Human MTDH(Metadherin) ELISA Kit

Human MTDH(Metadherin) ELISA Kit

To Order Contact us below: 

Human Metadherin (MTDH) ELISA Kit
RDR-MTDH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Metadherin (MTDH) ELISA Kit
RD-MTDH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Metadherin (MTDH) ELISA Kit
RD-MTDH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Metadherin (MTDH) ELISA Kit
20-abx152312	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Metadherin (MTDH) ELISA Kit
abx250897-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Metadherin (MTDH) ELISA Kit
abx571203-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Metadherin(MTDH)ELISA Kit
QY-E00441	Qayee Biotechnology	96T	EUR 361

Human Metadherin (MTDH) ELISA Kit
SEC631Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

Human Metadherin (MTDH) ELISA Kit
SEC631Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

Human Metadherin (MTDH) ELISA Kit
SEC631Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

Human Metadherin (MTDH) ELISA Kit
SEC631Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Metadherin (MTDH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Metadherin (MTDH) in Tissue homogenates, cell lysates and other biological fluids.

Human Metadherin (MTDH) ELISA Kit
4-SEC631Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Metadherin elisa. Alternative names of the recognized antigen: 3D3 AEG1 LYRIC Astrocyte elevated gene-1 protein Lysine-rich CEACAM1 co-isolated protein Metastasis adhesion protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Metadherin (MTDH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Metadherin (MTDH) Antibody
20-abx006805	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Metadherin (MTDH) Antibody
20-abx177534	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Metadherin (MTDH) Antibody
20-abx113692	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Metadherin (MTDH) Antibody
20-abx173544	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Metadherin (MTDH) Antibody
abx011143-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Metadherin (MTDH) Antibody
20-abx321360	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Mouse Metadherin (MTDH) ELISA Kit
abx516937-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Metadherin (MTDH) ELISA Kit
abx516938-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human MTDH (Metadherin)
ELK3779	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Metadherin (MTDH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Metadherin (MTDH Show more
Description: A sandwich ELISA kit for detection of Metadherin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Metadherin (MTDH) Protein
20-abx654347	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Metadherin (MTDH) CLIA Kit
20-abx493810	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

MTDH Metadherin Human Recombinant Protein
PROTQ86UE4	BosterBio	Regular: 10ug	EUR 317
Description: Metadherin Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Val271-Asn456) containing 196 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 21.5kDa.

Monoclonal MTDH / Metadherin Antibody (clone 2F11C3), Clone: 2F11C3
AMM01881G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human MTDH / Metadherin (clone 2F11C3). The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC-P, E, Flo

Mtdh/ Rat Mtdh ELISA Kit
ELI-04711r	Lifescience Market	96 Tests	EUR 886

Human MTDH ELISA Kit
ELA-E1442h	Lifescience Market	96 Tests	EUR 824

MTDH ELISA KIT|Human
EF009612	Lifescience Market	96 Tests	EUR 689

MTDH ELISA Kit (Human) (OKCD08210)
OKCD08210	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Metadherin (Metastasis adhesion protein), also known as MTDH, LYsine-RIch CEACAM1 co-isolated (LYRIC), is a novel protein that localizes with the tight junction proteins ZO-1 and occludin in polarized epithelial cells. At the tight junction, it acts not as a structural component, but is rather recruited during the maturation of the tight junction complex. Metadherin is overexpressed in breast cancer tissue and breast tumor xenografts, while much lower levels are expressed in normal breast tissue. Metadherin binds to lung vasculature, one of the four common sites of breast cancer metastasis, through a C-terminal segment in the extracellular domain; blocking this lung-homing domain with antibodies or inhibiting metadherin with siRNA has been reported to inhibit breast cancer metastasis.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

MTDH ELISA Kit (Human) (OKEH04866)
OKEH04866	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092nmol/L

Metadherin antibody
10R-1918	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal Metadherin antibody

Metadherin Antibody
BF0508	Affbiotech	200ul	EUR 376
Description: Metadherin antibody detects endogenous levels of total Metadherin.

Human MTDH/ Protein LYRIC ELISA Kit
E1650Hu	Sunlong	1 Kit	EUR 571

Human MTDH(Protein LYRIC) ELISA Kit
EH1606	FN Test	96T	EUR 567.6
Detection range: 1.56-100pmol/ml Uniprot ID: Q86UE4 Alias: MTDH(Protein LYRIC)/3D3/AEG1/LYRIC/AEG-13D3,LYRIC/AEG1LYRIC,3D3/Astrocyte elevated gene-1 protein/Metastasis adhesion protein/Lysine-rich CEACAM1 co-isolated protein/Metadherin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938pmol/ml

Human Protein LYRIC, MTDH ELISA KIT
ELI-04710h	Lifescience Market	96 Tests	EUR 824

MTDH ELISA Kit (Mouse) (OKEH05493)
OKEH05493	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.7 pg/mL

MTDH ELISA Kit (Rat) (OKEH06168)
OKEH06168	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Downregulates SLC1A2/EAAT2 promoter activity when expressed ectopically. Activates the nuclear factor kappa-B (NF-kappa-B) transcription factor. Promotes anchorage-independent growth of immortalized melanocytes and astrocytes which is a key component in tumor cell expansion. Promotes lung metastasis and also has an effect on bone and brain metastasis, possibly by enhancing the seeding of tumor cells to the target organ endothelium. Induces chemoresistance.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.06 pg/mL

Metadherin(LYRIC) Antibody
48236-100ul	SAB	100ul	EUR 333

Metadherin(LYRIC) Antibody
48236-50ul	SAB	50ul	EUR 239

Metadherin Blocking Peptide
BF0508-BP	Affbiotech	1mg	EUR 195

anti-Metadherin (2F11C3)
LF-MA30328	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to Metadherin

ELISA kit for Human Protein LYRIC (MTDH)
KTE61504-48T	Abbkine	48T	EUR 332
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein LYRIC (MTDH)
KTE61504-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein LYRIC (MTDH)
KTE61504-96T	Abbkine	96T	EUR 539
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Human Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MTDH Antibody
1-CSB-PA773028ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

MTDH Antibody
1-CSB-PA015143GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MTDH. Recognizes MTDH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

MTDH siRNA
20-abx903370	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MTDH siRNA
20-abx924881	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MTDH siRNA
20-abx924882	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pUC19-MTDH
PVT14391	Lifescience Market	2 ug	EUR 495

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Mouse Protein LYRIC, Mtdh ELISA KIT
ELI-04709m	Lifescience Market	96 Tests	EUR 865

Human MTDH shRNA Plasmid
20-abx964109	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MTDH Recombinant Protein (Human)
RP020257	ABM	100 ug	Ask for price

Metadherin(LYRIC) Conjugated Antibody
C48236	SAB	100ul	EUR 397

ELISA kit for Rat Protein LYRIC (MTDH)
KTE100572-48T	Abbkine	48T	EUR 332
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein LYRIC (MTDH)
KTE100572-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein LYRIC (MTDH)
KTE100572-96T	Abbkine	96T	EUR 539
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein LYRIC (MTDH)
KTE70928-48T	Abbkine	48T	EUR 332
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein LYRIC (MTDH)
KTE70928-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein LYRIC (MTDH)
KTE70928-96T	Abbkine	96T	EUR 539
MTDH (Metadherin) is a Protein Coding gene. Diseases associated with MTDH include Nervous System Disease. Among its related pathways are Adhesion and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to t Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein LYRIC (MTDH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MTDH Polyclonal Antibody
30670-100ul	SAB	100ul	EUR 252

MTDH Polyclonal Antibody
30670-50ul	SAB	50ul	EUR 187

MTDH cloning plasmid
CSB-CL773028HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1749 Sequence: atggctgcacggagctggcaggacgagctggcccagcaggccgaggagggctcggcccggctgcgggaaatgctctcggtcggcctaggctttctgcgcaccgagctgggcctcgacctggggctggagccgaaacggtaccccggctgggtgatcctggtgggcactggcgcgc Show more
Description: A cloning plasmid for the MTDH gene.

MTDH Rabbit pAb
A5887-100ul	Abclonal	100 ul	EUR 308

MTDH Rabbit pAb
A5887-200ul	Abclonal	200 ul	EUR 459

MTDH Rabbit pAb
A5887-20ul	Abclonal	20 ul	EUR 183

MTDH Rabbit pAb
A5887-50ul	Abclonal	50 ul	EUR 223

pDONR223-MTDH Plasmid
PVTB00287-1	Lifescience Market	2 ug	EUR 356

pcDNA3.1-MTDH Plasmid
PVTB00287-2a	Lifescience Market	2 ug	EUR 356

Anti-MTDH antibody
STJ29926	St John's Laboratory	100 µl	EUR 277

Anti-MTDH antibody
STJ98256	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to MTDH.

MTDH ORF Vector (Human) (pORF)
ORF006753	ABM	1.0 ug DNA	EUR 95

Monoclonal Metadherin Antibody, Clone: 2F11C3
AMM06386G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human Metadherin. The antibodies are raised in Mouse and are from clone 2F11C3. This antibody is applicable in WB and IHC, FC, E

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Rat MTDH shRNA Plasmid
20-abx987631	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MTDH shRNA Plasmid
20-abx976005	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MTDH Polyclonal Conjugated Antibody
C30670	SAB	100ul	EUR 397

Anti-LYRIC/MTDH Antibody
PB9338	BosterBio	100ug/vial	EUR 334

pcDNA3.1-MTDH-HA Plasmid
PVTB00287-2b	Lifescience Market	2 ug	EUR 356

pEGFP-N1-MTDH Plasmid
PVTB00287-2c	Lifescience Market	2 ug	EUR 356

MTDH Recombinant Protein (Mouse)
RP152003	ABM	100 ug	Ask for price

MTDH Recombinant Protein (Rat)
RP212633	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

MTDH sgRNA CRISPR Lentivector set (Human)
K1359401	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

AEG-1 / MTDH-Specific Antibody
abx230189-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Mtdh ORF Vector (Rat) (pORF)
ORF070879	ABM	1.0 ug DNA	EUR 506

Mtdh ORF Vector (Mouse) (pORF)
ORF050669	ABM	1.0 ug DNA	EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MTDH sgRNA CRISPR Lentivector (Human) (Target 1)
K1359402	ABM	1.0 ug DNA	EUR 154

MTDH sgRNA CRISPR Lentivector (Human) (Target 2)
K1359403	ABM	1.0 ug DNA	EUR 154

MTDH sgRNA CRISPR Lentivector (Human) (Target 3)
K1359404	ABM	1.0 ug DNA	EUR 154

Human MTDH(Metadherin) ELISA Kit