
    EUR 397

    PVALB Conjugated Antibody

    C38467 100ul
    EUR 397

    PVALB cloning plasmid

    CSB-CL019092HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 333
    • Sequence: atgtcgatgacagacttgctgaacgctgaggacatcaagaaggcggtgggagcctttagcgctaccgactccttcgaccacaaaaagttcttccaaatggtcggcctgaagaaaaagagtgcggatgatgtgaagaaggtgtttcacatgctggacaaggacaaaagtggcttcat
    • Show more
    Description: A cloning plasmid for the PVALB gene.

    PVALB Polyclonal Antibody

    A57009 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    PVALB Rabbit pAb

    A2791-100ul 100 ul
    EUR 308

    PVALB Rabbit pAb

    A2791-200ul 200 ul
    EUR 459

    PVALB Rabbit pAb

    A2791-20ul 20 ul
    EUR 183

    PVALB Rabbit pAb

    A2791-50ul 50 ul
    EUR 223

    Anti-PVALB antibody

    STJ25239 100 µl
    EUR 277
    Description: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants.

    Anti-PVALB antibody

    STJ115499 100 µl
    EUR 277
    Description: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants.

    Recombinant Rat Parvalbumin

    7-05806 2µg Ask for price

    Recombinant Rat Parvalbumin

    7-05807 10µg Ask for price

    Recombinant Rat Parvalbumin

    7-05808 100µg Ask for price

    Parvalbumin Blocking Peptide

    DF7544-BP 1mg
    EUR 195

    Parvalbumin beta Antibody

    1-CSB-PA365766HA01GAA
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against Parvalbumin beta. Recognizes Parvalbumin beta from Gadus morhua subsp. This antibody is Unconjugated. Tested in the following application: ELISA

    Parvalbumin alpha antibody

    70R-50297 100 ul
    EUR 244
    Description: Purified Polyclonal Parvalbumin alpha antibody

    Parvalbumin alpha Antibody

    20-abx008795
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Parvalbumin beta Antibody

    20-abx110580
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Parvalbumin Conjugated Antibody

    C49428 100ul
    EUR 397

    Human PVALB(Parvalbumin) ELISA Kit