Human MTDH(Metadherin) ELISA Kit

Human MTDH(Metadherin) ELISA Kit

To Order Contact us below: 

    Human Metadherin (MTDH) ELISA Kit

    RDR-MTDH-Hu-96Tests 96 Tests
    EUR 756

    Human Metadherin (MTDH) ELISA Kit

    RD-MTDH-Hu-48Tests 48 Tests
    EUR 521

    Human Metadherin (MTDH) ELISA Kit

    RD-MTDH-Hu-96Tests 96 Tests
    EUR 723

    Human Metadherin (MTDH) ELISA Kit

    20-abx152312
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Metadherin (MTDH) ELISA Kit

    abx250897-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Human Metadherin (MTDH) ELISA Kit

    abx571203-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Metadherin(MTDH)ELISA Kit

    QY-E00441 96T
    EUR 361

    Human Metadherin (MTDH) ELISA Kit

    SEC631Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Metadherin (MTDH) ELISA Kit

    SEC631Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Metadherin (MTDH) ELISA Kit

    SEC631Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Metadherin (MTDH) ELISA Kit

    SEC631Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Metadherin (MTDH) ELISA Kit

    4-SEC631Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Metadherin elisa. Alternative names of the recognized antigen: 3D3
    • AEG1
    • LYRIC
    • Astrocyte elevated gene-1 protein
    • Lysine-rich CEACAM1 co-isolated protein
    • Metastasis adhesion protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Metadherin (MTDH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Metadherin (MTDH) Antibody

    20-abx006805
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Metadherin (MTDH) Antibody

    20-abx177534
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Metadherin (MTDH) Antibody

    20-abx113692
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Metadherin (MTDH) Antibody

    20-abx173544
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Metadherin (MTDH) Antibody

    abx011143-100ul 100 ul
    EUR 411
    • Shipped within 5-10 working days.

    Metadherin (MTDH) Antibody

    20-abx321360
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Mouse Metadherin (MTDH) ELISA Kit

    abx516937-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Metadherin (MTDH) ELISA Kit

    abx516938-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ELISA kit for Human MTDH (Metadherin)

    ELK3779 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Metadherin (MTDH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Metadherin (MTDH
    • Show more
    Description: A sandwich ELISA kit for detection of Metadherin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Metadherin (MTDH) Protein

    20-abx654347
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human Metadherin (MTDH) CLIA Kit

    20-abx493810
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    MTDH Metadherin Human Recombinant Protein

    PROTQ86UE4 Regular: 10ug
    EUR 317
    Description: Metadherin Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Val271-Asn456) containing 196 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 21.5kDa.

    Monoclonal MTDH / Metadherin Antibody (clone 2F11C3), Clone: 2F11C3

    AMM01881G 0.05ml
    EUR 484
    Description: A Monoclonal antibody against Human MTDH / Metadherin (clone 2F11C3). The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC-P, E, Flo

    Mtdh/ Rat Mtdh ELISA Kit

    ELI-04711r 96 Tests
    EUR 886

    Human MTDH ELISA Kit

    ELA-E1442h 96 Tests
    EUR 824

    MTDH ELISA KIT|Human

    EF009612 96 Tests
    EUR 689

    MTDH ELISA Kit (Human) (OKCD08210)

    OKCD08210 96 Wells
    EUR 975
    Description: Description of target: Metadherin (Metastasis adhesion protein), also known as MTDH, LYsine-RIch CEACAM1 co-isolated (LYRIC), is a novel protein that localizes with the tight junction proteins ZO-1 and occludin in polarized epithelial cells. At the tight junction, it acts not as a structural component, but is rather recruited during the maturation of the tight junction complex. Metadherin is overexpressed in breast cancer tissue and breast tumor xenografts, while much lower levels are expressed in normal breast tissue. Metadherin binds to lung vasculature, one of the four common sites of breast cancer metastasis, through a C-terminal segment in the extracellular domain; blocking this lung-homing domain with antibodies or inhibiting metadherin with siRNA has been reported to inhibit breast cancer metastasis.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

    MTDH ELISA Kit (Human) (OKEH04866)

    OKEH04866 96 Wells
    EUR 662
    Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092nmol/L

    Metadherin antibody

    10R-1918 100 ul
    EUR 403
    Description: Mouse monoclonal Metadherin antibody

    Metadherin Antibody

    BF0508 200ul
    EUR 376
    Description: Metadherin antibody detects endogenous levels of total Metadherin.

    Human MTDH/ Protein LYRIC ELISA Kit

    E1650Hu 1 Kit
    EUR 571

    Human MTDH(Protein LYRIC) ELISA Kit

    EH1606 96T
    EUR 567.6
    • Detection range: 1.56-100pmol/ml
    • Uniprot ID: Q86UE4
    • Alias: MTDH(Protein LYRIC)/3D3/AEG1/LYRIC/AEG-13D3,LYRIC/AEG1LYRIC,3D3/Astrocyte elevated gene-1 protein/Metastasis adhesion protein/Lysine-rich CEACAM1 co-isolated protein/Metadherin
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938pmol/ml

    Human Protein LYRIC, MTDH ELISA KIT

    ELI-04710h 96 Tests
    EUR 824

    MTDH ELISA Kit (Mouse) (OKEH05493)

    OKEH05493 96 Wells
    EUR 662
    Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.7 pg/mL

    MTDH ELISA Kit (Rat) (OKEH06168)

    OKEH06168 96 Wells
    EUR 662
    Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.06 pg/mL

    Metadherin(LYRIC) Antibody

    48236-100ul 100ul
    EUR 333

    Metadherin(LYRIC) Antibody

    48236-50ul 50ul
    EUR 239

    Metadherin Blocking Peptide

    BF0508-BP 1mg
    EUR 195

    anti-Metadherin (2F11C3)

    LF-MA30328 100 ul
    EUR 486
    Description: Mouse Monoclonal to Metadherin

    ELISA kit for Human Protein LYRIC (MTDH)

    KTE61504-48T 48T
    EUR 332
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protein LYRIC (MTDH)

    KTE61504-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protein LYRIC (MTDH)

    KTE61504-96T 96T
    EUR 539
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    MTDH Antibody

    1-CSB-PA773028ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

    MTDH Antibody

    1-CSB-PA015143GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    MTDH siRNA

    20-abx903370
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MTDH siRNA

    20-abx924881
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MTDH siRNA

    20-abx924882
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    pUC19-MTDH

    PVT14391 2 ug
    EUR 495

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Mouse Protein LYRIC, Mtdh ELISA KIT

    ELI-04709m 96 Tests
    EUR 865

    Human MTDH shRNA Plasmid

    20-abx964109
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    MTDH Recombinant Protein (Human)

    RP020257 100 ug Ask for price

    Metadherin(LYRIC) Conjugated Antibody

    C48236 100ul
    EUR 397

    ELISA kit for Rat Protein LYRIC (MTDH)

    KTE100572-48T 48T
    EUR 332
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protein LYRIC (MTDH)

    KTE100572-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protein LYRIC (MTDH)

    KTE100572-96T 96T
    EUR 539
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Protein LYRIC (MTDH)

    KTE70928-48T 48T
    EUR 332
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Protein LYRIC (MTDH)

    KTE70928-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Protein LYRIC (MTDH)

    KTE70928-96T 96T
    EUR 539
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    MTDH Polyclonal Antibody

    30670-100ul 100ul
    EUR 252

    MTDH Polyclonal Antibody

    30670-50ul 50ul
    EUR 187

    MTDH cloning plasmid

    CSB-CL773028HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1749
    • Sequence: atggctgcacggagctggcaggacgagctggcccagcaggccgaggagggctcggcccggctgcgggaaatgctctcggtcggcctaggctttctgcgcaccgagctgggcctcgacctggggctggagccgaaacggtaccccggctgggtgatcctggtgggcactggcgcgc
    • Show more
    Description: A cloning plasmid for the MTDH gene.

    MTDH Rabbit pAb

    A5887-100ul 100 ul
    EUR 308

    MTDH Rabbit pAb

    A5887-200ul 200 ul
    EUR 459

    MTDH Rabbit pAb

    A5887-20ul 20 ul
    EUR 183

    MTDH Rabbit pAb

    A5887-50ul 50 ul
    EUR 223

    pDONR223-MTDH Plasmid

    PVTB00287-1 2 ug
    EUR 356

    pcDNA3.1-MTDH Plasmid

    PVTB00287-2a 2 ug
    EUR 356

    Anti-MTDH antibody

    STJ29926 100 µl
    EUR 277

    Anti-MTDH antibody

    STJ98256 100 µl
    EUR 234
    Description: Mouse monoclonal to MTDH.

    MTDH ORF Vector (Human) (pORF)

    ORF006753 1.0 ug DNA
    EUR 95

    Monoclonal Metadherin Antibody, Clone: 2F11C3

    AMM06386G 0.1ml
    EUR 484
    Description: A Monoclonal antibody against Human Metadherin. The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC, FC, E

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Rat MTDH shRNA Plasmid

    20-abx987631
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse MTDH shRNA Plasmid

    20-abx976005
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    MTDH Polyclonal Conjugated Antibody

    C30670 100ul
    EUR 397

    Anti-LYRIC/MTDH Antibody

    PB9338 100ug/vial
    EUR 334

    pcDNA3.1-MTDH-HA Plasmid

    PVTB00287-2b 2 ug
    EUR 356

    pEGFP-N1-MTDH Plasmid

    PVTB00287-2c 2 ug
    EUR 356

    MTDH Recombinant Protein (Mouse)

    RP152003 100 ug Ask for price

    MTDH Recombinant Protein (Rat)

    RP212633 100 ug Ask for price

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    MTDH sgRNA CRISPR Lentivector set (Human)

    K1359401 3 x 1.0 ug
    EUR 339

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    AEG-1 / MTDH-Specific Antibody

    abx230189-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Mtdh ORF Vector (Rat) (pORF)

    ORF070879 1.0 ug DNA
    EUR 506

    Mtdh ORF Vector (Mouse) (pORF)

    ORF050669 1.0 ug DNA
    EUR 506

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MTDH sgRNA CRISPR Lentivector (Human) (Target 1)

    K1359402 1.0 ug DNA
    EUR 154

    MTDH sgRNA CRISPR Lentivector (Human) (Target 2)

    K1359403 1.0 ug DNA
    EUR 154

    MTDH sgRNA CRISPR Lentivector (Human) (Target 3)

    K1359404 1.0 ug DNA
    EUR 154

    Human MTDH(Metadherin) ELISA Kit