Human PML(Promyelocytic Leukemia Protein) ELISA Kit

Human PML(Promyelocytic Leukemia Protein) ELISA Kit

To Order Contact us below: 

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    RDR-PML-Hu-48Tests 48 Tests
    EUR 544

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    RDR-PML-Hu-96Tests 96 Tests
    EUR 756

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    RD-PML-Hu-48Tests 48 Tests
    EUR 521

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    RD-PML-Hu-96Tests 96 Tests
    EUR 723

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    20-abx152792
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    abx595499-96tests 96 tests
    EUR 637
    • Shipped within 1-2 weeks.

    Human Promyelocytic Leukemia Protein(PML)ELISA Kit

    QY-E00302 96T
    EUR 361

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    SEC221Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    SEC221Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    SEC221Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    SEC221Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Promyelocytic Leukemia Protein (PML) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Promyelocytic Leukemia Protein (PML) in tissue homogenates, cell lysates and other biological fluids.

    Human Promyelocytic Leukemia Protein (PML) ELISA Kit

    4-SEC221Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Promyelocytic Leukemia Protein elisa. Alternative names of the recognized antigen: MYL
    • RNF71
    • TRIM19
    • Probable Transcription Factor PML
    • Ring Finger Protein 71
    • Tripartite motif-containing protein 19
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Promyelocytic Leukemia Protein (PML) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Promyelocytic Leukemia Protein (PML) Antibody

    20-abx008856
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Promyelocytic Leukemia Protein (PML) Antibody

    20-abx103063
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Promyelocytic Leukemia Protein (PML) Antibody

    abx117056-100ug 100 ug
    EUR 467
    • Shipped within 5-10 working days.

    Promyelocytic Leukemia Protein (PML) Antibody

    20-abx174197
    • EUR 342.00
    • EUR 857.00
    • EUR 439.00
    • EUR 154.00
    • EUR 258.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Promyelocytic Leukemia Protein (PML) Antibody

    abx236572-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Promyelocytic Leukemia Protein (PML) Antibody

    20-abx324818
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Promyelocytic Leukemia Protein (PML) Antibody

    20-abx001098
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Recombinant Promyelocytic Leukemia Protein (PML)

    4-RPC221Hu01
    • EUR 413.60
    • EUR 214.00
    • EUR 1276.00
    • EUR 492.00
    • EUR 884.00
    • EUR 340.00
    • EUR 3040.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P29590
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 26.2kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Promyelocytic Leukemia Protein expressed in: E.coli

    Human Promyelocytic Leukemia Protein (PML) Protein

    20-abx068694
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Promyelocytic Leukemia Protein (PML) CLIA Kit

    20-abx493551
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human PML (Promyelocytic Leukemia Protein)

    ELK3769 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Promyelocytic Leukemia Protein (PML). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
    • Show more
    Description: A sandwich ELISA kit for detection of Promyelocytic Leukemia Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Promyelocytic Leukemia Protein (PML) Antibody (Biotin)

    20-abx272262
    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Promyelocytic Leukemia Protein (PML) Antibody (FITC)

    20-abx273636
    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human)

    4-PAC221Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PML (Gln59~Glu239)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML)

    Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), APC

    4-PAC221Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PML (Gln59~Glu239)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with APC.

    Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), Biotinylated

    4-PAC221Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PML (Gln59~Glu239)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with Biotin.

    Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), Cy3

    4-PAC221Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PML (Gln59~Glu239)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with Cy3.

    Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), FITC

    4-PAC221Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PML (Gln59~Glu239)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with FITC.

    Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), HRP

    4-PAC221Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PML (Gln59~Glu239)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with HRP.

    Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), PE

    4-PAC221Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PML (Gln59~Glu239)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with PE.

    Promyelocytic Leukemia Protein (PML) Polyclonal Antibody (Human), APC-Cy7

    4-PAC221Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PML (Gln59~Glu239)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Promyelocytic Leukemia Protein (PML). This antibody is labeled with APC-Cy7.

    Human HL60 (Promyelocytic Leukemia) lysate

    HCL-1209 100ug
    EUR 238

    Human Protein PML, PML ELISA KIT

    ELI-36129h 96 Tests
    EUR 824

    Mouse Protein PML, Pml ELISA KIT

    ELI-15331m 96 Tests
    EUR 865

    HL60 Cell Lysate (Human promyelocytic leukemia cell line)

    LF-R0009 200 ul
    EUR 86
    Description: HL60 (Human promyelocytic leukemia cell line) Whole Cell Lysate

    ELISA kit for Mouse Protein PML (PML)

    KTE70720-48T 48T
    EUR 332
    • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Protein PML (PML)

    KTE70720-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Protein PML (PML)

    KTE70720-96T 96T
    EUR 539
    • Probable transcription factor PML is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bod
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Protein PML (PML) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    PML ELISA KIT|Human

    EF001884 96 Tests
    EUR 689

    PML ELISA Kit (Human) (OKCD00314)

    OKCD00314 96 Wells
    EUR 831
    Description: Description of target: Functions via its association with PML-nuclear bodies (PML-NBs) in a wide range of important cellular processes, including tumor suppression, transcriptional regulation, apoptosis, senescence, DNA damage response, and viral defense mechanisms. Acts as the scaffold of PML-NBs allowing other proteins to shuttle in and out, a process which is regulated by SUMO-mediated modifications and interactions. Isoform PML-4 has a multifaceted role in the regulation of apoptosis and growth suppression: activates RB1 and inhibits AKT1 via interactions with PP1 and PP2A phosphatases respectively, negatively affects the PI3K pathway by inhibiting MTOR and activating PTEN, and positively regulates p53/TP53 by acting at different levels (by promoting its acetylation and phosphorylation and by inhibiting its MDM2-dependent degradation). Isoform PML-4 also: acts as a transcriptional repressor of TBX2 during cellular senescence and the repression is dependent on a functional RBL2/E2F4 repressor complex, regulates double-strand break repair in gamma-irradiation-induced DNA damage responses via its interaction with WRN, acts as a negative regulator of telomerase by interacting with TERT, and regulates PER2 nuclear localization and circadian function. Isoform PML-6 inhibits specifically the activity of the tetrameric form of PKM. The nuclear isoforms (isoform PML-1, isoform PML-2, isoform PML-3, isoform PML-4 and isoform PML-5) in concert with SATB1 are involved in local chromatin-loop remodeling and gene expression regulation at the MHC-I locus. Isoform PML-2 is required for efficient IFN-gamma induced MHC II gene transcription via regulation of CIITA. Cytoplasmic PML is involved in the regulation of the TGF-beta signaling pathway. PML also regulates transcription activity of ELF4 and can act as an important mediator for TNF-alpha- and IFN-alpha-mediated inhibition of endothelial cell network formation and migration. Exhibits antiviral activity against both DNA and RNA viruses. The antiviral activity can involve one or several isoform(s) and can be enhanced by the permanent PML-NB-associated protein DAXX or by the recruitment of p53/TP53 within these structures. Isoform PML-4 restricts varicella zoster virus (VZV) via sequestration of virion capsids in PML-NBs thereby preventing their nuclear egress and inhibiting formation of infectious virus particles. The sumoylated isoform PML-4 restricts rabies virus by inhibiting viral mRNA and protein synthesis. The cytoplasmic isoform PML-14 can restrict herpes simplex virus-1 (HHV-1) replication by sequestering the viral E3 ubiquitin-protein ligase ICP0 in the cytoplasm. Isoform PML-6 shows restriction activity towards human cytomegalovirus (HCMV) and influenza A virus strains PR8(H1N1) and ST364(H3N2). Sumoylated isoform PML-4 and isoform PML-12 show antiviral activity against encephalomyocarditis virus (EMCV) by promoting nuclear sequestration of viral polymerase (P3D-POL) within PML NBs. Isoform PML-3 exhibits antiviral activity against poliovirus by inducing apoptosis in infected cells through the recruitment and the activation of p53/TP53 in the PML-NBs. Isoform PML-3 represses human foamy virus (HFV) transcription by complexing the HFV transactivator, bel1/tas, preventing its binding to viral DNA. PML may positively regulate infectious hepatitis C viral (HCV) production and isoform PML-2 may enhance adenovirus transcription. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

    anti-PML Protein

    YF-PA24405 50 ul
    EUR 334
    Description: Mouse polyclonal to PML Protein

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    PML antibody

    70R-30724 100 ug
    EUR 327
    Description: Rabbit polyclonal PML antibody

    PML Antibody

    32211-100ul 100ul
    EUR 252

    PML antibody

    10R-1742 100 ug
    EUR 512
    Description: Mouse monoclonal PML antibody

    PML Antibody

    1-CSB-PA003823
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against PML. Recognizes PML from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

    PML Antibody

    DF6318 200ul
    EUR 304
    Description: PML Antibody detects endogenous levels of total PML.

    PML Antibody

    CSB-PA018236KA01HU-
    EUR 335
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

    PML Antibody

    CSB-PA018236KA01HU-100ul 100ul
    EUR 389
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against PML. Recognizes PML from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

    PML antibody

    70R-50222 100 ul
    EUR 244
    Description: Purified Polyclonal PML antibody

    PML antibody

    70R-7965 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal PML antibody

    PML siRNA

    20-abx929039
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PML siRNA

    20-abx929040
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PML Antibody

    ABD6318 100 ug
    EUR 438

    PML Colorimetric Cell-Based ELISA Kit

    EKC1477 100ul
    EUR 572

    Anti-PML Protein Antibody

    PB10084 100ug/vial
    EUR 334

    Anti-PML Protein Antibody

    PB10085 100ug/vial
    EUR 334

    Anti-PML Protein (1D12)

    YF-MA10708 100 ug
    EUR 363
    Description: Mouse monoclonal to PML Protein

    Anti-PML Protein (2B10)

    YF-MA14783 100 ug
    EUR 363
    Description: Mouse monoclonal to PML Protein

    Human PML shRNA Plasmid

    20-abx953606
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PML Colorimetric Cell-Based ELISA Kit (OKAG00988)

    OKAG00988 96 Wells
    EUR 596
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Type: Cell-Based
    Subtype: None
    Detection Method: Colorimetric 450 nm;Sensitivity:

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    PML Blocking Peptide

    33R-2443 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PML antibody, catalog no. 70R-7965

    PML Polyclonal Antibody

    41354-100ul 100ul
    EUR 252

    PML Polyclonal Antibody

    41354-50ul 50ul
    EUR 187

    PML Blocking Peptide

    DF6318-BP 1mg
    EUR 195

    PML / RARA Antibody

    20-abx007137
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    PML Blocking Peptide

    20-abx063097
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    PML Conjugated Antibody

    C32211 100ul
    EUR 397

    PML cloning plasmid

    CSB-CL018236HU-10ug 10ug
    EUR 766
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2346
    • Sequence: atggagcctgcacccgcccgatctccgaggccccagcaggaccccgcccggccccaggagcccaccatgcctccccccgagaccccctctgaaggccgccagcccagccccagccccagccctacagagcgagcccccgcttcggaggaggagttccagtttctgcgctgccagc
    • Show more
    Description: A cloning plasmid for the PML gene.

    PML Polyclonal Antibody

    ABP52240-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
    • Applications tips:
    Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

    PML Polyclonal Antibody

    ABP52240-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
    • Applications tips:
    Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

    PML Polyclonal Antibody

    ABP52240-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110
    • Applications tips:
    Description: A polyclonal antibody for detection of PML from Human. This PML antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human PML at AA range: 30-110

    PML Rabbit mAb

    A19646-100ul 100 ul
    EUR 410

    PML Rabbit mAb

    A19646-200ul 200 ul
    EUR 571

    PML Rabbit mAb

    A19646-20ul 20 ul
    EUR 221

    PML Rabbit mAb

    A19646-50ul 50 ul
    EUR 287

    anti- PML antibody

    FNab06572 100µg
    EUR 585
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: promyelocytic leukemia
    • Uniprot ID: P29590
    • Gene ID: 5371
    • Research Area: Immunology, Metabolism
    Description: Antibody raised against PML

    PML Polyclonal Antibody

    ES3239-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

    PML Polyclonal Antibody

    ES3239-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against PML from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

    Anti-PML antibody

    PAab06572 100 ug
    EUR 412

    Anti-PML antibody

    STJ25034 100 µl
    EUR 413
    Description: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified.

    Anti-PML antibody

    STJ95166 200 µl
    EUR 197
    Description: Rabbit polyclonal to PML.

    HL-60 Cell Slide (Human (36yrs, Female) peripheral blood promyeloblast, acute promyelocytic leukemia) (5 slides/pk)

    HCLS-17009 1 pk
    EUR 250

    PML ORF Vector (Human) (pORF)

    ORF007965 1.0 ug DNA
    EUR 95

    PML Protein Vector (Human) (pPB-C-His)

    PV031857 500 ng
    EUR 329

    PML Protein Vector (Human) (pPB-N-His)

    PV031858 500 ng
    EUR 329

    PML Protein Vector (Human) (pPM-C-HA)

    PV031859 500 ng
    EUR 329

    PML Protein Vector (Human) (pPM-C-His)

    PV031860 500 ng
    EUR 329

    Human Leukemia Inhibitory Factor ELISA kit

    E01L0007-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Leukemia Inhibitory Factor ELISA kit

    E01L0007-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Leukemia Inhibitory Factor ELISA kit

    E01L0007-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukemia Inhibitory Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human thymus- leukemia antigen ELISA Kit

    ELA-E1555h 96 Tests
    EUR 824

    Human Leukemia- associated protein 7, DLEU7 ELISA KIT

    ELI-14461h 96 Tests
    EUR 824

    Human Leukemia- associated protein 2, DLEU2 ELISA KIT

    ELI-16219h 96 Tests
    EUR 824

    Human Leukemia- associated protein 1, DLEU1 ELISA KIT

    ELI-31615h 96 Tests
    EUR 824

    Human Megakaryocytic Acute Leukemia Protein (MKL1) ELISA Kit

    abx381459-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Human PML- RARA- regulated adapter molecule 1, PRAM1 ELISA KIT

    ELI-22264h 96 Tests
    EUR 824

    Human PML-RARA-regulated adapter molecule 1 (PRAM1) ELISA Kit

    abx382446-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    PML/RARA Polyclonal Antibody

    30953-100ul 100ul
    EUR 252

    PML/RARA Polyclonal Antibody

    30953-50ul 50ul
    EUR 187

    Polyclonal PML polyclonal antibody

    AMR09397G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PML polyclonal . This antibody is tested and proven to work in the following applications:

    Mouse PML shRNA Plasmid

    20-abx972115
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PML/RARA Rabbit pAb

    A7525-100ul 100 ul
    EUR 308

    PML/RARA Rabbit pAb

    A7525-200ul 200 ul
    EUR 459

    PML/RARA Rabbit pAb

    A7525-20ul 20 ul
    EUR 183

    PML/RARA Rabbit pAb

    A7525-50ul 50 ul
    EUR 223

    Anti-PML/RARA antibody

    STJ29663 100 µl
    EUR 277

    PML sgRNA CRISPR Lentivector set (Human)

    K1673401 3 x 1.0 ug
    EUR 339

    ELISA kit for Human Leukemia-associated protein 7 (DLEU7)

    KTE62031-48T 48T
    EUR 332
    • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Leukemia-associated protein 7 (DLEU7)

    KTE62031-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Leukemia-associated protein 7 (DLEU7)

    KTE62031-96T 96T
    EUR 539
    • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 7 (DLEU7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Leukemia-associated protein 1 (DLEU1)

    KTE62032-48T 48T
    EUR 332
    • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Leukemia-associated protein 1 (DLEU1)

    KTE62032-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Leukemia-associated protein 1 (DLEU1)

    KTE62032-96T 96T
    EUR 539
    • Deletion of chromosome 13q14 is the most frequent genetic aberration in B-cell chronic lymphocytic leukemia (CLL), found in more than 50% of cases, indicating that this region contains a gene(s) involved in the development of CLL.DLEU7, located adjac
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Leukemia-associated protein 1 (DLEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Human Leukemia inhibitory factor,LIF ELISA kit

    201-12-1112 96 tests
    EUR 440
    • This Leukemia inhibitory factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human thymus-leukemia antigen,TLa ELISA Kit

    201-12-1646 96 tests
    EUR 440
    • This thymus-leukemia antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    DLR-LIF-Hu-48T 48T
    EUR 380
    • Should the Human Leukemia Inhibitory Factor (LIF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Leukemia Inhibitory Factor (LIF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    DLR-LIF-Hu-96T 96T
    EUR 485
    • Should the Human Leukemia Inhibitory Factor (LIF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Leukemia Inhibitory Factor (LIF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Leukemia inhibitory factor, LIF ELISA kit

    CSB-E04651h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Leukemia inhibitory factor, LIF in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Leukemia inhibitory factor, LIF ELISA kit

    1-CSB-E04651h
    • EUR 574.00
    • EUR 4013.00
    • EUR 2138.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Leukemia inhibitory factor, LIF in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Leukemia inhibitory factor receptor ELISA kit

    E01L0235-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Leukemia inhibitory factor receptor ELISA kit

    E01L0235-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Leukemia inhibitory factor receptor ELISA kit

    E01L0235-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Leukemia inhibitory factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    20-abx152198
    • EUR 5311.00
    • EUR 2837.00
    • EUR 668.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    abx253476-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.

    ELISA kit for Human Leukemia inhibitory factor

    EK1239 96 tests
    EUR 452
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Leukemia inhibitory factor in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human LIF/ Leukemia inhibitory factor ELISA Kit

    E1462Hu 1 Kit
    EUR 537

    Human LIF(Leukemia inhibitory factor) ELISA Kit

    EH0507 96T
    EUR 524.1
    • Detection range: 31.25-2000 pg/ml
    • Uniprot ID: P15018
    • Alias: LIF(Leukemia Inhibitory Factor)/CDF/D factor/DIA/differentiation inhibitory activity/differentiation stimulating factor/Differentiation-stimulating factor/Emfilermin
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

    Human Hepatic leukemia factor, HLF ELISA KIT

    ELI-30911h 96 Tests
    EUR 824

    Human Leukemia inhibitory factor,LIF ELISA kit

    CN-03238H1 96T
    EUR 452

    Human Leukemia inhibitory factor,LIF ELISA kit

    CN-03238H2 48T
    EUR 302

    Human thymus-leukemia antigen,TLa ELISA Kit

    CN-04447H1 96T
    EUR 447

    Human thymus-leukemia antigen,TLa ELISA Kit

    CN-04447H2 48T
    EUR 296

    Human Thymus Leukemia Antigen (TLA) ELISA Kit

    abx354514-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    abx576321-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.

    Human Hepatic Leukemia Factor (HLF) ELISA Kit

    abx387818-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human thymus-leukemia antigen(TLa)ELISA Kit

    GA-E1662HM-48T 48T
    EUR 289

    Human thymus-leukemia antigen(TLa)ELISA Kit

    GA-E1662HM-96T 96T
    EUR 466

    Human Leukemia inhibitory factor(LIF)ELISA Kit

    GA-E1128HM-48T 48T
    EUR 289

    Human Leukemia inhibitory factor(LIF)ELISA Kit

    GA-E1128HM-96T 96T
    EUR 466

    Human thymus-leukemia antigen(TLa)ELISA Kit

    QY-E00766 96T
    EUR 361

    Human Leukemia inhibitory factor(LIF)ELISA Kit

    QY-E04232 96T
    EUR 361

    Human Leukemia inhibitory factor(LIF) ELISA Kit

    RK00123 96 Tests
    EUR 521

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    SEA085Hu-10x96wellstestplate 10x96-wells test plate
    EUR 3069.07
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    SEA085Hu-1x48wellstestplate 1x48-wells test plate
    EUR 340.39
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    SEA085Hu-1x96wellstestplate 1x96-wells test plate
    EUR 443.42
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    SEA085Hu-5x96wellstestplate 5x96-wells test plate
    EUR 1695.39
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leukemia Inhibitory Factor (LIF) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leukemia Inhibitory Factor (LIF) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    4-SEA085Hu
    • EUR 3120.00
    • EUR 1646.00
    • EUR 444.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Leukemia Inhibitory Factor elisa. Alternative names of the recognized antigen: CDF
    • D-FACTOR
    • HILDA
    • MLPLI
    • Cholinergic Differentiation Factor
    • Differentiation-Stimulating Factor
    • Melanoma-Derived LPL Inhibitor
    • Emfilermin
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Leukemia Inhibitory Factor (LIF) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    RDR-LIF-Hu-48Tests 48 Tests
    EUR 383

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    RDR-LIF-Hu-96Tests 96 Tests
    EUR 525

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    RD-LIF-Hu-48Tests 48 Tests
    EUR 367

    Human Leukemia Inhibitory Factor (LIF) ELISA Kit

    RD-LIF-Hu-96Tests 96 Tests
    EUR 502

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    PML Protein Vector (Mouse) (pPB-C-His)

    PV217426 500 ng
    EUR 1065

    PML Protein Vector (Mouse) (pPB-N-His)

    PV217427 500 ng
    EUR 1065

    PML Protein Vector (Mouse) (pPM-C-HA)

    PV217428 500 ng
    EUR 1065

    PML Protein Vector (Mouse) (pPM-C-His)

    PV217429 500 ng
    EUR 1065

    PML Protein Vector (Mouse) (pPB-C-His)

    PV217430 500 ng
    EUR 1065

    PML Protein Vector (Mouse) (pPB-N-His)

    PV217431 500 ng
    EUR 1065

    PML Protein Vector (Mouse) (pPM-C-HA)

    PV217432 500 ng
    EUR 1065

    PML Protein Vector (Mouse) (pPM-C-His)

    PV217433 500 ng
    EUR 1065

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Human T cell leukemia homeobox protein 1(TLX1) ELISA kit

    E01T0695-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human T cell leukemia homeobox protein 1(TLX1) ELISA kit

    E01T0695-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human T cell leukemia homeobox protein 1(TLX1) ELISA kit

    E01T0695-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 1(TLX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human T cell leukemia homeobox protein 3(TLX3) ELISA kit

    E01T0696-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human T cell leukemia homeobox protein 3(TLX3) ELISA kit

    E01T0696-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human T cell leukemia homeobox protein 3(TLX3) ELISA kit

    E01T0696-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human T cell leukemia homeobox protein 3(TLX3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human TCL1A/ T-cell leukemia/lymphoma protein 1A ELISA Kit

    E2460Hu 1 Kit
    EUR 571

    Human T- cell leukemia homeobox protein 2, TLX2 ELISA KIT

    ELI-16061h 96 Tests
    EUR 824

    Human T- cell leukemia/lymphoma protein 1A, TCL1A ELISA KIT

    ELI-05546h 96 Tests
    EUR 824

    Human T- cell leukemia homeobox protein 1, TLX1 ELISA KIT

    ELI-51739h 96 Tests
    EUR 824

    Human T- cell leukemia homeobox protein 3, TLX3 ELISA KIT

    ELI-51740h 96 Tests
    EUR 824

    Human T- cell leukemia/lymphoma protein 1B, TCL1B ELISA KIT

    ELI-51950h 96 Tests
    EUR 824

    Human T-cell leukemia/lymphoma protein 1A (TCL1A) ELISA Kit

    abx518206-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Brain And Acute Leukemia Cytoplasmic Protein (BAALC) ELISA Kit

    20-abx385995
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human T-Cell Leukemia/Lymphoma Protein 1A(TCL1A)ELISA Kit

    QY-E04512 96T
    EUR 361

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    PML(isoform 5) Polyclonal Antibody

    30325-100ul 100ul
    EUR 252

    PML(isoform 5) Polyclonal Antibody

    30325-50ul 50ul
    EUR 187

    PML(isoform 5) Polyclonal Antibody

    30348-100ul 100ul
    EUR 252

    PML(isoform 5) Polyclonal Antibody

    30348-50ul 50ul
    EUR 187

    [KO Validated] PML Rabbit pAb

    A1184-100ul 100 ul
    EUR 410

    [KO Validated] PML Rabbit pAb

    A1184-200ul 200 ul
    EUR 571

    [KO Validated] PML Rabbit pAb

    A1184-20ul 20 ul
    EUR 221

    [KO Validated] PML Rabbit pAb

    A1184-50ul 50 ul
    EUR 287

    Polyclonal PML Antibody (aa37-51)

    AMR09395G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PML (aa37-51). This antibody is tested and proven to work in the following applications:

    PML/RARA Polyclonal Conjugated Antibody

    C30953 100ul
    EUR 397

    PML(isoform 5) Rabbit pAb

    A18134-100ul 100 ul
    EUR 308

    PML(isoform 5) Rabbit pAb

    A18134-200ul 200 ul
    EUR 459

    PML(isoform 5) Rabbit pAb

    A18134-20ul 20 ul
    EUR 183

    PML(isoform 5) Rabbit pAb

    A18134-50ul 50 ul
    EUR 223

    PML(isoform 5) Rabbit pAb

    A18182-100ul 100 ul
    EUR 308

    PML(isoform 5) Rabbit pAb

    A18182-200ul 200 ul
    EUR 459

    PML(isoform 5) Rabbit pAb

    A18182-20ul 20 ul
    EUR 183

    PML(isoform 5) Rabbit pAb

    A18182-50ul 50 ul
    EUR 223

    Anti-PML Rabbit Monoclonal Antibody

    M00093 100ug/vial
    EUR 397
    Description: Rabbit Monoclonal PML Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

    Human PML(Promyelocytic Leukemia Protein) ELISA Kit