Mouse IL28A(Interleukin 28A) ELISA Kit

Mouse IL28A(Interleukin 28A) ELISA Kit

To Order Contact us below: 

    Mouse Interleukin 28A (IL28A) ELISA Kit
    RDR-IL28A-Mu-96Tests 96 Tests
    EUR 651
    Human Interleukin 28A (IL28A) ELISA Kit
    DLR-IL28A-Hu-48T 48T
    EUR 444
    • Should the Human Interleukin 28A (IL28A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 28A (IL28A) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Interleukin 28A (IL28A) ELISA Kit
    DLR-IL28A-Hu-96T 96T
    EUR 573
    • Should the Human Interleukin 28A (IL28A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 28A (IL28A) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Interleukin 28A (IL28A) ELISA Kit
    RD-IL28A-Hu-48Tests 48 Tests
    EUR 439
    Human Interleukin 28A (IL28A) ELISA Kit
    RD-IL28A-Hu-96Tests 96 Tests
    EUR 606
    Human Interleukin 28A (IL28A) ELISA Kit
    RDR-IL28A-Hu-48Tests 48 Tests
    EUR 458
    Human Interleukin 28A (IL28A) ELISA Kit
    RDR-IL28A-Hu-96Tests 96 Tests
    EUR 633
    Mouse Interleukin 28A (IL28A) ELISA Kit
    abx574962-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Mouse Il28a/ Interleukin-28A ELISA Kit
    E0771Mo 1 Kit
    EUR 546
    Mouse Interleukin- 28A, Il28a ELISA KIT
    ELI-05512m 96 Tests
    EUR 865
    Mouse Interleukin 28A (IL28A) ELISA Kit
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Mouse Interleukin 28A (IL28A) ELISA Kit
    SEB689Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4626.78
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Mouse Interleukin 28A (IL28A) ELISA Kit
    SEB689Mu-1x48wellstestplate 1x48-wells test plate
    EUR 468.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Mouse Interleukin 28A (IL28A) ELISA Kit
    SEB689Mu-1x96wellstestplate 1x96-wells test plate
    EUR 626.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Mouse Interleukin 28A (IL28A) ELISA Kit
    SEB689Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2520.06
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Mouse Interleukin 28A (IL28A) ELISA Kit
    • EUR 4677.00
    • EUR 2471.00
    • EUR 627.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 28A elisa. Alternative names of the recognized antigen: IFNL2
    • Interferon, Lambda 2
    • Cytokine Zcyto20
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Interleukin 28A (IL28A) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Mouse Interleukin 28A (IL28A) Protein
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Mouse Interleukin 28A (IL28A) Protein
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Interleukin-28A (IL28A) Antibody
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.
    Interleukin 28A (IL28A) Antibody
    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Interleukin 28A (IL28A) Antibody
    • EUR 328.00
    • EUR 815.00
    • EUR 425.00
    • EUR 154.00
    • EUR 258.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Interleukin 28A (IL28A) Antibody
    • EUR 328.00
    • EUR 815.00
    • EUR 425.00
    • EUR 154.00
    • EUR 258.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Interleukin 28A (IL28A) Antibody
    • EUR 328.00
    • EUR 815.00
    • EUR 425.00
    • EUR 154.00
    • EUR 258.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Interleukin-28A (IL28A) Antibody
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Interleukin 28A (IL28A) Antibody
    • EUR 815.00
    • EUR 425.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Interleukin 28A (IL28A) Antibody
    • EUR 1177.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Interleukin 28A (IL28A) Antibody
    • EUR 1177.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Interleukin-28A (IL28A) Antibody
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Interleukin-28A (IL28A) Antibody
    abx224240-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.
    Interleukin-28A (IL28A) Antibody
    abx224382-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.
    Recombinant Interleukin 28A (IL28A)
    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q8IZJ0
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 52.1kDa
    • Isoelectric Point: 7.1
    Description: Recombinant Human Interleukin 28A expressed in: E.coli
    Mouse Interleukin 28A (IL28A)CLIA Kit
    SCB689Mu-10x96wellstestplate 10x96-wells test plate
    EUR 5804.88
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 28A (IL28A) in serum, plasma and other biological fluids.
    Mouse Interleukin 28A (IL28A)CLIA Kit
    SCB689Mu-1x48wellstestplate 1x48-wells test plate
    EUR 565.7
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 28A (IL28A) in serum, plasma and other biological fluids.
    Mouse Interleukin 28A (IL28A)CLIA Kit
    SCB689Mu-1x96wellstestplate 1x96-wells test plate
    EUR 765.28
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 28A (IL28A) in serum, plasma and other biological fluids.
    Mouse Interleukin 28A (IL28A)CLIA Kit
    SCB689Mu-5x96wellstestplate 5x96-wells test plate
    EUR 3143.76
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Interleukin 28A (IL28A) in serum, plasma and other biological fluids.
    Mouse Interleukin 28A (IL28A) CLIA Kit
    • EUR 5855.00
    • EUR 3144.00
    • EUR 766.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 28A Clia kit. Alternative names of the recognized antigen: IFNL2
    • Interferon, Lambda 2
    • Cytokine Zcyto20
    Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Mouse Interleukin 28A (IL28A)Serum, plasma and other biological fluids
    ELISA kit for Mouse IL28A (Interleukin 28A)
    ELK4006 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 28A (IL28A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki
    • Show more
    Description: A sandwich ELISA kit for detection of Interleukin 28A from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Human Interleukin 28A (IL28A) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Interleukin 28A (IL28A) ELISA Kit
    abx574504-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human IL28A/ Interleukin-28A ELISA Kit
    E1286Hu 1 Kit
    EUR 571
    Human Interleukin- 28A, IL28A ELISA KIT
    ELI-05511h 96 Tests
    EUR 824
    Human Interleukin 28A (IL28A) ELISA Kit
    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Interleukin 28A (IL28A) ELISA Kit
    abx251260-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Interleukin 28A (IL28A) ELISA Kit
    SEB689Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4502.43
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Interleukin 28A (IL28A) ELISA Kit
    SEB689Hu-1x48wellstestplate 1x48-wells test plate
    EUR 458.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Interleukin 28A (IL28A) ELISA Kit
    SEB689Hu-1x96wellstestplate 1x96-wells test plate
    EUR 612.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Interleukin 28A (IL28A) ELISA Kit
    SEB689Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2454.23
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Interleukin 28A (IL28A) ELISA Kit
    • EUR 4553.00
    • EUR 2405.00
    • EUR 613.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 28A elisa. Alternative names of the recognized antigen: IFNL2
    • Interferon, Lambda 2
    • Cytokine Zcyto20
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 28A (IL28A) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Mini Samples Mouse Interleukin 28A (IL28A) ELISA Kit
    MEB689Mu-10x96wellstestplate 10x96-wells test plate
    EUR 5523.45
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28A (IL28A).
    Mini Samples Mouse Interleukin 28A (IL28A) ELISA Kit
    MEB689Mu-1x48wellstestplate 1x48-wells test plate
    EUR 542.52
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28A (IL28A).
    Mini Samples Mouse Interleukin 28A (IL28A) ELISA Kit
    MEB689Mu-1x96wellstestplate 1x96-wells test plate
    EUR 732.17
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28A (IL28A).
    Mini Samples Mouse Interleukin 28A (IL28A) ELISA Kit
    MEB689Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2994.77
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28A (IL28A).
    Mini Samples Mouse Interleukin 28A (IL28A) ELISA Kit
    • EUR 5574.00
    • EUR 2945.00
    • EUR 733.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 28A elisa. Alternative names of the recognized antigen: IFNL2
    • Interferon, Lambda 2
    • Cytokine Zcyto20
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 28A (IL28A) in samples from n/a with no significant corss-reactivity with analogues from other species.
    Human Interleukin 28A (IL28A) Protein
    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Interleukin 28A (IL28A) Antibody (Biotin)
    • EUR 342.00
    • EUR 203.00
    • EUR 885.00
    • EUR 453.00
    • EUR 300.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Interleukin 28A (IL28A) Antibody Pair
    • EUR 1664.00
    • EUR 1066.00
    • 10 × 96 tests
    • 5 × 96 tests
    • Shipped within 5-12 working days.
    ELISA kit for Human IL28A (Interleukin 28A)
    ELK2147 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 28A (IL28A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki
    • Show more
    Description: A sandwich ELISA kit for detection of Interleukin 28A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Human Interleukin 28A (IL28A) CLIA Kit
    • EUR 7911.00
    • EUR 4215.00
    • EUR 973.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 20 working days.
    Human Interleukin 28A (IL28A)CLIA Kit
    SCB689Hu-10x96wellstestplate 10x96-wells test plate
    EUR 5647.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Interleukin 28A (IL28A)CLIA Kit
    SCB689Hu-1x48wellstestplate 1x48-wells test plate
    EUR 552.76
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Interleukin 28A (IL28A)CLIA Kit
    SCB689Hu-1x96wellstestplate 1x96-wells test plate
    EUR 746.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Interleukin 28A (IL28A)CLIA Kit
    SCB689Hu-5x96wellstestplate 5x96-wells test plate
    EUR 3060.6
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Interleukin 28A (IL28A) CLIA Kit
    • EUR 5698.00
    • EUR 3061.00
    • EUR 747.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 28A Clia kit. Alternative names of the recognized antigen: IFNL2
    • Interferon, Lambda 2
    • Cytokine Zcyto20
    Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 28A (IL28A)serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids
    High Sensitive Human Interleukin 28A (IL28A) ELISA Kit
    HEB689Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4927.85
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assa
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    High Sensitive Human Interleukin 28A (IL28A) ELISA Kit
    HEB689Hu-1x48wellstestplate 1x48-wells test plate
    EUR 493.47
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assa
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    High Sensitive Human Interleukin 28A (IL28A) ELISA Kit
    HEB689Hu-1x96wellstestplate 1x96-wells test plate
    EUR 662.1
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assa
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    High Sensitive Human Interleukin 28A (IL28A) ELISA Kit
    HEB689Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2679.45
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28A (IL28A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assa
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28A (IL28A) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    High Sensitive Human Interleukin 28A (IL28A) ELISA Kit
    • EUR 4978.00
    • EUR 2630.00
    • EUR 663.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 28A elisa. Alternative names of the recognized antigen: IFNL2
    • Interferon, Lambda 2
    • Cytokine Zcyto20
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Interleukin 28A (IL28A) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Interleukin 28A (IL28A) Protein (Active)
    • EUR 1038.00
    • EUR 356.00
    • EUR 3460.00
    • EUR 1261.00
    • EUR 718.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Interleukin 28A (IL28A) Polyclonal Antibody (Human)
    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL28A (Val26~Val200)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Interleukin 28A (IL28A)
    Interleukin 28A (IL28A) Monoclonal Antibody (Human)
    • EUR 247.00
    • EUR 2523.00
    • EUR 628.00
    • EUR 311.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A)
    Interleukin 28A (IL28A) Monoclonal Antibody (Human)
    • EUR 247.00
    • EUR 2523.00
    • EUR 628.00
    • EUR 311.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A)
    Interleukin 28A (IL28A) Monoclonal Antibody (Human)
    • EUR 247.00
    • EUR 2523.00
    • EUR 628.00
    • EUR 311.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A)
    Interleukin 28A (IL28A) Polyclonal Antibody (Human), APC
    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL28A (Val26~Val200)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with APC.
    Interleukin 28A (IL28A) Polyclonal Antibody (Human), Biotinylated
    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL28A (Val26~Val200)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with Biotin.
    Interleukin 28A (IL28A) Polyclonal Antibody (Human), Cy3
    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL28A (Val26~Val200)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with Cy3.
    Interleukin 28A (IL28A) Polyclonal Antibody (Human), FITC
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL28A (Val26~Val200)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with FITC.
    Interleukin 28A (IL28A) Polyclonal Antibody (Human), HRP
    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL28A (Val26~Val200)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with HRP.
    Interleukin 28A (IL28A) Polyclonal Antibody (Human), PE
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL28A (Val26~Val200)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with PE.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), APC
    • EUR 346.00
    • EUR 3293.00
    • EUR 917.00
    • EUR 441.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with APC.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), Biotinylated
    • EUR 312.00
    • EUR 2473.00
    • EUR 730.00
    • EUR 382.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with Biotin.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), Cy3
    • EUR 420.00
    • EUR 4349.00
    • EUR 1181.00
    • EUR 547.00
    • EUR 252.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with Cy3.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), FITC
    • EUR 297.00
    • EUR 2654.00
    • EUR 753.00
    • EUR 373.00
    • EUR 196.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with FITC.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2870.00
    • EUR 811.00
    • EUR 399.00
    • EUR 207.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with HRP.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), PE
    • EUR 297.00
    • EUR 2654.00
    • EUR 753.00
    • EUR 373.00
    • EUR 196.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with PE.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), APC
    • EUR 346.00
    • EUR 3293.00
    • EUR 917.00
    • EUR 441.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with APC.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), Biotinylated
    • EUR 312.00
    • EUR 2473.00
    • EUR 730.00
    • EUR 382.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with Biotin.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), Cy3
    • EUR 420.00
    • EUR 4349.00
    • EUR 1181.00
    • EUR 547.00
    • EUR 252.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with Cy3.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), FITC
    • EUR 297.00
    • EUR 2654.00
    • EUR 753.00
    • EUR 373.00
    • EUR 196.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with FITC.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2870.00
    • EUR 811.00
    • EUR 399.00
    • EUR 207.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with HRP.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), PE
    • EUR 297.00
    • EUR 2654.00
    • EUR 753.00
    • EUR 373.00
    • EUR 196.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with PE.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), APC
    • EUR 346.00
    • EUR 3293.00
    • EUR 917.00
    • EUR 441.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with APC.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), Biotinylated
    • EUR 312.00
    • EUR 2473.00
    • EUR 730.00
    • EUR 382.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with Biotin.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), Cy3
    • EUR 420.00
    • EUR 4349.00
    • EUR 1181.00
    • EUR 547.00
    • EUR 252.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with Cy3.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), FITC
    • EUR 297.00
    • EUR 2654.00
    • EUR 753.00
    • EUR 373.00
    • EUR 196.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with FITC.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2870.00
    • EUR 811.00
    • EUR 399.00
    • EUR 207.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with HRP.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), PE
    • EUR 297.00
    • EUR 2654.00
    • EUR 753.00
    • EUR 373.00
    • EUR 196.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with PE.
    Mouse Interleukin 28A(IL-28A) ELISA Kit
    CSB-E17651m-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 28A (IL-28A) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Mouse Interleukin 28A(IL-28A) ELISA Kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 28A(IL-28A) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Interleukin 28A (IL28A) Polyclonal Antibody (Human), APC-Cy7
    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: IL28A (Val26~Val200)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with APC-Cy7.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), APC-Cy7
    • EUR 572.00
    • EUR 6466.00
    • EUR 1714.00
    • EUR 763.00
    • EUR 320.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with APC-Cy7.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), APC-Cy7
    • EUR 572.00
    • EUR 6466.00
    • EUR 1714.00
    • EUR 763.00
    • EUR 320.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with APC-Cy7.
    Interleukin 28A (IL28A) Monoclonal Antibody (Human), APC-Cy7
    • EUR 572.00
    • EUR 6466.00
    • EUR 1714.00
    • EUR 763.00
    • EUR 320.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Val26~Val200
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Interleukin 28A (IL28A). This antibody is labeled with APC-Cy7.
    Human IL-28A(Interleukin-28A) ELISA Kit
    EH0194 96T
    EUR 567.6
    • Detection range: 31.2-2000 pg/ml
    • Uniprot ID: Q8IZJ0
    • Alias: IL-28A/Cytokine Zcyto20/Interferon lambda-2(IFN-lambda-2)
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
    ELISA kit for Mouse Interleukin-28A
    EK3878 96 tests
    EUR 469
    Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Interleukin-28A in samples from serum, plasma, tissue homogenates and other biological fluids.
    Recombinant Human IL-28A/IL28A Protein
    RP00231 10 μg
    EUR 164
    ELISA kit for Human IL-28A (Interleukin 28A)
    E-EL-H5507 1 plate of 96 wells
    EUR 534
    • Gentaur's IL-28A ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-28A. Standards or samples are added to the micro ELISA plate wells and combined wit
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human IL-28A (Interleukin 28A) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for Rat Interleukin 28A (IL-28A)
    KTE100888-48T 48T
    EUR 332
    • Interleukin-28 (IL-28) is a cytokine that comes in two isoforms, IL-28A and IL-28B, and plays a role in immune defense against viruses, including the induction an "antiviral state" by turning on Mx proteins, 2',5'-oligoadenylate synthetase as well as
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Interleukin 28A (IL-28A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Rat Interleukin 28A (IL-28A)
    KTE100888-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Interleukin-28 (IL-28) is a cytokine that comes in two isoforms, IL-28A and IL-28B, and plays a role in immune defense against viruses, including the induction an "antiviral state" by turning on Mx proteins, 2',5'-oligoadenylate synthetase as well as
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Interleukin 28A (IL-28A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Rat Interleukin 28A (IL-28A)
    KTE100888-96T 96T
    EUR 539
    • Interleukin-28 (IL-28) is a cytokine that comes in two isoforms, IL-28A and IL-28B, and plays a role in immune defense against viruses, including the induction an "antiviral state" by turning on Mx proteins, 2',5'-oligoadenylate synthetase as well as
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Interleukin 28A (IL-28A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Interleukin-28A (IL-28A) Antibody
    abx234261-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.
    Interleukin-28A (IL-28A) Antibody
    abx234262-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.
    Human Interleukin 28A(IL-28A/IFN-λ2)ELISA Kit
    GA-E0096HM-48T 48T
    EUR 289
    Human Interleukin 28A(IL-28A/IFN-λ2)ELISA Kit
    GA-E0096HM-96T 96T
    EUR 466
    Human Interleukin 28A,IL-28A/IFN-?2 ELISA Kit
    201-12-0057 96 tests
    EUR 440
    • This Interleukin 28A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Interleukin 28A(IL-28A/IFN-λ2)ELISA Kit
    QY-E04283 96T
    EUR 361
    IL-28A Interleukin-28A Mouse Recombinant Protein
    PROTQ4VK74 Regular: 20ug
    EUR 317
    Description: Recombinant Mouse Interleukin-28A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 174 amino acids and having a total molecular mass of 19.7kDa.;The IL-28A is purified by proprietary chromatographic techniques.
    ELISA kit for Human Interleukin-28A
    EK3877 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-28A in samples from serum, plasma, tissue homogenates and other biological fluids.
    Human Interleukin 28A, IL-28A/IFN-λ2 ELISA kit
    CSB-E11708h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 28A, IL-28A/IFN-λ2 in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Interleukin 28A, IL-28A/IFN-λ2 ELISA kit
    • EUR 500.00
    • EUR 3402.00
    • EUR 1820.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 28A, IL-28A/IFN-λ2 in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    IL-28A Interleukin-28A Human Recombinant Protein
    PROTQ8IZJ0-1 Regular: 20ug
    EUR 317
    Description: IL-28A human recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 175 amino acids and having a molecular mass of 19.6 kDa.
    Interleukin-28A (IL28) Antibody
    abx029273-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Interleukin-28A (IL28) Antibody
    abx029273-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Recombinant Human Interleukin-28A
    7-01090 5µg Ask for price
    Recombinant Human Interleukin-28A
    7-01091 20µg Ask for price
    Recombinant Human Interleukin-28A
    7-01092 1mg Ask for price
    IL-28A Interleukin-28A Human Recombinant Protein, HEK
    PROTQ8IZJ0 Regular: 10ug
    EUR 317
    Description: Interleukin-28A Human Recombinant produced in HEK cells is a non-glycosylated monomer, having a total molecular weight of 24kDa.;The IL28A is purified by proprietary chromatographic techniques.
    IL-28A Interleukin-28A Human Recombinant Protein, His Tag
    PROTQ8IZJ0-2 Regular: 10ug
    EUR 317
    Description: IL 28A Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 198 amino acids (26-200 a.a.) and having a molecular mass of 22.1kDa. IL 28A is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    Human IL28A ELISA Kit
    ELA-E1689h 96 Tests
    EUR 824
    Human IL28A ELISA kit
    55R-1967 96 tests
    EUR 617
    Description: ELISA Kit for detection of IL28A in the research laboratory
    Il28a ELISA Kit (Mouse) : 96 Wells (OKEH02796)
    OKEH02796 96 Wells
    EUR 544
    Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.81 pg/mL
    IL-28A ELISA KIT|Human
    EF000158 96 Tests
    EUR 689
    Human IL-28A ELISA Kit
    LF-EK50987 1×96T
    EUR 648
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    IL28A Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    IL28A Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    IL28A antibody
    70R-51218 100 ul
    EUR 244
    Description: Purified Polyclonal IL28A antibody
    IL28A Antibody
    ABD10159 100 ug
    EUR 438
    IL28A Antibody
    44551-100ul 100ul
    EUR 252
    IL28A Antibody
    44551-50ul 50ul
    EUR 187
    IL28A Antibody
    DF10159 200ul
    EUR 304
    Description: IL28A Antibody detects endogenous levels of total IL28A.
    Human IL-28A PicoKine ELISA Kit
    EK0969 96 wells
    EUR 425
    Description: For quantitative detection of human IL-28A in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
    pET- 28a
    PVT0072 2 ug
    EUR 241
    Mouse Interferon Lambda 2 (IL28A) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Il28a ORF Vector (Mouse) (pORF)
    ORF047874 1.0 ug DNA
    EUR 506
    IL28A ELISA Kit (Human) : 96 Wells (OKEH02795)
    OKEH02795 96 Wells
    EUR 662
    Description: Description of target: This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28B (IL28B), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL
    IL28A Conjugated Antibody
    C44551 100ul
    EUR 397
    IL28A Blocking Peptide
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    Anti-IL28A Antibody
    A30781 100ul
    EUR 397
    Description: Rabbit Polyclonal IL28A Antibody. Validated in WB and tested in Human.
    IL28A Blocking Peptide
    DF10159-BP 1mg
    EUR 195
    IL28A cloning plasmid
    CSB-CL816921HU-10ug 10ug
    EUR 279
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 603
    • Sequence: atgaaactagacatgactggggactgcacgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagttcctgtcgccaggctccacggggctctcccggatgcaaggggctgccacatagcccagttcaagtccctgtctccacaggagctgcaggcctttaagag
    • Show more
    Description: A cloning plasmid for the IL28A gene.
    PVTB00118-1a 2 ug
    EUR 356
    pET- 28a Plasmid
    PVT0331 2 ug
    EUR 266
    Mouse Coiled coil domain containing protein 28A(CCDC28A) ELISA kit
    E03C1069-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 28A(CCDC28A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Coiled coil domain containing protein 28A(CCDC28A) ELISA kit
    E03C1069-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 28A(CCDC28A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Coiled coil domain containing protein 28A(CCDC28A) ELISA kit
    E03C1069-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 28A(CCDC28A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Il28a sgRNA CRISPR Lentivector set (Mouse)
    K3341401 3 x 1.0 ug
    EUR 339
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Mouse IL28A(Interleukin 28A) ELISA Kit