Human PVALB(Parvalbumin) ELISA Kit

Human PVALB(Parvalbumin) ELISA Kit

To Order Contact us below: 

Human Parvalbumin (PVALB) ELISA Kit

RDR-PVALB-Hu-96Tests 96 Tests
EUR 756

Human Parvalbumin (PVALB) ELISA Kit

RD-PVALB-Hu-48Tests 48 Tests
EUR 521

Human Parvalbumin (PVALB) ELISA Kit

RD-PVALB-Hu-96Tests 96 Tests
EUR 723

Rat Parvalbumin (PVALB) ELISA Kit

DLR-PVALB-Ra-48T 48T
EUR 549
  • Should the Rat Parvalbumin (PVALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Parvalbumin (PVALB) in samples from serum, plasma or other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit

DLR-PVALB-Ra-96T 96T
EUR 718
  • Should the Rat Parvalbumin (PVALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Parvalbumin (PVALB) in samples from serum, plasma or other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit

RDR-PVALB-Ra-48Tests 48 Tests
EUR 583

Rat Parvalbumin (PVALB) ELISA Kit

RDR-PVALB-Ra-96Tests 96 Tests
EUR 811

Rat Parvalbumin (PVALB) ELISA Kit

RD-PVALB-Ra-48Tests 48 Tests
EUR 557

Rat Parvalbumin (PVALB) ELISA Kit

RD-PVALB-Ra-96Tests 96 Tests
EUR 775

Human Parvalbumin (PVALB)ELISA Kit

201-12-2942 96 tests
EUR 440
  • This Parvalbumin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Parvalbumin (PVALB) ELISA Kit

20-abx152652
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Parvalbumin(PVALB)ELISA Kit

QY-E00855 96T
EUR 361

Human Parvalbumin ELISA Kit (PVALB)

RK02169 96 Tests
EUR 521

Human Parvalbumin (PVALB) ELISA Kit

SEG439Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Parvalbumin (PVALB) ELISA Kit

SEG439Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Parvalbumin (PVALB) ELISA Kit

SEG439Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Parvalbumin (PVALB) ELISA Kit

SEG439Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Parvalbumin (PVALB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Parvalbumin (PVALB) ELISA Kit

4-SEG439Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Parvalbumin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Parvalbumin (PVALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Parvalbumin (PVALB) ELISA Kit

20-abx155947
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Parvalbumin(PVALB)ELISA kit

QY-E10201 96T
EUR 361

Mouse Parvalbumin(PVALB)ELISA kit

QY-E21141 96T
EUR 361

Rat Parvalbumin (PVALB) ELISA Kit

SEG439Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit

SEG439Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit

SEG439Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit

SEG439Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Parvalbumin (PVALB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Parvalbumin (PVALB) in serum, plasma and other biological fluids.

Rat Parvalbumin (PVALB) ELISA Kit

4-SEG439Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Parvalbumin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Parvalbumin (PVALB) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Parvalbumin alpha (PVALB) ELISA Kit

abx250713-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human PVALB/ Parvalbumin alpha ELISA Kit

E2099Hu 1 Kit
EUR 605

Human PVALB(Parvalbumin alpha) ELISA Kit

EH1436 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P20472
  • Alias: PVALB/Parvalbumin alpha
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Parvalbumin alpha, PVALB ELISA KIT

ELI-15681h 96 Tests
EUR 824

ELISA kit for Human PVALB (Parvalbumin)

ELK4148 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Parvalbumin (PVALB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Parvalbumin (P
  • Show more
Description: A sandwich ELISA kit for detection of Parvalbumin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Parvalbumin (PVALB) Antibody

20-abx214662
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Parvalbumin (PVALB) Antibody

20-abx218086
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Parvalbumin (PVALB) Antibody

20-abx177926
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Parvalbumin (PVALB) Antibody

20-abx177927
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Parvalbumin (PVALB) Antibody

20-abx173965
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Parvalbumin (PVALB) Antibody

20-abx173966
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Parvalbumin (PVALB) Antibody

abx239836-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Parvalbumin (PVALB) Antibody

20-abx242310
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Parvalbumin (PVALB) Antibody

abx433095-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human Parvalbumin (PVALB) CLIA Kit

20-abx495197
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Parvalbumin alpha (PVALB)

1-CSB-EP019092HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Parvalbumin alpha(PVALB) expressed in E.coli

Human Parvalbumin (PVALB) Protein

20-abx654662
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Parvalbumin alpha (PVALB) ELISA Kit

abx256462-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Pvalb/ Parvalbumin alpha ELISA Kit

E0824Ra 1 Kit
EUR 646

Mouse Pvalb/ Parvalbumin alpha ELISA Kit

E1232Mo 1 Kit
EUR 632

Rabbit Parvalbumin alpha, PVALB ELISA KIT

ELI-16808Ra 96 Tests
EUR 928

Bovine Parvalbumin alpha, PVALB ELISA KIT

ELI-22372b 96 Tests
EUR 928

Mouse Parvalbumin alpha, Pvalb ELISA KIT

ELI-30562m 96 Tests
EUR 865

Cow Parvalbumin alpha (PVALB) ELISA Kit

abx516082-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Parvalbumin alpha (PVALB) ELISA Kit

abx516084-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Rat PVALB (Parvalbumin)

ELK6317 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Parvalbumin (PVALB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Parvalbumin (P
  • Show more
Description: A sandwich ELISA kit for detection of Parvalbumin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Pvalb(Parvalbumin alpha) ELISA Kit

ER0485 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P02625
  • Alias: Pvalb/PVALB
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Parvalbumin (PVALB) CLIA Kit

20-abx495198
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Parvalbumin Alpha (PVALB) Antibody

20-abx318361
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat Parvalbumin (PVALB) Protein

20-abx654663
  • EUR 885.00
  • EUR 328.00
  • EUR 2834.00
  • EUR 1052.00
  • EUR 606.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Parvalbumin Alpha (PVALB) Antibody

20-abx002095
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Parvalbumin alpha (PVALB) Antibody

32295-05111 150 ug
EUR 261

PVALB Parvalbumin Human Recombinant Protein

PROTP20472 Regular: 25ug
EUR 317
Description: PVALB Human Recombinant fused with a 24 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 134 amino acids (1-110 a.a.) and having a molecular mass of 14.6kDa. The PVALB is purified by proprietary chromatographic techniques.

Pvalb ELISA Kit| Rat Parvalbumin alpha ELISA Kit

EF017325 96 Tests
EUR 689

Pvalb ELISA Kit| Mouse Parvalbumin alpha ELISA Kit

EF015801 96 Tests
EUR 689

PVALB ELISA Kit| Bovine Parvalbumin alpha ELISA Kit

EF011716 96 Tests
EUR 689

Parvalbumin Alpha (PVALB) Antibody (HRP)

20-abx305003
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Parvalbumin Alpha (PVALB) Antibody (FITC)

20-abx305004
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Parvalbumin Alpha (PVALB) Antibody (Biotin)

20-abx305005
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PVALB Parvalbumin Rat Recombinant Protein

PROTP02625 Regular: 10ug
EUR 441
Description: Recombinant Rat Parvalbumin produced in E.Coli.;The Rat Parvalbumin is purified by proprietary chromatographic techniques.

Human Parvalbumin alpha (PVALB) Antibody (Biotin Conjugate)

32295-05121 150 ug
EUR 369

Recombinant Human Parvalbumin α/PVALB (C-6His)

C157-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Parvalbumin α/PVALB (C-6His)

C157-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Parvalbumin α/PVALB (C-6His)

C157-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Parvalbumin α/PVALB (C-6His)

C157-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Polyclonal PVALB / Parvalbumin Antibody (aa51-100)

APR13030G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PVALB / Parvalbumin (aa51-100). This antibody is tested and proven to work in the following applications:

Polyclonal PVALB / Parvalbumin Antibody (C-Terminus)

APR13031G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PVALB / Parvalbumin (C-Terminus). This antibody is tested and proven to work in the following applications:

Human Parvalbumin alpha (PVALB) AssayLite Antibody (FITC Conjugate)

32295-05141 150 ug
EUR 428

Human Parvalbumin alpha (PVALB) AssayLite Antibody (RPE Conjugate)

32295-05151 150 ug
EUR 428

Human Parvalbumin alpha (PVALB) AssayLite Antibody (APC Conjugate)

32295-05161 150 ug
EUR 428

Human Parvalbumin alpha (PVALB) AssayLite Antibody (PerCP Conjugate)

32295-05171 150 ug
EUR 471

Pvalb/ Rat Pvalb ELISA Kit

ELI-52399r 96 Tests
EUR 886

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-100ug

QP6558-ec-100ug 100ug
EUR 408

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-10ug

QP6558-ec-10ug 10ug
EUR 200

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-1mg

QP6558-ec-1mg 1mg
EUR 1632

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-200ug

QP6558-ec-200ug 200ug
EUR 634

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-500ug

QP6558-ec-500ug 500ug
EUR 1060

Recombinant Human Parvalbumin/ PVALB Protein, His-SUMO, E.coli-50ug

QP6558-ec-50ug 50ug
EUR 263

Human PVALB ELISA Kit

ELA-E12618h 96 Tests
EUR 824

PVALB ELISA KIT|Human

EF004871 96 Tests
EUR 689

Human Parvalbumin a ELISA kit

E01P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Parvalbumin a ELISA kit

E01P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Parvalbumin a ELISA kit

E01P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Parvalbumin alpha

EK3078 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

Parvalbumin

AT210 1mg
EUR 1114

Parvalbumin

CH22119 100 ul
EUR 435

Parvalbumin

AG210 1 mg
EUR 523

Parvalbumin

MO22149 100 ul
EUR 435

Parvalbumin

RA24428 100 ul
EUR 539

Rat Parvalbumin a ELISA kit

E02P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Parvalbumin a ELISA kit

E02P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Parvalbumin a ELISA kit

E02P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Parvalbumin a ELISA kit

E04P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Parvalbumin a ELISA kit

E04P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Parvalbumin a ELISA kit

E04P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Parvalbumin a ELISA kit

E03P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Parvalbumin a ELISA kit

E03P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Parvalbumin a ELISA kit

E03P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Parvalbumin a ELISA kit

E08P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Parvalbumin a ELISA kit

E08P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Parvalbumin a ELISA kit

E08P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Parvalbumin a ELISA kit

E06P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Parvalbumin a ELISA kit

E06P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Parvalbumin a ELISA kit

E06P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Parvalbumin a ELISA kit

E07P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Parvalbumin a ELISA kit

E07P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Parvalbumin a ELISA kit

E07P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Parvalbumin a ELISA kit

E09P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Parvalbumin a ELISA kit

E09P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Parvalbumin a ELISA kit

E09P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Recombinant Human Parvalbumin

7-05803 5µg Ask for price

Recombinant Human Parvalbumin

7-05804 25µg Ask for price

Recombinant Human Parvalbumin

7-05805 1mg Ask for price

PVALB Antibody

35902-100ul 100ul
EUR 252

PVALB antibody

38467-100ul 100ul
EUR 252

PVALB Antibody

1-CSB-PA648142
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

PVALB Antibody

DF7083 200ul
EUR 304
Description: PVALB Antibody detects endogenous levels of total PVALB.

PVALB Antibody

1-CSB-PA263723
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PVALB Antibody

1-CSB-PA019092HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PVALB. Recognizes PVALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PVALB siRNA

20-abx904386
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PVALB siRNA

20-abx930475
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PVALB siRNA

20-abx930476
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PVALB Antibody

ABD7083 100 ug
EUR 438

Guinea pig Parvalbumin a ELISA kit

E05P0002-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Parvalbumin a ELISA kit

E05P0002-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Parvalbumin a ELISA kit

E05P0002-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Parvalbumin a in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Parvalbumin alpha

EK3076 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Parvalbumin alpha

EK3077 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Parvalbumin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

Parvalbumin Antibody

49428-100ul 100ul
EUR 333

Parvalbumin Antibody

49428-50ul 50ul
EUR 239

Parvalbumin Antibody

45060-100ul 100ul
EUR 252

Parvalbumin Antibody

45060-50ul 50ul
EUR 187

Parvalbumin Antibody

DF7544 200ul
EUR 304
Description: Parvalbumin Antibody detects endogenous levels of total Parvalbumin.

Parvalbumin Protein

20-abx260065
  • EUR 3042.00
  • EUR 495.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Parvalbumin Protein

20-abx261700
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Parvalbumin Antibody

ABD7544 100 ug
EUR 438

Parvalbumin antibody

PAab09811 100 ug
EUR 386

Human PVALB shRNA Plasmid

20-abx953931
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PVALB Recombinant Protein (Human)

RP025294 100 ug Ask for price

PVALB Rabbit pAb

A13538-100ul 100 ul
EUR 308

PVALB Rabbit pAb

A13538-200ul 200 ul
EUR 459

PVALB Rabbit pAb

A13538-20ul 20 ul
EUR 183

PVALB Rabbit pAb

A13538-50ul 50 ul
EUR 223

PVALB Blocking Peptide

DF7083-BP 1mg
EUR 195

Polyclonal PVALB Antibody

APR13032G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PVALB . This antibody is tested and proven to work in the following applications:

PVALB Conjugated Antibody

C35902 100ul
EUR 397

PVALB Conjugated Antibody

C38467 100ul
EUR 397

PVALB cloning plasmid

CSB-CL019092HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtcgatgacagacttgctgaacgctgaggacatcaagaaggcggtgggagcctttagcgctaccgactccttcgaccacaaaaagttcttccaaatggtcggcctgaagaaaaagagtgcggatgatgtgaagaaggtgtttcacatgctggacaaggacaaaagtggcttcat
  • Show more
Description: A cloning plasmid for the PVALB gene.

PVALB Polyclonal Antibody

A57009 100 µg
EUR 570.55
Description: kits suitable for this type of research

PVALB Rabbit pAb

A2791-100ul 100 ul
EUR 308

PVALB Rabbit pAb

A2791-200ul 200 ul
EUR 459

PVALB Rabbit pAb

A2791-20ul 20 ul
EUR 183

PVALB Rabbit pAb

A2791-50ul 50 ul
EUR 223

Anti-PVALB antibody

STJ25239 100 µl
EUR 277
Description: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants.

Anti-PVALB antibody

STJ115499 100 µl
EUR 277
Description: The protein encoded by this gene is a high affinity calcium ion-binding protein that is structurally and functionally similar to calmodulin and troponin C. The encoded protein is thought to be involved in muscle relaxation. Alternative splicing results in multiple transcript variants.

Recombinant Rat Parvalbumin

7-05806 2µg Ask for price

Recombinant Rat Parvalbumin

7-05807 10µg Ask for price

Recombinant Rat Parvalbumin

7-05808 100µg Ask for price

Parvalbumin Blocking Peptide

DF7544-BP 1mg
EUR 195

Parvalbumin beta Antibody

1-CSB-PA365766HA01GAA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Parvalbumin beta. Recognizes Parvalbumin beta from Gadus morhua subsp. This antibody is Unconjugated. Tested in the following application: ELISA

Parvalbumin alpha antibody

70R-50297 100 ul
EUR 244
Description: Purified Polyclonal Parvalbumin alpha antibody

Parvalbumin alpha Antibody

20-abx008795
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Parvalbumin beta Antibody

20-abx110580
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Parvalbumin Conjugated Antibody

C49428 100ul
EUR 397

Parvalbumin Conjugated Antibody

C45060 100ul
EUR 397

Parvalbumin Antibody (Biotin)

abx433096-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Parvalbumin Rabbit mAb

A19098-100ul 100 ul
EUR 410

Parvalbumin Rabbit mAb

A19098-200ul 200 ul
EUR 571

Parvalbumin Rabbit mAb

A19098-20ul 20 ul
EUR 221

Parvalbumin Rabbit mAb

A19098-50ul 50 ul
EUR 287

anti- Parvalbumin antibody

FNab09811 100µg
EUR 548.75
  • Recommended dilution: WB: 1:400 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: peptide
  • Uniprot ID: P20472
  • Gene ID: 5816
Description: Antibody raised against Parvalbumin

Human PVALB(Parvalbumin) ELISA Kit