Human PVALB(Parvalbumin) ELISA Kit

Human PVALB(Parvalbumin) ELISA Kit

To Order Contact us below: 

Human Parvalbumin (PVALB) ELISA Kit
RDR-PVALB-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Parvalbumin (PVALB) ELISA Kit
RD-PVALB-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Parvalbumin (PVALB) ELISA Kit
RD-PVALB-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Parvalbumin (PVALB) ELISA Kit
DLR-PVALB-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Parvalbumin (PVALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Parvalbumin (PVALB) in samples from serum, plasma or other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit
DLR-PVALB-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Parvalbumin (PVALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Parvalbumin (PVALB) in samples from serum, plasma or other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit
RDR-PVALB-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Parvalbumin (PVALB) ELISA Kit
RDR-PVALB-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Parvalbumin (PVALB) ELISA Kit
RD-PVALB-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Parvalbumin (PVALB) ELISA Kit
RD-PVALB-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Parvalbumin (PVALB)ELISA Kit
201-12-2942	SunredBio	96 tests	EUR 440
This Parvalbumin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Parvalbumin (PVALB) ELISA Kit
20-abx152652	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Parvalbumin(PVALB)ELISA Kit
QY-E00855	Qayee Biotechnology	96T	EUR 361

Human Parvalbumin ELISA Kit (PVALB)
RK02169	Abclonal	96 Tests	EUR 521

Human Parvalbumin (PVALB) ELISA Kit
SEG439Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Parvalbumin (PVALB) ELISA Kit
SEG439Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Parvalbumin (PVALB) ELISA Kit
SEG439Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Parvalbumin (PVALB) ELISA Kit
SEG439Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Parvalbumin (PVALB) ELISA Kit
4-SEG439Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Parvalbumin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Parvalbumin (PVALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Parvalbumin (PVALB) ELISA Kit
20-abx155947	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Parvalbumin(PVALB)ELISA kit
QY-E10201	Qayee Biotechnology	96T	EUR 361

Mouse Parvalbumin(PVALB)ELISA kit
QY-E21141	Qayee Biotechnology	96T	EUR 361

Rat Parvalbumin (PVALB) ELISA Kit
SEG439Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit
SEG439Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit
SEG439Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit
SEG439Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit
4-SEG439Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Parvalbumin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Parvalbumin (PVALB) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Parvalbumin alpha (PVALB) ELISA Kit
abx250713-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human PVALB/ Parvalbumin alpha ELISA Kit
E2099Hu	Sunlong	1 Kit	EUR 605

Human PVALB(Parvalbumin alpha) ELISA Kit
EH1436	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P20472 Alias: PVALB/Parvalbumin alpha
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Parvalbumin alpha, PVALB ELISA KIT
ELI-15681h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human PVALB (Parvalbumin)
ELK4148	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Parvalbumin (PVALB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Parvalbumin (P Show more
Description: A sandwich ELISA kit for detection of Parvalbumin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Parvalbumin (PVALB) Antibody
20-abx214662	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Parvalbumin (PVALB) Antibody
20-abx218086	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Parvalbumin (PVALB) Antibody
20-abx177926	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Parvalbumin (PVALB) Antibody
20-abx177927	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Parvalbumin (PVALB) Antibody
20-abx173965	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Parvalbumin (PVALB) Antibody
20-abx173966	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Parvalbumin (PVALB) Antibody
abx239836-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Parvalbumin (PVALB) Antibody
20-abx242310	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Parvalbumin (PVALB) Antibody
abx433095-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Human Parvalbumin (PVALB) CLIA Kit
20-abx495197	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Parvalbumin alpha (PVALB)
1-CSB-EP019092HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 27.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Parvalbumin alpha(PVALB) expressed in E.coli

Human Parvalbumin (PVALB) Protein
20-abx654662	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Parvalbumin alpha (PVALB) ELISA Kit
abx256462-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Pvalb/ Parvalbumin alpha ELISA Kit
E0824Ra	Sunlong	1 Kit	EUR 646

Mouse Pvalb/ Parvalbumin alpha ELISA Kit
E1232Mo	Sunlong	1 Kit	EUR 632

Rabbit Parvalbumin alpha, PVALB ELISA KIT
ELI-16808Ra	Lifescience Market	96 Tests	EUR 928

Bovine Parvalbumin alpha, PVALB ELISA KIT
ELI-22372b	Lifescience Market	96 Tests	EUR 928

Mouse Parvalbumin alpha, Pvalb ELISA KIT
ELI-30562m	Lifescience Market	96 Tests	EUR 865

Cow Parvalbumin alpha (PVALB) ELISA Kit
abx516082-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Parvalbumin alpha (PVALB) ELISA Kit
abx516084-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Rat PVALB (Parvalbumin)
ELK6317	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Parvalbumin (PVALB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Parvalbumin (P Show more
Description: A sandwich ELISA kit for detection of Parvalbumin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Pvalb(Parvalbumin alpha) ELISA Kit
ER0485	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P02625 Alias: Pvalb/PVALB
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Parvalbumin (PVALB) CLIA Kit
20-abx495198	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Parvalbumin Alpha (PVALB) Antibody
20-abx318361	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rat Parvalbumin (PVALB) Protein
20-abx654663	Abbexa	EUR 885.00 EUR 328.00 EUR 2834.00 EUR 1052.00 EUR 606.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Parvalbumin Alpha (PVALB) Antibody
20-abx002095	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Human Parvalbumin alpha (PVALB) Antibody
32295-05111	AssayPro	150 ug	EUR 261

PVALB Parvalbumin Human Recombinant Protein
PROTP20472	BosterBio	Regular: 25ug	EUR 317
Description: PVALB Human Recombinant fused with a 24 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 134 amino acids (1-110 a.a.) and having a molecular mass of 14.6kDa. The PVALB is purified by proprietary chromatographic techniques.

Pvalb ELISA Kit| Rat Parvalbumin alpha ELISA Kit
EF017325	Lifescience Market	96 Tests	EUR 689

Pvalb ELISA Kit| Mouse Parvalbumin alpha ELISA Kit
EF015801	Lifescience Market	96 Tests	EUR 689

PVALB ELISA Kit| Bovine Parvalbumin alpha ELISA Kit
EF011716	Lifescience Market	96 Tests	EUR 689

Parvalbumin Alpha (PVALB) Antibody (HRP)
20-abx305003	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Parvalbumin Alpha (PVALB) Antibody (FITC)
20-abx305004	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Parvalbumin Alpha (PVALB) Antibody (Biotin)
20-abx305005	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PVALB Parvalbumin Rat Recombinant Protein
PROTP02625	BosterBio	Regular: 10ug	EUR 441
Description: Recombinant Rat Parvalbumin produced in E.Coli.;The Rat Parvalbumin is purified by proprietary chromatographic techniques.

Human Parvalbumin alpha (PVALB) Antibody (Biotin Conjugate)
32295-05121	AssayPro	150 ug	EUR 369

Recombinant Human Parvalbumin α/PVALB (C-6His)
C157-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Parvalbumin α/PVALB (C-6His)
C157-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Parvalbumin α/PVALB (C-6His)
C157-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Parvalbumin α/PVALB (C-6His)
C157-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Polyclonal PVALB / Parvalbumin Antibody (aa51-100)
APR13030G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PVALB / Parvalbumin (aa51-100). This antibody is tested and proven to work in the following applications:

Polyclonal PVALB / Parvalbumin Antibody (C-Terminus)
APR13031G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PVALB / Parvalbumin (C-Terminus). This antibody is tested and proven to work in the following applications:

Human Parvalbumin alpha (PVALB) AssayLite Antibody (FITC Conjugate)
32295-05141	AssayPro	150 ug	EUR 428

Human Parvalbumin alpha (PVALB) AssayLite Antibody (RPE Conjugate)
32295-05151	AssayPro	150 ug	EUR 428

Human Parvalbumin alpha (PVALB) AssayLite Antibody (APC Conjugate)
32295-05161	AssayPro	150 ug	EUR 428

Human Parvalbumin alpha (PVALB) AssayLite Antibody (PerCP Conjugate)
32295-05171	AssayPro	150 ug	EUR 471

Pvalb/ Rat Pvalb ELISA Kit
ELI-52399r	Lifescience Market	96 Tests	EUR 886

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-100ug
QP6558-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-10ug
QP6558-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-1mg
QP6558-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-200ug
QP6558-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-500ug
QP6558-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-50ug
QP6558-ec-50ug	EnQuireBio	50ug	EUR 263

Human PVALB ELISA Kit
ELA-E12618h	Lifescience Market	96 Tests	EUR 824

PVALB ELISA KIT|Human
EF004871	Lifescience Market	96 Tests	EUR 689

Human Parvalbumin a ELISA kit
E01P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Parvalbumin a ELISA kit
E01P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Parvalbumin a ELISA kit
E01P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Parvalbumin alpha
EK3078	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

Parvalbumin
AT210	Unibiotest	1mg	EUR 1114

Parvalbumin
CH22119	Neuromics	100 ul	EUR 435

Parvalbumin
AG210	Unibiotest	1 mg	EUR 523

Parvalbumin
MO22149	Neuromics	100 ul	EUR 435

Parvalbumin
RA24428	Neuromics	100 ul	EUR 539

Rat Parvalbumin a ELISA kit
E02P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Parvalbumin a ELISA kit
E02P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Parvalbumin a ELISA kit
E02P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Parvalbumin a ELISA kit
E04P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Parvalbumin a ELISA kit
E04P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Parvalbumin a ELISA kit
E04P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Parvalbumin a ELISA kit
E03P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Parvalbumin a ELISA kit
E03P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Parvalbumin a ELISA kit
E03P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Parvalbumin a ELISA kit
E08P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Parvalbumin a ELISA kit
E08P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Parvalbumin a ELISA kit
E08P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Parvalbumin a ELISA kit
E06P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Parvalbumin a ELISA kit
E06P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Parvalbumin a ELISA kit
E06P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Parvalbumin a ELISA kit
E07P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Parvalbumin a ELISA kit
E07P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Parvalbumin a ELISA kit
E07P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Parvalbumin a ELISA kit
E09P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Parvalbumin a ELISA kit
E09P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Parvalbumin a ELISA kit
E09P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Recombinant Human Parvalbumin
7-05803	CHI Scientific	5µg	Ask for price

Recombinant Human Parvalbumin
7-05804	CHI Scientific	25µg	Ask for price

Recombinant Human Parvalbumin
7-05805	CHI Scientific	1mg	Ask for price

PVALB Antibody
35902-100ul	SAB	100ul	EUR 252

PVALB antibody
38467-100ul	SAB	100ul	EUR 252

PVALB Antibody
1-CSB-PA648142	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

PVALB Antibody
DF7083	Affbiotech	200ul	EUR 304
Description: PVALB Antibody detects endogenous levels of total PVALB.

PVALB Antibody
1-CSB-PA263723	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PVALB Antibody
1-CSB-PA019092HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PVALB siRNA
20-abx904386	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PVALB siRNA
20-abx930475	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PVALB siRNA
20-abx930476	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PVALB Antibody
ABD7083	Lifescience Market	100 ug	EUR 438

Guinea pig Parvalbumin a ELISA kit
E05P0002-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Parvalbumin a ELISA kit
E05P0002-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Parvalbumin a ELISA kit
E05P0002-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Parvalbumin alpha
EK3076	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Parvalbumin alpha
EK3077	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

Parvalbumin Antibody
49428-100ul	SAB	100ul	EUR 333

Parvalbumin Antibody
49428-50ul	SAB	50ul	EUR 239

Parvalbumin Antibody
45060-100ul	SAB	100ul	EUR 252

Parvalbumin Antibody
45060-50ul	SAB	50ul	EUR 187

Parvalbumin Antibody
DF7544	Affbiotech	200ul	EUR 304
Description: Parvalbumin Antibody detects endogenous levels of total Parvalbumin.

Parvalbumin Protein
20-abx260065	Abbexa	EUR 3042.00 EUR 495.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Parvalbumin Protein
20-abx261700	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

Parvalbumin Antibody
ABD7544	Lifescience Market	100 ug	EUR 438

Parvalbumin antibody
PAab09811	Lifescience Market	100 ug	EUR 386

Human PVALB shRNA Plasmid
20-abx953931	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PVALB Recombinant Protein (Human)
RP025294	ABM	100 ug	Ask for price

PVALB Rabbit pAb
A13538-100ul	Abclonal	100 ul	EUR 308

PVALB Rabbit pAb
A13538-200ul	Abclonal	200 ul	EUR 459

PVALB Rabbit pAb
A13538-20ul	Abclonal	20 ul	EUR 183

PVALB Rabbit pAb
A13538-50ul	Abclonal	50 ul	EUR 223

PVALB Blocking Peptide
DF7083-BP	Affbiotech	1mg	EUR 195

Polyclonal PVALB Antibody
APR13032G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PVALB . This antibody is tested and proven to work in the following applications:

PVALB Conjugated Antibody
C35902	SAB	100ul	EUR 397

PVALB Conjugated Antibody
C38467	SAB	100ul	EUR 397

PVALB cloning plasmid
CSB-CL019092HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 333 Sequence: atgtcgatgacagacttgctgaacgctgaggacatcaagaaggcggtgggagcctttagcgctaccgactccttcgaccacaaaaagttcttccaaatggtcggcctgaagaaaaagagtgcggatgatgtgaagaaggtgtttcacatgctggacaaggacaaaagtggcttcat Show more
Description: A cloning plasmid for the PVALB gene.

PVALB Polyclonal Antibody
A57009	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PVALB Rabbit pAb
A2791-100ul	Abclonal	100 ul	EUR 308

PVALB Rabbit pAb
A2791-200ul	Abclonal	200 ul	EUR 459

PVALB Rabbit pAb
A2791-20ul	Abclonal	20 ul	EUR 183

PVALB Rabbit pAb
A2791-50ul	Abclonal	50 ul	EUR 223

Anti-PVALB antibody
STJ25239	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants.

Anti-PVALB antibody
STJ115499	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants.

Recombinant Rat Parvalbumin
7-05806	CHI Scientific	2µg	Ask for price

Recombinant Rat Parvalbumin
7-05807	CHI Scientific	10µg	Ask for price

Recombinant Rat Parvalbumin
7-05808	CHI Scientific	100µg	Ask for price

Parvalbumin Blocking Peptide
DF7544-BP	Affbiotech	1mg	EUR 195

Parvalbumin beta Antibody
1-CSB-PA365766HA01GAA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Parvalbumin beta. Recognizes Parvalbumin beta from Gadus morhua subsp. This antibody is Unconjugated. Tested in the following application: ELISA

Parvalbumin alpha antibody
70R-50297	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal Parvalbumin alpha antibody

Parvalbumin alpha Antibody
20-abx008795	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Parvalbumin beta Antibody
20-abx110580	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Parvalbumin Conjugated Antibody
C49428	SAB	100ul	EUR 397

Parvalbumin Conjugated Antibody
C45060	SAB	100ul	EUR 397

Parvalbumin Antibody (Biotin)
abx433096-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Parvalbumin Rabbit mAb
A19098-100ul	Abclonal	100 ul	EUR 410

Parvalbumin Rabbit mAb
A19098-200ul	Abclonal	200 ul	EUR 571

Parvalbumin Rabbit mAb
A19098-20ul	Abclonal	20 ul	EUR 221

Parvalbumin Rabbit mAb
A19098-50ul	Abclonal	50 ul	EUR 287

anti- Parvalbumin antibody
FNab09811	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:400 - 1:2000 IHC: 1:50 - 1:200 Immunogen: peptide Uniprot ID: P20472 Gene ID: 5816
Description: Antibody raised against Parvalbumin

Human PVALB(Parvalbumin) ELISA Kit