Human DSTN(Destrin) ELISA Kit

Human DSTN(Destrin) ELISA Kit

To Order Contact us below: 

Human Destrin (DSTN) ELISA Kit
RD-DSTN-Hu-96Tests 96 Tests
EUR 723
Human Destrin(DSTN) ELISA kit
E01D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Destrin(DSTN) ELISA kit
E01D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Destrin(DSTN) ELISA kit
E01D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Destrin, DSTN ELISA KIT
ELI-09411h 96 Tests
EUR 824
Human Destrin (DSTN) ELISA Kit
20-abx151305
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Destrin (DSTN)ELISA Kit
201-12-2652 96 tests
EUR 440
  • This Destrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Destrin(DSTN)ELISA Kit
QY-E02787 96T
EUR 361
Human Destrin (DSTN) ELISA Kit
SEJ225Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Destrin (DSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Destrin (DSTN) in serum, plasma, tissue homogenates and other biological fluids.
Human Destrin (DSTN) ELISA Kit
SEJ225Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Destrin (DSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Destrin (DSTN) in serum, plasma, tissue homogenates and other biological fluids.
Human Destrin (DSTN) ELISA Kit
SEJ225Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Destrin (DSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Destrin (DSTN) in serum, plasma, tissue homogenates and other biological fluids.
Human Destrin (DSTN) ELISA Kit
SEJ225Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Destrin (DSTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Destrin (DSTN) in serum, plasma, tissue homogenates and other biological fluids.
Human Destrin (DSTN) ELISA Kit
4-SEJ225Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Destrin elisa. Alternative names of the recognized antigen: ADF
  • ACTDP
  • Actin Depolymerizing Factor
  • Actin Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Destrin (DSTN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Goat Destrin(DSTN) ELISA kit
E06D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Destrin(DSTN) ELISA kit
E06D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Destrin(DSTN) ELISA kit
E06D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Destrin(DSTN) ELISA kit
E02D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Destrin(DSTN) ELISA kit
E02D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Destrin(DSTN) ELISA kit
E02D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Destrin(DSTN) ELISA kit
E03D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Destrin(DSTN) ELISA kit
E03D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Destrin(DSTN) ELISA kit
E03D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Destrin(DSTN) ELISA kit
E04D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Destrin(DSTN) ELISA kit
E04D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Destrin(DSTN) ELISA kit
E04D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Destrin(DSTN) ELISA kit
E08D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Destrin(DSTN) ELISA kit
E08D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Destrin(DSTN) ELISA kit
E08D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Destrin(DSTN) ELISA kit
E09D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Destrin(DSTN) ELISA kit
E09D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Destrin(DSTN) ELISA kit
E09D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Destrin(DSTN) ELISA kit
E07D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Destrin(DSTN) ELISA kit
E07D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Destrin(DSTN) ELISA kit
E07D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Chicken Destrin, DSTN ELISA KIT
ELI-26358c 96 Tests
EUR 928
Bovine Destrin, DSTN ELISA KIT
ELI-26463b 96 Tests
EUR 928
Porcine Destrin, DSTN ELISA KIT
ELI-28119p 96 Tests
EUR 928
Mouse Destrin, Dstn ELISA KIT
ELI-46775m 96 Tests
EUR 865
Mouse Destrin (DSTN) ELISA Kit
abx389051-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Destrin (DSTN) ELISA Kit
abx391219-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Destrin (DSTN) Antibody
20-abx125787
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody
20-abx126890
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody
20-abx112047
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody
20-abx129207
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Destrin (DSTN) Antibody
abx034267-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody
abx034267-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody
20-abx172103
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Destrin (DSTN) Protein
20-abx260908
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody
20-abx241214
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody
20-abx241504
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody
20-abx303680
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Destrin (DSTN)
4-RPJ225Hu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P60981
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Destrin expressed in: E.coli
ELISA kit for Human DSTN (Destrin)
ELK3736 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Destrin (DSTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Destrin (DSTN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Destrin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Destrin (DSTN)
KTE62264-48T 48T
EUR 332
  • Destrin belongs to the actin-binding proteins ADF/cofilin family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Destrin (DSTN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Destrin (DSTN)
KTE62264-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Destrin belongs to the actin-binding proteins ADF/cofilin family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Destrin (DSTN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Destrin (DSTN)
KTE62264-96T 96T
EUR 539
  • Destrin belongs to the actin-binding proteins ADF/cofilin family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and bi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Destrin (DSTN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Destrin (DSTN) CLIA Kit
20-abx495639
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Destrin (DSTN) Protein
20-abx168214
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Guinea pig Destrin(DSTN) ELISA kit
E05D0295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Destrin(DSTN) ELISA kit
E05D0295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Destrin(DSTN) ELISA kit
E05D0295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Destrin(DSTN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dstn ELISA Kit| Rat Destrin ELISA Kit
EF018573 96 Tests
EUR 689
Dstn ELISA Kit| Mouse Destrin ELISA Kit
EF014680 96 Tests
EUR 689
DSTN ELISA Kit| chicken Destrin ELISA Kit
EF012280 96 Tests
EUR 689
DSTN ELISA Kit| Bovine Destrin ELISA Kit
EF011309 96 Tests
EUR 689
Destrin (DSTN) Antibody (HRP)
20-abx303681
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody (FITC)
20-abx303682
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Destrin (DSTN) Antibody (Biotin)
20-abx303683
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Destrin (DSTN) Polyclonal Antibody (Human)
4-PAJ225Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DSTN (Met1~Val165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Destrin (DSTN)
DSTN Destrin Human Recombinant Protein
PROTP60981 Regular: 20ug
EUR 317
Description: DSTN Human Recombinant produced in E. coli is a single polypeptide chain containing 173 amino acids (1-165) and having a molecular mass of 19.5 kDa.;DSTN is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.
Destrin (DSTN) Polyclonal Antibody (Human), APC
4-PAJ225Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DSTN (Met1~Val165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Destrin (DSTN). This antibody is labeled with APC.
Destrin (DSTN) Polyclonal Antibody (Human), Biotinylated
4-PAJ225Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DSTN (Met1~Val165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Destrin (DSTN). This antibody is labeled with Biotin.
Destrin (DSTN) Polyclonal Antibody (Human), Cy3
4-PAJ225Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DSTN (Met1~Val165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Destrin (DSTN). This antibody is labeled with Cy3.
Destrin (DSTN) Polyclonal Antibody (Human), FITC
4-PAJ225Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DSTN (Met1~Val165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Destrin (DSTN). This antibody is labeled with FITC.
Destrin (DSTN) Polyclonal Antibody (Human), HRP
4-PAJ225Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DSTN (Met1~Val165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Destrin (DSTN). This antibody is labeled with HRP.
Destrin (DSTN) Polyclonal Antibody (Human), PE
4-PAJ225Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DSTN (Met1~Val165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Destrin (DSTN). This antibody is labeled with PE.
Destrin (DSTN) Polyclonal Antibody (Human), APC-Cy7
4-PAJ225Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DSTN (Met1~Val165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Destrin (DSTN). This antibody is labeled with APC-Cy7.
Dstn/ Rat Dstn ELISA Kit
ELI-26359r 96 Tests
EUR 886
DSTN ELISA KIT|Human
EF004857 96 Tests
EUR 689
Destrin antibody
ABF9259 100 ug
EUR 438
Destrin antibody
70R-3884 50 ug
EUR 467
Description: Rabbit polyclonal Destrin antibody
Human DSTN Antibody
33410-05111 150 ug
EUR 261
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
DSTN siRNA
20-abx901592
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DSTN siRNA
20-abx914672
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DSTN siRNA
20-abx914673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DSTN Antibody
36414-100ul 100ul
EUR 252
DSTN antibody
10R-6895 100 ul
EUR 691
Description: Mouse monoclonal DSTN antibody
DSTN antibody
10R-3897 100 ul
EUR 726
Description: Mouse monoclonal DSTN antibody
DSTN antibody
10R-3901 100 ul
EUR 691
Description: Mouse monoclonal DSTN antibody
DSTN antibody
10R-3902 100 ul
EUR 691
Description: Mouse monoclonal DSTN antibody
DSTN antibody
10R-3903 100 ul
EUR 691
Description: Mouse monoclonal DSTN antibody
DSTN antibody
70R-16940 50 ul
EUR 435
Description: Rabbit polyclonal DSTN antibody
DSTN Antibody
1-CSB-PA007211GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DSTN. Recognizes DSTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
DSTN Antibody
1-CSB-PA007211LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSTN. Recognizes DSTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
DSTN Antibody
1-CSB-PA671890
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DSTN. Recognizes DSTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
DSTN Antibody
1-CSB-PA247989
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DSTN. Recognizes DSTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
anti-DSTN
YF-PA25715 50 ul
EUR 334
Description: Mouse polyclonal to DSTN
Destrin Blocking Peptide
33R-1510 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DSTN antibody, catalog no. 70R-3884
Human DSTN shRNA Plasmid
20-abx957540
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DSTN Recombinant Protein (Human)
RP009862 100 ug Ask for price
DSTN Conjugated Antibody
C36414 100ul
EUR 397
DSTN cloning plasmid
CSB-CL007211HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atggcctcaggagtgcaagtagctgatgaagtatgtcgcattttttatgacatgaaagttcgtaaatgctccacaccagaagaaatcaagaaaagaaagaaggctgtcattttttgtctcagtgcagacaaaaagtgcatcattgtagaagaaggcaaagagatcttggttggaga
  • Show more
Description: A cloning plasmid for the DSTN gene.
DSTN Rabbit pAb
A11603-100ul 100 ul
EUR 308
DSTN Rabbit pAb
A11603-200ul 200 ul
EUR 459
DSTN Rabbit pAb
A11603-20ul 20 ul
EUR 183
DSTN Rabbit pAb
A11603-50ul 50 ul
EUR 223
DSTN Polyclonal Antibody
A58866 100 µg
EUR 570.55
Description: Ask the seller for details
DSTN Rabbit pAb
A4480-100ul 100 ul
EUR 308
DSTN Rabbit pAb
A4480-200ul 200 ul
EUR 459
DSTN Rabbit pAb
A4480-20ul 20 ul Ask for price
DSTN Rabbit pAb
A4480-50ul 50 ul Ask for price
Anti-DSTN antibody
STJ111222 100 µl
EUR 277
Description: The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene.
Anti-DSTN antibody
STJ113208 100 µl
EUR 277
Description: The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene.
Human DSTN Antibody (Biotin Conjugate)
33410-05121 150 ug
EUR 369
DSTN ORF Vector (Human) (pORF)
ORF003288 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Polyclonal DSTN Antibody (Center)
AMM06963G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DSTN (Center). This antibody is tested and proven to work in the following applications:
Mouse DSTN shRNA Plasmid
20-abx974769
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DSTN protein (His tag)
80R-2336 100 ug
EUR 322
Description: Purified recombinant Human DSTN Protein (His tag)
Rat DSTN shRNA Plasmid
20-abx991034
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DSTN Antibody, HRP conjugated
1-CSB-PA007211LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSTN. Recognizes DSTN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DSTN Antibody, FITC conjugated
1-CSB-PA007211LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSTN. Recognizes DSTN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DSTN Antibody, Biotin conjugated
1-CSB-PA007211LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DSTN. Recognizes DSTN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
DSTN Recombinant Protein (Rat)
RP198716 100 ug Ask for price
DSTN Recombinant Protein (Mouse)
RP130145 100 ug Ask for price
DSTN sgRNA CRISPR Lentivector set (Human)
K0635101 3 x 1.0 ug
EUR 339
Human DSTN AssayLite Antibody (FITC Conjugate)
33410-05141 150 ug
EUR 428
Human DSTN AssayLite Antibody (RPE Conjugate)
33410-05151 150 ug
EUR 428
Human DSTN AssayLite Antibody (APC Conjugate)
33410-05161 150 ug
EUR 428
Human DSTN AssayLite Antibody (PerCP Conjugate)
33410-05171 150 ug
EUR 471
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Human DSTN(Destrin) ELISA Kit