Human PML(Promyelocytic Leukemia Protein) ELISA Kit

Human PML(Promyelocytic Leukemia Protein) ELISA Kit

To Order Contact us below: 

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

RD-PML-Hu-48Tests 48 Tests
EUR 521

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

RD-PML-Hu-96Tests 96 Tests
EUR 723

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

RDR-PML-Hu-48Tests 48 Tests
EUR 544

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

RDR-PML-Hu-96Tests 96 Tests
EUR 756

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

abx595499-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

20-abx152792
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

SEC221Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

SEC221Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

SEC221Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

SEC221Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit

4-SEC221Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Promyelocytic Leukemia Protein elisa. Alternative names of the recognized antigen: MYL
  • RNF71
  • TRIM19
  • Probable Transcription Factor PML
  • Ring Finger Protein 71
  • Tripartite motif-containing protein 19
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Promyelocytic Leukemia Protein (PML) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Promyelocytic Leukemia Protein(PML)ELISA Kit

QY-E00302 96T
EUR 361

Promyelocytic Leukemia Protein (PML) Antibody

abx117056-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Promyelocytic Leukemia Protein (PML) Antibody

20-abx001098
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Promyelocytic Leukemia Protein (PML) Antibody

20-abx103063
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Promyelocytic Leukemia Protein (PML) Antibody

20-abx008856
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Promyelocytic Leukemia Protein (PML) Antibody

20-abx174197
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Promyelocytic Leukemia Protein (PML) Antibody

20-abx324818
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Promyelocytic Leukemia Protein (PML) Antibody

abx236572-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Recombinant Promyelocytic Leukemia Protein (PML)

4-RPC221Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P29590
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Promyelocytic Leukemia Protein expressed in: E.coli

Human Promyelocytic Leukemia Protein (PML) Protein

20-abx068694
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Promyelocytic Leukemia Protein (PML) CLIA Kit

20-abx493551
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human PML (Promyelocytic Leukemia Protein)

ELK3769 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Promyelocytic Leukemia Protein (PML). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Promyelocytic Leukemia Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Promyelocytic Leukemia Protein (PML) Antibody (FITC)

20-abx273636
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Promyelocytic Leukemia Protein (PML) Antibody (Biotin)

20-abx272262
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human)

4-PAC221Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PML (Gln59~Glu239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML)

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), APC

4-PAC221Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PML (Gln59~Glu239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with APC.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), Biotinylated

4-PAC221Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PML (Gln59~Glu239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with Biotin.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), Cy3

4-PAC221Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PML (Gln59~Glu239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with Cy3.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), FITC

4-PAC221Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PML (Gln59~Glu239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with FITC.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), HRP

4-PAC221Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PML (Gln59~Glu239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with HRP.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), PE

4-PAC221Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PML (Gln59~Glu239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with PE.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), APC-Cy7

4-PAC221Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PML (Gln59~Glu239)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with APC-Cy7.

Human HL60 (Promyelocytic Leukemia) lysate

HCL-1209 100ug
EUR 238

Human Protein PML, PML ELISA KIT

ELI-36129h 96 Tests
EUR 824

Mouse Protein PML, Pml ELISA KIT

ELI-15331m 96 Tests
EUR 865

HL60 Cell Lysate (Human promyelocytic leukemia cell line)

LF-R0009 200 ul
EUR 86
Description: HL60 (Human promyelocytic leukemia cell line) Whole Cell Lysate

ELISA kit for Mouse Protein PML (PML)

KTE70720-48T 48T
EUR 332
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein PML (PML)

KTE70720-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein PML (PML)

KTE70720-96T 96T
EUR 539
  • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PML ELISA KIT|Human

EF001884 96 Tests
EUR 689

anti-PML Protein

YF-PA24405 50 ul
EUR 334
Description: Mouse polyclonal to PML Protein

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

PML Colorimetric Cell-Based ELISA Kit

EKC1477 100ul
EUR 572

PML siRNA

20-abx929039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PML siRNA

20-abx929040
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PML antibody

70R-50222 100 ul
EUR 244
Description: Purified Polyclonal PML antibody

PML antibody

70R-30724 100 ug
EUR 327
Description: Rabbit polyclonal PML antibody

PML antibody

70R-7965 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PML antibody

PML Antibody

ABD6318 100 ug
EUR 438

PML Antibody

32211-100ul 100ul
EUR 252

PML antibody

10R-1742 100 ug
EUR 512
Description: Mouse monoclonal PML antibody

PML Antibody

DF6318 200ul
EUR 304
Description: PML Antibody detects endogenous levels of total PML.

PML Antibody

1-CSB-PA003823
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PML. Recognizes PML from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

PML Antibody

CSB-PA018236KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PML Antibody

CSB-PA018236KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Anti-PML Protein Antibody

PB10084 100ug/vial
EUR 334

Anti-PML Protein Antibody

PB10085 100ug/vial
EUR 334

Anti-PML Protein (2B10)

YF-MA14783 100 ug
EUR 363
Description: Mouse monoclonal to PML Protein

Anti-PML Protein (1D12)

YF-MA10708 100 ug
EUR 363
Description: Mouse monoclonal to PML Protein

Human PML shRNA Plasmid

20-abx953606
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PML Conjugated Antibody

C32211 100ul
EUR 397

PML cloning plasmid

CSB-CL018236HU-10ug 10ug
EUR 766
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2346
  • Sequence: atggagcctgcacccgcccgatctccgaggccccagcaggaccccgcccggccccaggagcccaccatgcctccccccgagaccccctctgaaggccgccagcccagccccagccccagccctacagagcgagcccccgcttcggaggaggagttccagtttctgcgctgccagc
  • Show more
Description: A cloning plasmid for the PML gene.

PML Polyclonal Antibody

ES3239-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

PML Polyclonal Antibody

ES3239-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- PML antibody

FNab06572 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: promyelocytic leukemia
  • Uniprot ID: P29590
  • Gene ID: 5371
  • Research Area: Immunology, Metabolism
Description: Antibody raised against PML

PML Polyclonal Antibody

ABP52240-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody

ABP52240-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody

ABP52240-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Blocking Peptide

20-abx063097
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PML / RARA Antibody

20-abx007137
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PML Rabbit mAb

A19646-100ul 100 ul
EUR 410

PML Rabbit mAb

A19646-200ul 200 ul
EUR 571

PML Rabbit mAb

A19646-20ul 20 ul
EUR 221

PML Rabbit mAb

A19646-50ul 50 ul
EUR 287

PML Blocking Peptide

33R-2443 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PML antibody, catalog no. 70R-7965

PML Polyclonal Antibody

41354-100ul 100ul
EUR 252

PML Polyclonal Antibody

41354-50ul 50ul
EUR 187

PML Blocking Peptide

DF6318-BP 1mg
EUR 195

Anti-PML antibody

PAab06572 100 ug
EUR 412

Anti-PML antibody

STJ95166 200 µl
EUR 197
Description: Rabbit polyclonal to PML.

Anti-PML antibody

STJ25034 100 µl
EUR 413
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified.

HL-60 Cell Slide (Human (36yrs, Female) peripheral blood promyeloblast, acute promyelocytic leukemia) (5 slides/pk)

HCLS-17009 1 pk
EUR 250

PML ORF Vector (Human) (pORF)

ORF007965 1.0 ug DNA
EUR 95

PML Protein Vector (Human) (pPB-C-His)

PV031857 500 ng
EUR 329

PML Protein Vector (Human) (pPB-N-His)

PV031858 500 ng
EUR 329

PML Protein Vector (Human) (pPM-C-HA)

PV031859 500 ng
EUR 329

PML Protein Vector (Human) (pPM-C-His)

PV031860 500 ng
EUR 329

Human Leukemia Inhibitory Factor ELISA kit

E01L0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia Inhibitory Factor ELISA kit

E01L0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia Inhibitory Factor ELISA kit

E01L0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human thymus- leukemia antigen ELISA Kit

ELA-E1555h 96 Tests
EUR 824

Human Leukemia- associated protein 7, DLEU7 ELISA KIT

ELI-14461h 96 Tests
EUR 824

Human Leukemia- associated protein 2, DLEU2 ELISA KIT

ELI-16219h 96 Tests
EUR 824

Human Leukemia- associated protein 1, DLEU1 ELISA KIT

ELI-31615h 96 Tests
EUR 824

Human Megakaryocytic Acute Leukemia Protein (MKL1) ELISA Kit

abx381459-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human PML- RARA- regulated adapter molecule 1, PRAM1 ELISA KIT

ELI-22264h 96 Tests
EUR 824

Human PML-RARA-regulated adapter molecule 1 (PRAM1) ELISA Kit

abx382446-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Polyclonal PML polyclonal antibody

AMR09397G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PML polyclonal . This antibody is tested and proven to work in the following applications:

PML/RARA Rabbit pAb

A7525-100ul 100 ul
EUR 308

PML/RARA Rabbit pAb

A7525-200ul 200 ul
EUR 459

PML/RARA Rabbit pAb

A7525-20ul 20 ul
EUR 183

PML/RARA Rabbit pAb

A7525-50ul 50 ul
EUR 223

PML/RARA Polyclonal Antibody

30953-100ul 100ul
EUR 252

PML/RARA Polyclonal Antibody

30953-50ul 50ul
EUR 187

Mouse PML shRNA Plasmid

20-abx972115
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-PML/RARA antibody

STJ29663 100 µl
EUR 277

ELISA kit for Human Leukemia-associated protein 7 (DLEU7)

KTE62031-48T 48T
EUR 332
  • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 7 (DLEU7)

KTE62031-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 7 (DLEU7)

KTE62031-96T 96T
EUR 539
  • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 1 (DLEU1)

KTE62032-48T 48T
EUR 332
  • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 1 (DLEU1)

KTE62032-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 1 (DLEU1)

KTE62032-96T 96T
EUR 539
  • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PML sgRNA CRISPR Lentivector set (Human)

K1673401 3 x 1.0 ug
EUR 339

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

abx576321-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Leukemia inhibitory factor receptor ELISA kit

E01L0235-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia inhibitory factor receptor ELISA kit

E01L0235-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia inhibitory factor receptor ELISA kit

E01L0235-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Leukemia inhibitory factor

EK1239 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Leukemia inhibitory factor in samples from serum, plasma, tissue homogenates and other biological fluids.

Human LIF/ Leukemia inhibitory factor ELISA Kit

E1462Hu 1 Kit
EUR 537

Human LIF(Leukemia inhibitory factor) ELISA Kit

EH0507 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P15018
  • Alias: LIF(Leukemia Inhibitory Factor)/CDF/D factor/DIA/differentiation inhibitory activity/differentiation stimulating factor/Differentiation-stimulating factor/Emfilermin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Leukemia inhibitory factor(LIF)ELISA Kit

GA-E1128HM-48T 48T
EUR 289

Human Leukemia inhibitory factor(LIF)ELISA Kit

GA-E1128HM-96T 96T
EUR 466

Human thymus-leukemia antigen(TLa)ELISA Kit

GA-E1662HM-48T 48T
EUR 289

Human thymus-leukemia antigen(TLa)ELISA Kit

GA-E1662HM-96T 96T
EUR 466

Human Hepatic leukemia factor, HLF ELISA KIT

ELI-30911h 96 Tests
EUR 824

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

20-abx152198
  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thymus Leukemia Antigen (TLA) ELISA Kit

abx354514-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

abx253476-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Hepatic Leukemia Factor (HLF) ELISA Kit

abx387818-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Leukemia inhibitory factor,LIF ELISA kit

201-12-1112 96 tests
EUR 440
  • This Leukemia inhibitory factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human thymus-leukemia antigen,TLa ELISA Kit

201-12-1646 96 tests
EUR 440
  • This thymus-leukemia antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

DLR-LIF-Hu-48T 48T
EUR 380
  • Should the Human Leukemia Inhibitory Factor (LIF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukemia Inhibitory Factor (LIF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

DLR-LIF-Hu-96T 96T
EUR 485
  • Should the Human Leukemia Inhibitory Factor (LIF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukemia Inhibitory Factor (LIF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Leukemia inhibitory factor, LIF ELISA kit

CSB-E04651h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Leukemia inhibitory factor, LIF in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Leukemia inhibitory factor, LIF ELISA kit

1-CSB-E04651h
  • EUR 574.00
  • EUR 4013.00
  • EUR 2138.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Leukemia inhibitory factor, LIF in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Leukemia inhibitory factor,LIF ELISA kit

CN-03238H1 96T
EUR 452

Human Leukemia inhibitory factor,LIF ELISA kit

CN-03238H2 48T
EUR 302

Human thymus-leukemia antigen,TLa ELISA Kit

CN-04447H1 96T
EUR 447

Human thymus-leukemia antigen,TLa ELISA Kit

CN-04447H2 48T
EUR 296

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

SEA085Hu-10x96wellstestplate 10x96-wells test plate
EUR 3069.07
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

SEA085Hu-1x48wellstestplate 1x48-wells test plate
EUR 340.39
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

SEA085Hu-1x96wellstestplate 1x96-wells test plate
EUR 443.42
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

SEA085Hu-5x96wellstestplate 5x96-wells test plate
EUR 1695.39
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

4-SEA085Hu
  • EUR 3120.00
  • EUR 1646.00
  • EUR 444.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Leukemia Inhibitory Factor elisa. Alternative names of the recognized antigen: CDF
  • D-FACTOR
  • HILDA
  • MLPLI
  • Cholinergic Differentiation Factor
  • Differentiation-Stimulating Factor
  • Melanoma-Derived LPL Inhibitor
  • Emfilermin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Leukemia Inhibitory Factor (LIF) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Leukemia inhibitory factor(LIF) ELISA Kit

RK00123 96 Tests
EUR 521

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

RD-LIF-Hu-48Tests 48 Tests
EUR 367

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

RD-LIF-Hu-96Tests 96 Tests
EUR 502

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

RDR-LIF-Hu-48Tests 48 Tests
EUR 383

Human Leukemia Inhibitory Factor (LIF) ELISA Kit

RDR-LIF-Hu-96Tests 96 Tests
EUR 525

Human Leukemia inhibitory factor(LIF)ELISA Kit

QY-E04232 96T
EUR 361

Human thymus-leukemia antigen(TLa)ELISA Kit

QY-E00766 96T
EUR 361

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

PML Protein Vector (Mouse) (pPB-C-His)

PV217426 500 ng
EUR 1065

PML Protein Vector (Mouse) (pPB-N-His)

PV217427 500 ng
EUR 1065

PML Protein Vector (Mouse) (pPM-C-HA)

PV217428 500 ng
EUR 1065

PML Protein Vector (Mouse) (pPM-C-His)

PV217429 500 ng
EUR 1065

PML Protein Vector (Mouse) (pPB-C-His)

PV217430 500 ng
EUR 1065

PML Protein Vector (Mouse) (pPB-N-His)

PV217431 500 ng
EUR 1065

PML Protein Vector (Mouse) (pPM-C-HA)

PV217432 500 ng
EUR 1065

PML Protein Vector (Mouse) (pPM-C-His)

PV217433 500 ng
EUR 1065

Human T-cell leukemia/lymphoma protein 1A (TCL1A) ELISA Kit

abx518206-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human T cell leukemia homeobox protein 1(TLX1) ELISA kit

E01T0695-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 1(TLX1) ELISA kit

E01T0695-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 1(TLX1) ELISA kit

E01T0695-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 3(TLX3) ELISA kit

E01T0696-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 3(TLX3) ELISA kit

E01T0696-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 3(TLX3) ELISA kit

E01T0696-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TCL1A/ T-cell leukemia/lymphoma protein 1A ELISA Kit

E2460Hu 1 Kit
EUR 571

Human T- cell leukemia/lymphoma protein 1A, TCL1A ELISA KIT

ELI-05546h 96 Tests
EUR 824

Human T- cell leukemia homeobox protein 2, TLX2 ELISA KIT

ELI-16061h 96 Tests
EUR 824

Human T- cell leukemia/lymphoma protein 1B, TCL1B ELISA KIT

ELI-51950h 96 Tests
EUR 824

Human T- cell leukemia homeobox protein 1, TLX1 ELISA KIT

ELI-51739h 96 Tests
EUR 824

Human T- cell leukemia homeobox protein 3, TLX3 ELISA KIT

ELI-51740h 96 Tests
EUR 824

Human Brain And Acute Leukemia Cytoplasmic Protein (BAALC) ELISA Kit

20-abx385995
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human T-Cell Leukemia/Lymphoma Protein 1A(TCL1A)ELISA Kit

QY-E04512 96T
EUR 361

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Mouse PML- RARA- regulated adapter molecule 1, Pram1 ELISA KIT

ELI-21673m 96 Tests
EUR 865

Mouse PML-RARA-regulated adapter molecule 1 (PRAM1) ELISA Kit

abx390265-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Goat Leukemia Inhibitory Factor ELISA kit

E06L0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Leukemia Inhibitory Factor ELISA kit

E06L0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Leukemia Inhibitory Factor ELISA kit

E06L0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Leukemia Inhibitory Factor ELISA kit

E02L0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Leukemia Inhibitory Factor ELISA kit

E02L0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Leukemia Inhibitory Factor ELISA kit

E02L0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Leukemia Inhibitory Factor ELISA kit

E03L0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Leukemia Inhibitory Factor ELISA kit

E03L0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Leukemia Inhibitory Factor ELISA kit

E03L0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Leukemia Inhibitory Factor ELISA kit

E04L0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Leukemia Inhibitory Factor ELISA kit

E04L0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Leukemia Inhibitory Factor ELISA kit

E04L0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat leukemia inhibitory factor ELISA Kit

ELA-E0085r 96 Tests
EUR 886

Dog Leukemia Inhibitory Factor ELISA kit

E08L0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Leukemia Inhibitory Factor ELISA kit

E08L0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Leukemia Inhibitory Factor ELISA kit

E08L0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Leukemia Inhibitory Factor ELISA kit

E07L0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Leukemia Inhibitory Factor ELISA kit

E07L0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Leukemia Inhibitory Factor ELISA kit

E07L0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PML(Promyelocytic Leukemia Protein) ELISA Kit