Human PML(Promyelocytic Leukemia Protein) ELISA Kit

Human PML(Promyelocytic Leukemia Protein) ELISA Kit

To Order Contact us below: 

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
RD-PML-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
RD-PML-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
RDR-PML-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
RDR-PML-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
abx595499-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
20-abx152792	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
SEC221Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
SEC221Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
SEC221Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
SEC221Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

Human Promyelocytic Leukemia Protein (PML) ELISA Kit
4-SEC221Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Promyelocytic Leukemia Protein elisa. Alternative names of the recognized antigen: MYL RNF71 TRIM19 Probable Transcription Factor PML Ring Finger Protein 71 Tripartite motif-containing protein 19
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Promyelocytic Leukemia Protein (PML) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Promyelocytic Leukemia Protein(PML)ELISA Kit
QY-E00302	Qayee Biotechnology	96T	EUR 361

Promyelocytic Leukemia Protein (PML) Antibody
abx117056-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Promyelocytic Leukemia Protein (PML) Antibody
20-abx001098	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Promyelocytic Leukemia Protein (PML) Antibody
20-abx103063	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Promyelocytic Leukemia Protein (PML) Antibody
20-abx008856	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Promyelocytic Leukemia Protein (PML) Antibody
20-abx174197	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Promyelocytic Leukemia Protein (PML) Antibody
20-abx324818	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Promyelocytic Leukemia Protein (PML) Antibody
abx236572-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Recombinant Promyelocytic Leukemia Protein (PML)
4-RPC221Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P29590 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Promyelocytic Leukemia Protein expressed in: E.coli

Human Promyelocytic Leukemia Protein (PML) Protein
20-abx068694	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Promyelocytic Leukemia Protein (PML) CLIA Kit
20-abx493551	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human PML (Promyelocytic Leukemia Protein)
ELK3769	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Promyelocytic Leukemia Protein (PML). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Promyelocytic Leukemia Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Promyelocytic Leukemia Protein (PML) Antibody (FITC)
20-abx273636	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Promyelocytic Leukemia Protein (PML) Antibody (Biotin)
20-abx272262	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human)
4-PAC221Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PML (Gln59~Glu239) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML)

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), APC
4-PAC221Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PML (Gln59~Glu239) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with APC.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), Biotinylated
4-PAC221Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PML (Gln59~Glu239) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with Biotin.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), Cy3
4-PAC221Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PML (Gln59~Glu239) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with Cy3.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), FITC
4-PAC221Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PML (Gln59~Glu239) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with FITC.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), HRP
4-PAC221Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PML (Gln59~Glu239) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with HRP.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), PE
4-PAC221Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PML (Gln59~Glu239) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with PE.

Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), APC-Cy7
4-PAC221Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PML (Gln59~Glu239) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with APC-Cy7.

Human HL60 (Promyelocytic Leukemia) lysate
HCL-1209	Alpha Diagnostics	100ug	EUR 238

Human Protein PML, PML ELISA KIT
ELI-36129h	Lifescience Market	96 Tests	EUR 824

Mouse Protein PML, Pml ELISA KIT
ELI-15331m	Lifescience Market	96 Tests	EUR 865

HL60 Cell Lysate (Human promyelocytic leukemia cell line)
LF-R0009	Abfrontier	200 ul	EUR 86
Description: HL60 (Human promyelocytic leukemia cell line) Whole Cell Lysate

ELISA kit for Mouse Protein PML (PML)
KTE70720-48T	Abbkine	48T	EUR 332
Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein PML (PML)
KTE70720-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein PML (PML)
KTE70720-96T	Abbkine	96T	EUR 539
Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PML ELISA KIT|Human
EF001884	Lifescience Market	96 Tests	EUR 689

anti-PML Protein
YF-PA24405	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PML Protein

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

PML Colorimetric Cell-Based ELISA Kit
EKC1477	BosterBio	100ul	EUR 572

PML siRNA
20-abx929039	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PML siRNA
20-abx929040	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PML antibody
70R-50222	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal PML antibody

PML antibody
70R-30724	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal PML antibody

PML antibody
70R-7965	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal PML antibody

PML Antibody
ABD6318	Lifescience Market	100 ug	EUR 438

PML Antibody
32211-100ul	SAB	100ul	EUR 252

PML antibody
10R-1742	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal PML antibody

PML Antibody
DF6318	Affbiotech	200ul	EUR 304
Description: PML Antibody detects endogenous levels of total PML.

PML Antibody
1-CSB-PA003823	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PML. Recognizes PML from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

PML Antibody
CSB-PA018236KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PML Antibody
CSB-PA018236KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Anti-PML Protein Antibody
PB10084	BosterBio	100ug/vial	EUR 334

Anti-PML Protein Antibody
PB10085	BosterBio	100ug/vial	EUR 334

Anti-PML Protein (2B10)
YF-MA14783	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PML Protein

Anti-PML Protein (1D12)
YF-MA10708	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PML Protein

Human PML shRNA Plasmid
20-abx953606	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

PML Conjugated Antibody
C32211	SAB	100ul	EUR 397

PML cloning plasmid
CSB-CL018236HU-10ug	Cusabio	10ug	EUR 766
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2346 Sequence: atggagcctgcacccgcccgatctccgaggccccagcaggaccccgcccggccccaggagcccaccatgcctccccccgagaccccctctgaaggccgccagcccagccccagccccagccctacagagcgagcccccgcttcggaggaggagttccagtttctgcgctgccagc Show more
Description: A cloning plasmid for the PML gene.

PML Polyclonal Antibody
ES3239-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

PML Polyclonal Antibody
ES3239-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

anti- PML antibody
FNab06572	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: promyelocytic leukemia Uniprot ID: P29590 Gene ID: 5371 Research Area: Immunology, Metabolism
Description: Antibody raised against PML

PML Polyclonal Antibody
ABP52240-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody
ABP52240-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Polyclonal Antibody
ABP52240-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

PML Blocking Peptide
20-abx063097	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

PML / RARA Antibody
20-abx007137	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

PML Rabbit mAb
A19646-100ul	Abclonal	100 ul	EUR 410

PML Rabbit mAb
A19646-200ul	Abclonal	200 ul	EUR 571

PML Rabbit mAb
A19646-20ul	Abclonal	20 ul	EUR 221

PML Rabbit mAb
A19646-50ul	Abclonal	50 ul	EUR 287

PML Blocking Peptide
33R-2443	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PML antibody, catalog no. 70R-7965

PML Polyclonal Antibody
41354-100ul	SAB	100ul	EUR 252

PML Polyclonal Antibody
41354-50ul	SAB	50ul	EUR 187

PML Blocking Peptide
DF6318-BP	Affbiotech	1mg	EUR 195

Anti-PML antibody
PAab06572	Lifescience Market	100 ug	EUR 412

Anti-PML antibody
STJ95166	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PML.

Anti-PML antibody
STJ25034	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified.

HL-60 Cell Slide (Human (36yrs, Female) peripheral blood promyeloblast, acute promyelocytic leukemia) (5 slides/pk)
HCLS-17009	Alpha Diagnostics	1 pk	EUR 250

PML ORF Vector (Human) (pORF)
ORF007965	ABM	1.0 ug DNA	EUR 95

PML Protein Vector (Human) (pPB-C-His)
PV031857	ABM	500 ng	EUR 329

PML Protein Vector (Human) (pPB-N-His)
PV031858	ABM	500 ng	EUR 329

PML Protein Vector (Human) (pPM-C-HA)
PV031859	ABM	500 ng	EUR 329

PML Protein Vector (Human) (pPM-C-His)
PV031860	ABM	500 ng	EUR 329

Human Leukemia Inhibitory Factor ELISA kit
E01L0007-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia Inhibitory Factor ELISA kit
E01L0007-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia Inhibitory Factor ELISA kit
E01L0007-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human thymus- leukemia antigen ELISA Kit
ELA-E1555h	Lifescience Market	96 Tests	EUR 824

Human Leukemia- associated protein 7, DLEU7 ELISA KIT
ELI-14461h	Lifescience Market	96 Tests	EUR 824

Human Leukemia- associated protein 2, DLEU2 ELISA KIT
ELI-16219h	Lifescience Market	96 Tests	EUR 824

Human Leukemia- associated protein 1, DLEU1 ELISA KIT
ELI-31615h	Lifescience Market	96 Tests	EUR 824

Human Megakaryocytic Acute Leukemia Protein (MKL1) ELISA Kit
abx381459-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human PML- RARA- regulated adapter molecule 1, PRAM1 ELISA KIT
ELI-22264h	Lifescience Market	96 Tests	EUR 824

Human PML-RARA-regulated adapter molecule 1 (PRAM1) ELISA Kit
abx382446-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Polyclonal PML polyclonal antibody
AMR09397G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PML polyclonal . This antibody is tested and proven to work in the following applications:

PML/RARA Rabbit pAb
A7525-100ul	Abclonal	100 ul	EUR 308

PML/RARA Rabbit pAb
A7525-200ul	Abclonal	200 ul	EUR 459

PML/RARA Rabbit pAb
A7525-20ul	Abclonal	20 ul	EUR 183

PML/RARA Rabbit pAb
A7525-50ul	Abclonal	50 ul	EUR 223

PML/RARA Polyclonal Antibody
30953-100ul	SAB	100ul	EUR 252

PML/RARA Polyclonal Antibody
30953-50ul	SAB	50ul	EUR 187

Mouse PML shRNA Plasmid
20-abx972115	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-PML/RARA antibody
STJ29663	St John's Laboratory	100 µl	EUR 277

ELISA kit for Human Leukemia-associated protein 7 (DLEU7)
KTE62031-48T	Abbkine	48T	EUR 332
Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 7 (DLEU7)
KTE62031-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 7 (DLEU7)
KTE62031-96T	Abbkine	96T	EUR 539
Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 1 (DLEU1)
KTE62032-48T	Abbkine	48T	EUR 332
Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 1 (DLEU1)
KTE62032-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Leukemia-associated protein 1 (DLEU1)
KTE62032-96T	Abbkine	96T	EUR 539
Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac Show more
Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PML sgRNA CRISPR Lentivector set (Human)
K1673401	ABM	3 x 1.0 ug	EUR 339

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
abx576321-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Leukemia inhibitory factor receptor ELISA kit
E01L0235-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia inhibitory factor receptor ELISA kit
E01L0235-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukemia inhibitory factor receptor ELISA kit
E01L0235-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Leukemia inhibitory factor
EK1239	SAB	96 tests	EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Leukemia inhibitory factor in samples from serum, plasma, tissue homogenates and other biological fluids.

Human LIF/ Leukemia inhibitory factor ELISA Kit
E1462Hu	Sunlong	1 Kit	EUR 537

Human LIF(Leukemia inhibitory factor) ELISA Kit
EH0507	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: P15018 Alias: LIF(Leukemia Inhibitory Factor)/CDF/D factor/DIA/differentiation inhibitory activity/differentiation stimulating factor/Differentiation-stimulating factor/Emfilermin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Leukemia inhibitory factor(LIF)ELISA Kit
GA-E1128HM-48T	GenAsia Biotech	48T	EUR 289

Human Leukemia inhibitory factor(LIF)ELISA Kit
GA-E1128HM-96T	GenAsia Biotech	96T	EUR 466

Human thymus-leukemia antigen(TLa)ELISA Kit
GA-E1662HM-48T	GenAsia Biotech	48T	EUR 289

Human thymus-leukemia antigen(TLa)ELISA Kit
GA-E1662HM-96T	GenAsia Biotech	96T	EUR 466

Human Hepatic leukemia factor, HLF ELISA KIT
ELI-30911h	Lifescience Market	96 Tests	EUR 824

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
20-abx152198	Abbexa	EUR 5311.00 EUR 2837.00 EUR 668.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Thymus Leukemia Antigen (TLA) ELISA Kit
abx354514-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
abx253476-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Hepatic Leukemia Factor (HLF) ELISA Kit
abx387818-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Leukemia inhibitory factor,LIF ELISA kit
201-12-1112	SunredBio	96 tests	EUR 440
This Leukemia inhibitory factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human thymus-leukemia antigen,TLa ELISA Kit
201-12-1646	SunredBio	96 tests	EUR 440
This thymus-leukemia antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
DLR-LIF-Hu-48T	DL Develop	48T	EUR 380
Should the Human Leukemia Inhibitory Factor (LIF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukemia Inhibitory Factor (LIF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
DLR-LIF-Hu-96T	DL Develop	96T	EUR 485
Should the Human Leukemia Inhibitory Factor (LIF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukemia Inhibitory Factor (LIF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Leukemia inhibitory factor, LIF ELISA kit
CSB-E04651h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Leukemia inhibitory factor, LIF in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Leukemia inhibitory factor, LIF ELISA kit
1-CSB-E04651h	Cusabio	EUR 574.00 EUR 4013.00 EUR 2138.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Leukemia inhibitory factor, LIF in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Leukemia inhibitory factor,LIF ELISA kit
CN-03238H1	ChemNorm	96T	EUR 452

Human Leukemia inhibitory factor,LIF ELISA kit
CN-03238H2	ChemNorm	48T	EUR 302

Human thymus-leukemia antigen,TLa ELISA Kit
CN-04447H1	ChemNorm	96T	EUR 447

Human thymus-leukemia antigen,TLa ELISA Kit
CN-04447H2	ChemNorm	48T	EUR 296

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
SEA085Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 3069.07
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
SEA085Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 340.39
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
SEA085Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 443.42
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
SEA085Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 1695.39
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
4-SEA085Hu	Cloud-Clone	EUR 3120.00 EUR 1646.00 EUR 444.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Leukemia Inhibitory Factor elisa. Alternative names of the recognized antigen: CDF D-FACTOR HILDA MLPLI Cholinergic Differentiation Factor Differentiation-Stimulating Factor Melanoma-Derived LPL Inhibitor Emfilermin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Leukemia Inhibitory Factor (LIF) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Leukemia inhibitory factor(LIF) ELISA Kit
RK00123	Abclonal	96 Tests	EUR 521

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
RD-LIF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 367

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
RD-LIF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 502

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
RDR-LIF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 383

Human Leukemia Inhibitory Factor (LIF) ELISA Kit
RDR-LIF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 525

Human Leukemia inhibitory factor(LIF)ELISA Kit
QY-E04232	Qayee Biotechnology	96T	EUR 361

Human thymus-leukemia antigen(TLa)ELISA Kit
QY-E00766	Qayee Biotechnology	96T	EUR 361

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

PML Protein Vector (Mouse) (pPB-C-His)
PV217426	ABM	500 ng	EUR 1065

PML Protein Vector (Mouse) (pPB-N-His)
PV217427	ABM	500 ng	EUR 1065

PML Protein Vector (Mouse) (pPM-C-HA)
PV217428	ABM	500 ng	EUR 1065

PML Protein Vector (Mouse) (pPM-C-His)
PV217429	ABM	500 ng	EUR 1065

PML Protein Vector (Mouse) (pPB-C-His)
PV217430	ABM	500 ng	EUR 1065

PML Protein Vector (Mouse) (pPB-N-His)
PV217431	ABM	500 ng	EUR 1065

PML Protein Vector (Mouse) (pPM-C-HA)
PV217432	ABM	500 ng	EUR 1065

PML Protein Vector (Mouse) (pPM-C-His)
PV217433	ABM	500 ng	EUR 1065

Human T-cell leukemia/lymphoma protein 1A (TCL1A) ELISA Kit
abx518206-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human T cell leukemia homeobox protein 1(TLX1) ELISA kit
E01T0695-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 1(TLX1) ELISA kit
E01T0695-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 1(TLX1) ELISA kit
E01T0695-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 3(TLX3) ELISA kit
E01T0696-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 3(TLX3) ELISA kit
E01T0696-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T cell leukemia homeobox protein 3(TLX3) ELISA kit
E01T0696-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human TCL1A/ T-cell leukemia/lymphoma protein 1A ELISA Kit
E2460Hu	Sunlong	1 Kit	EUR 571

Human T- cell leukemia/lymphoma protein 1A, TCL1A ELISA KIT
ELI-05546h	Lifescience Market	96 Tests	EUR 824

Human T- cell leukemia homeobox protein 2, TLX2 ELISA KIT
ELI-16061h	Lifescience Market	96 Tests	EUR 824

Human T- cell leukemia/lymphoma protein 1B, TCL1B ELISA KIT
ELI-51950h	Lifescience Market	96 Tests	EUR 824

Human T- cell leukemia homeobox protein 1, TLX1 ELISA KIT
ELI-51739h	Lifescience Market	96 Tests	EUR 824

Human T- cell leukemia homeobox protein 3, TLX3 ELISA KIT
ELI-51740h	Lifescience Market	96 Tests	EUR 824

Human Brain And Acute Leukemia Cytoplasmic Protein (BAALC) ELISA Kit
20-abx385995	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human T-Cell Leukemia/Lymphoma Protein 1A(TCL1A)ELISA Kit
QY-E04512	Qayee Biotechnology	96T	EUR 361

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Mouse PML- RARA- regulated adapter molecule 1, Pram1 ELISA KIT
ELI-21673m	Lifescience Market	96 Tests	EUR 865

Mouse PML-RARA-regulated adapter molecule 1 (PRAM1) ELISA Kit
abx390265-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Goat Leukemia Inhibitory Factor ELISA kit
E06L0007-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Leukemia Inhibitory Factor ELISA kit
E06L0007-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Leukemia Inhibitory Factor ELISA kit
E06L0007-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Leukemia Inhibitory Factor ELISA kit
E02L0007-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Leukemia Inhibitory Factor ELISA kit
E02L0007-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Leukemia Inhibitory Factor ELISA kit
E02L0007-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Leukemia Inhibitory Factor ELISA kit
E03L0007-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Leukemia Inhibitory Factor ELISA kit
E03L0007-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Leukemia Inhibitory Factor ELISA kit
E03L0007-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Leukemia Inhibitory Factor ELISA kit
E04L0007-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Leukemia Inhibitory Factor ELISA kit
E04L0007-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Leukemia Inhibitory Factor ELISA kit
E04L0007-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat leukemia inhibitory factor ELISA Kit
ELA-E0085r	Lifescience Market	96 Tests	EUR 886

Dog Leukemia Inhibitory Factor ELISA kit
E08L0007-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Leukemia Inhibitory Factor ELISA kit
E08L0007-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Leukemia Inhibitory Factor ELISA kit
E08L0007-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Leukemia Inhibitory Factor ELISA kit
E07L0007-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Leukemia Inhibitory Factor ELISA kit
E07L0007-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Leukemia Inhibitory Factor ELISA kit
E07L0007-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PML(Promyelocytic Leukemia Protein) ELISA Kit