Human MTDH(Metadherin) ELISA Kit

Human MTDH(Metadherin) ELISA Kit

To Order Contact us below: 

    Human Metadherin (MTDH) ELISA Kit

    RD-MTDH-Hu-96Tests 96 Tests
    EUR 723

    Human Metadherin (MTDH) ELISA Kit

    RDR-MTDH-Hu-48Tests 48 Tests
    EUR 544

    Human Metadherin (MTDH) ELISA Kit

    RDR-MTDH-Hu-96Tests 96 Tests
    EUR 756

    Human Metadherin (MTDH) ELISA Kit

    abx571203-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Metadherin (MTDH) ELISA Kit

    20-abx152312
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Metadherin (MTDH) ELISA Kit

    abx250897-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Human Metadherin (MTDH) ELISA Kit

    SEC631Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Metadherin (MTDH) ELISA Kit

    SEC631Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Metadherin (MTDH) ELISA Kit

    SEC631Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Metadherin (MTDH) ELISA Kit

    SEC631Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Metadherin (MTDH) ELISA Kit

    4-SEC631Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Metadherin elisa. Alternative names of the recognized antigen: 3D3
    • AEG1
    • LYRIC
    • Astrocyte elevated gene-1 protein
    • Lysine-rich CEACAM1 co-isolated protein
    • Metastasis adhesion protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Metadherin (MTDH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Metadherin(MTDH)ELISA Kit

    QY-E00441 96T
    EUR 361

    Metadherin (MTDH) Antibody

    20-abx113692
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Metadherin (MTDH) Antibody

    abx011143-100ul 100 ul
    EUR 411
    • Shipped within 5-10 working days.

    Metadherin (MTDH) Antibody

    20-abx006805
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Metadherin (MTDH) Antibody

    20-abx173544
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Metadherin (MTDH) Antibody

    20-abx177534
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Metadherin (MTDH) Antibody

    20-abx321360
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Mouse Metadherin (MTDH) ELISA Kit

    abx516937-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Metadherin (MTDH) ELISA Kit

    abx516938-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Metadherin (MTDH) Protein

    20-abx654347
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    ELISA kit for Human MTDH (Metadherin)

    ELK3779 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Metadherin (MTDH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Metadherin (MTDH
    • Show more
    Description: A sandwich ELISA kit for detection of Metadherin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Metadherin (MTDH) CLIA Kit

    20-abx493810
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    MTDH Metadherin Human Recombinant Protein

    PROTQ86UE4 Regular: 10ug
    EUR 317
    Description: Metadherin Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Val271-Asn456) containing 196 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 21.5kDa.

    Monoclonal MTDH / Metadherin Antibody (clone 2F11C3), Clone: 2F11C3

    AMM01881G 0.05ml
    EUR 484
    Description: A Monoclonal antibody against Human MTDH / Metadherin (clone 2F11C3). The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC-P, E, Flo

    Mtdh/ Rat Mtdh ELISA Kit

    ELI-04711r 96 Tests
    EUR 886

    Human MTDH ELISA Kit

    ELA-E1442h 96 Tests
    EUR 824

    MTDH ELISA KIT|Human

    EF009612 96 Tests
    EUR 689

    MTDH ELISA Kit (Human) (OKCD08210)

    OKCD08210 96 Wells
    EUR 975
    Description: Description of target: Metadherin (Metastasis adhesion protein), also known as MTDH, LYsine-RIch CEACAM1 co-isolated (LYRIC), is a novel protein that localizes with the tight junction proteins ZO-1 and occludin in polarized epithelial cells. At the tight junction, it acts not as a structural component, but is rather recruited during the maturation of the tight junction complex. Metadherin is overexpressed in breast cancer tissue and breast tumor xenografts, while much lower levels are expressed in normal breast tissue. Metadherin binds to lung vasculature, one of the four common sites of breast cancer metastasis, through a C-terminal segment in the extracellular domain; blocking this lung-homing domain with antibodies or inhibiting metadherin with siRNA has been reported to inhibit breast cancer metastasis.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

    MTDH ELISA Kit (Human) (OKEH04866)

    OKEH04866 96 Wells
    EUR 662
    Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092nmol/L

    Metadherin Antibody

    BF0508 200ul
    EUR 376
    Description: Metadherin antibody detects endogenous levels of total Metadherin.

    Metadherin antibody

    10R-1918 100 ul
    EUR 403
    Description: Mouse monoclonal Metadherin antibody

    Human MTDH/ Protein LYRIC ELISA Kit

    E1650Hu 1 Kit
    EUR 571

    Human MTDH(Protein LYRIC) ELISA Kit

    EH1606 96T
    EUR 567.6
    • Detection range: 1.56-100pmol/ml
    • Uniprot ID: Q86UE4
    • Alias: MTDH(Protein LYRIC)/3D3/AEG1/LYRIC/AEG-13D3,LYRIC/AEG1LYRIC,3D3/Astrocyte elevated gene-1 protein/Metastasis adhesion protein/Lysine-rich CEACAM1 co-isolated protein/Metadherin
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938pmol/ml

    Human Protein LYRIC, MTDH ELISA KIT

    ELI-04710h 96 Tests
    EUR 824

    MTDH ELISA Kit (Mouse) (OKEH05493)

    OKEH05493 96 Wells
    EUR 662
    Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.7 pg/mL

    MTDH ELISA Kit (Rat) (OKEH06168)

    OKEH06168 96 Wells
    EUR 662
    Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.06 pg/mL

    Metadherin Blocking Peptide

    BF0508-BP 1mg
    EUR 195

    Metadherin(LYRIC) Antibody

    48236-100ul 100ul
    EUR 333

    Metadherin(LYRIC) Antibody

    48236-50ul 50ul
    EUR 239

    anti-Metadherin (2F11C3)

    LF-MA30328 100 ul
    EUR 486
    Description: Mouse Monoclonal to Metadherin

    ELISA kit for Human Protein LYRIC (MTDH)

    KTE61504-48T 48T
    EUR 332
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protein LYRIC (MTDH)

    KTE61504-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protein LYRIC (MTDH)

    KTE61504-96T 96T
    EUR 539
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    MTDH siRNA

    20-abx903370
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MTDH siRNA

    20-abx924881
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MTDH siRNA

    20-abx924882
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MTDH Antibody

    1-CSB-PA773028ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

    MTDH Antibody

    1-CSB-PA015143GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    pUC19-MTDH

    PVT14391 2 ug
    EUR 495

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Mouse Protein LYRIC, Mtdh ELISA KIT

    ELI-04709m 96 Tests
    EUR 865

    Human MTDH shRNA Plasmid

    20-abx964109
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    MTDH Recombinant Protein (Human)

    RP020257 100 ug Ask for price

    Metadherin(LYRIC) Conjugated Antibody

    C48236 100ul
    EUR 397

    ELISA kit for Rat Protein LYRIC (MTDH)

    KTE100572-48T 48T
    EUR 332
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protein LYRIC (MTDH)

    KTE100572-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protein LYRIC (MTDH)

    KTE100572-96T 96T
    EUR 539
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Protein LYRIC (MTDH)

    KTE70928-48T 48T
    EUR 332
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Protein LYRIC (MTDH)

    KTE70928-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Protein LYRIC (MTDH)

    KTE70928-96T 96T
    EUR 539
    • MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    MTDH Rabbit pAb

    A5887-100ul 100 ul
    EUR 308

    MTDH Rabbit pAb

    A5887-200ul 200 ul
    EUR 459

    MTDH Rabbit pAb

    A5887-20ul 20 ul
    EUR 183

    MTDH Rabbit pAb

    A5887-50ul 50 ul
    EUR 223

    MTDH Polyclonal Antibody

    30670-100ul 100ul
    EUR 252

    MTDH Polyclonal Antibody

    30670-50ul 50ul
    EUR 187

    MTDH cloning plasmid

    CSB-CL773028HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1749
    • Sequence: atggctgcacggagctggcaggacgagctggcccagcaggccgaggagggctcggcccggctgcgggaaatgctctcggtcggcctaggctttctgcgcaccgagctgggcctcgacctggggctggagccgaaacggtaccccggctgggtgatcctggtgggcactggcgcgc
    • Show more
    Description: A cloning plasmid for the MTDH gene.

    pDONR223-MTDH Plasmid

    PVTB00287-1 2 ug
    EUR 356

    pcDNA3.1-MTDH Plasmid

    PVTB00287-2a 2 ug
    EUR 356

    Anti-MTDH antibody

    STJ98256 100 µl
    EUR 234
    Description: Mouse monoclonal to MTDH.

    Anti-MTDH antibody

    STJ29926 100 µl
    EUR 277

    MTDH ORF Vector (Human) (pORF)

    ORF006753 1.0 ug DNA
    EUR 95

    Monoclonal Metadherin Antibody, Clone: 2F11C3

    AMM06386G 0.1ml
    EUR 484
    Description: A Monoclonal antibody against Human Metadherin. The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC, FC, E

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    MTDH Polyclonal Conjugated Antibody

    C30670 100ul
    EUR 397

    Mouse MTDH shRNA Plasmid

    20-abx976005
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat MTDH shRNA Plasmid

    20-abx987631
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Anti-LYRIC/MTDH Antibody

    PB9338 100ug/vial
    EUR 334

    MTDH Recombinant Protein (Rat)

    RP212633 100 ug Ask for price

    pcDNA3.1-MTDH-HA Plasmid

    PVTB00287-2b 2 ug
    EUR 356

    pEGFP-N1-MTDH Plasmid

    PVTB00287-2c 2 ug
    EUR 356

    MTDH Recombinant Protein (Mouse)

    RP152003 100 ug Ask for price

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    MTDH sgRNA CRISPR Lentivector set (Human)

    K1359401 3 x 1.0 ug
    EUR 339

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    AEG-1 / MTDH-Specific Antibody

    abx230189-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Mtdh ORF Vector (Mouse) (pORF)

    ORF050669 1.0 ug DNA
    EUR 506

    Mtdh ORF Vector (Rat) (pORF)

    ORF070879 1.0 ug DNA
    EUR 506

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MTDH sgRNA CRISPR Lentivector (Human) (Target 1)

    K1359402 1.0 ug DNA
    EUR 154

    MTDH sgRNA CRISPR Lentivector (Human) (Target 2)

    K1359403 1.0 ug DNA
    EUR 154

    MTDH sgRNA CRISPR Lentivector (Human) (Target 3)

    K1359404 1.0 ug DNA
    EUR 154

    Recombinant Human MTDH Protein, His, E.coli-10ug

    QP12748-10ug 10ug
    EUR 201

    Recombinant Human MTDH Protein, His, E.coli-1mg

    QP12748-1mg 1mg
    EUR 5251

    Recombinant Human MTDH Protein, His, E.coli-2ug

    QP12748-2ug 2ug
    EUR 155

    MTDH Protein Vector (Human) (pPB-C-His)

    PV027009 500 ng
    EUR 329

    MTDH Protein Vector (Human) (pPB-N-His)

    PV027010 500 ng
    EUR 329

    MTDH Protein Vector (Human) (pPM-C-HA)

    PV027011 500 ng
    EUR 329

    MTDH Protein Vector (Human) (pPM-C-His)

    PV027012 500 ng
    EUR 329

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    anti- AEG-1/MTDH-Specific antibody

    FNab00189 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: metadherin
    • Uniprot ID: Q86UE4
    • Gene ID: 92140
    • Research Area: Cancer
    Description: Antibody raised against AEG-1/MTDH-Specific

    Anti-AEG-1/MTDH-Specific antibody

    PAab00189 100 ug
    EUR 355

    Mtdh sgRNA CRISPR Lentivector set (Rat)

    K6945301 3 x 1.0 ug
    EUR 339

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    vWF Acty. Kit

    ABP-ACT-KIT 12 x 8 microwells
    EUR 428

    vWF Ant. Kit

    ABP-TOT-KIT 12 x 8 microwells
    EUR 394

    Mtdh sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6945302 1.0 ug DNA
    EUR 154

    Mtdh sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6945303 1.0 ug DNA
    EUR 154

    Mtdh sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6945304 1.0 ug DNA
    EUR 154

    MTDH Protein Vector (Rat) (pPB-C-His)

    PV283514 500 ng
    EUR 603

    MTDH Protein Vector (Rat) (pPB-N-His)

    PV283515 500 ng
    EUR 603

    MTDH Protein Vector (Rat) (pPM-C-HA)

    PV283516 500 ng
    EUR 603

    MTDH Protein Vector (Rat) (pPM-C-His)

    PV283517 500 ng
    EUR 603

    MTDH Protein Vector (Mouse) (pPB-C-His)

    PV202674 500 ng
    EUR 603

    MTDH Protein Vector (Mouse) (pPB-N-His)

    PV202675 500 ng
    EUR 603

    MTDH Protein Vector (Mouse) (pPM-C-HA)

    PV202676 500 ng
    EUR 603

    MTDH Protein Vector (Mouse) (pPM-C-His)

    PV202677 500 ng
    EUR 603

    Mtdh 3'UTR Luciferase Stable Cell Line

    TU213512 1.0 ml Ask for price

    Mtdh 3'UTR GFP Stable Cell Line

    TU263512 1.0 ml Ask for price

    hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

    CAS620A-KIT 1 kit
    EUR 2152
    • Category: Cas9
    Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PrecisionX Multiplex gRNA Cloning Kit

    CAS9-GRNA-KIT 10 rxn
    EUR 445
    • Category: Cas9

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    MTDH sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

    K1359405 3 x 1.0 ug
    EUR 376

    MTDH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

    LV683869 1.0 ug DNA
    EUR 682

    MTDH Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

    LV683873 1.0 ug DNA
    EUR 682

    MTDH Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

    LV683874 1.0 ug DNA
    EUR 682

    MTDH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

    K1359406 1.0 ug DNA
    EUR 167

    MTDH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

    K1359407 1.0 ug DNA
    EUR 167

    MTDH sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

    K1359408 1.0 ug DNA
    EUR 167

    CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

    CASCL9-100A-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Mtdh sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

    K6945305 3 x 1.0 ug
    EUR 376

    MTDH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

    LV683870 1.0 ug DNA
    EUR 682

    MTDH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

    LV683871 1.0 ug DNA
    EUR 740

    MTDH Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

    LV683872 1.0 ug DNA
    EUR 740

    Mtdh sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

    K6945306 1.0 ug DNA
    EUR 167

    Mtdh sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

    K6945307 1.0 ug DNA
    EUR 167

    Mtdh sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

    K6945308 1.0 ug DNA
    EUR 167

    AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

    AP-STR-KIT-P 1/pk
    EUR 721
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Human Kit ELISA Kit

    ELA-E0121h 96 Tests
    EUR 824

    Human KIT/SCFR ELISA kit

    LF-EK50791 1×96T
    EUR 648

    KIT ELISA Kit (Human) (OKAN04574)

    OKAN04574 96 Wells
    EUR 792
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

    KIT ELISA Kit (Human) (OKCD06003)

    OKCD06003 96 Wells
    EUR 648
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

    Human Biopterin ELISA Kit

    CELI-66011h 96 Tests
    EUR 824

    Human lipopolysaccharides ELISA Kit

    CELI-66031h 96 Tests
    EUR 824

    Human Microlbumin ELISA Kit

    abx517025-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Trypsin ELISA kit

    E01T0139-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Trypsin ELISA kit

    E01T0139-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Trypsin ELISA kit

    E01T0139-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Talin ELISA kit

    E01T0222-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Talin ELISA kit

    E01T0222-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Talin ELISA kit

    E01T0222-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Talin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thrombomodulin ELISA kit

    E01T0229-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thrombomodulin ELISA kit

    E01T0229-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thrombomodulin ELISA kit

    E01T0229-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Thrombomodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thioredoxin ELISA kit

    E01T0336-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thioredoxin ELISA kit

    E01T0336-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thioredoxin ELISA kit

    E01T0336-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thioredoxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transthyretin ELISA kit

    E01T0362-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transthyretin ELISA kit

    E01T0362-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transthyretin ELISA kit

    E01T0362-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transthyretin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kisspeptin ELISA kit

    E01T0490-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kisspeptin ELISA kit

    E01T0490-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kisspeptin ELISA kit

    E01T0490-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kisspeptin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tenascin ELISA kit

    E01T0523-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tenascin ELISA kit

    E01T0523-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tenascin ELISA kit

    E01T0523-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tenascin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptase ELISA kit

    E01T0532-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptase ELISA kit

    E01T0532-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptase ELISA kit

    E01T0532-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tryptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tafazzin ELISA kit

    E01T0752-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tafazzin ELISA kit

    E01T0752-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tafazzin ELISA kit

    E01T0752-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tafazzin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transketolase ELISA kit

    E01T0759-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transketolase ELISA kit

    E01T0759-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Transketolase ELISA kit

    E01T0759-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ubiquitin ELISA kit

    E01U0007-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ubiquitin ELISA kit

    E01U0007-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ubiquitin ELISA kit

    E01U0007-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urokinase ELISA kit

    E01U0010-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urokinase ELISA kit

    E01U0010-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urokinase ELISA kit

    E01U0010-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urokinase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Proteinuria ELISA kit

    E01U0011-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Proteinuria ELISA kit

    E01U0011-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Proteinuria ELISA kit

    E01U0011-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Proteinuria in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Utrophin ELISA kit

    E01U0030-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Utrophin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Utrophin ELISA kit

    E01U0030-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Utrophin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Utrophin ELISA kit

    E01U0030-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Utrophin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urocortin ELISA kit

    E01U0032-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urocortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urocortin ELISA kit

    E01U0032-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urocortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Urocortin ELISA kit

    E01U0032-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Urocortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Uromodulin ELISA kit

    E01U0077-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Uromodulin ELISA kit

    E01U0077-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Uromodulin ELISA kit

    E01U0077-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Uromodulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Visfatin ELISA kit

    E01V0003-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Visfatin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Visfatin ELISA kit

    E01V0003-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Visfatin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Visfatin ELISA kit

    E01V0003-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Visfatin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vitellogenin ELISA kit

    E01V0020-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vitellogenin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vitellogenin ELISA kit

    E01V0020-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vitellogenin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vitellogenin ELISA kit

    E01V0020-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vitellogenin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vinculin ELISA kit

    E01V0025-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vinculin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vinculin ELISA kit

    E01V0025-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vinculin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vinculin ELISA kit

    E01V0025-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vinculin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vimentin ELISA kit

    E01V0036-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vimentin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human MTDH(Metadherin) ELISA Kit