Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit

Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit

To Order Contact us below: 

    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    RDR-HMBS-Hu-48Tests 48 Tests
    EUR 544
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    RDR-HMBS-Hu-96Tests 96 Tests
    EUR 756
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    RD-HMBS-Hu-48Tests 48 Tests
    EUR 521
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    RD-HMBS-Hu-96Tests 96 Tests
    EUR 723
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    20-abx151823
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Hydroxymethylbilane Synthase ELISA Kit (HMBS)
    RK01572 96 Tests
    EUR 521
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    SEE673Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    SEE673Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    SEE673Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    SEE673Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.
    Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
    4-SEE673Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Hydroxymethylbilane Synthase elisa. Alternative names of the recognized antigen: PBG-D
    • PBGD
    • UPS
    • Hydroxymethylbilane Synthase
    • Uroporphyrinogen I Synthase
    • Porphobilinogen deaminase
    • Pre-uroporphyrinogen synthase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hydroxymethylbilane Synthase (HMBS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Hydroxymethylbilane Synthase (HMBS) Antibody
    20-abx113081
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Hydroxymethylbilane Synthase (HMBS) Antibody
    20-abx129004
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Hydroxymethylbilane Synthase (HMBS) Antibody
    20-abx172852
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Recombinant Hydroxymethylbilane Synthase (HMBS)
    4-RPE673Hu01
    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P08397
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 31.6kDa
    • Isoelectric Point: 6.5
    Description: Recombinant Human Hydroxymethylbilane Synthase expressed in: E.coli
    Human Hydroxymethylbilane Synthase (HMBS) Protein
    20-abx168094
    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Hydroxymethylbilane Synthase (HMBS) CLIA Kit
    20-abx494686
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human HMBS (Hydroxymethylbilane Synthase)
    ELK4111 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hydroxymethylbilane Synthase (HMBS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
    • Show more
    Description: A sandwich ELISA kit for detection of Hydroxymethylbilane Synthase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    HMBS Hydroxymethylbilane Synthase Human Recombinant Protein
    PROTP08397 Regular: 20ug
    EUR 317
    Description: HMBS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 385 amino acids (1-361) and having a molecular mass of 41.9kDa.;HMBS is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig)
    4-PAE673Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMBS (Leu85~Ser337)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS)
    Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), APC
    4-PAE673Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMBS (Leu85~Ser337)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with APC.
    Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), Biotinylated
    4-PAE673Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMBS (Leu85~Ser337)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with Biotin.
    Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), Cy3
    4-PAE673Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMBS (Leu85~Ser337)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with Cy3.
    Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), FITC
    4-PAE673Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMBS (Leu85~Ser337)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with FITC.
    Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), HRP
    4-PAE673Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMBS (Leu85~Ser337)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with HRP.
    Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), PE
    4-PAE673Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMBS (Leu85~Ser337)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with PE.
    Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), APC-Cy7
    4-PAE673Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMBS (Leu85~Ser337)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with APC-Cy7.
    Hydroxymethylbilane Synthase (Recombinant)
    20-abx073331
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    Hmbs/ Rat Hmbs ELISA Kit
    ELI-30905r 96 Tests
    EUR 886
    HMBS ELISA KIT|Human
    EF010156 96 Tests
    EUR 689
    HMBS ELISA Kit (Human) (OKAN06214)
    OKAN06214 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.26 ng/mL
    HMBS ELISA Kit (Human) (OKCD08681)
    OKCD08681 96 Wells
    EUR 975
    Description: Description of target: HMBS is a member of the hydroxymethylbilane synthase superfamily. It is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria.This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.26ng/mL
    HMBS ELISA Kit (Human) (OKEH02521)
    OKEH02521 96 Wells
    EUR 831
    Description: Description of target: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.327 ng/mL
    Human HMBS/ Porphobilinogen deaminase ELISA Kit
    E1138Hu 1 Kit
    EUR 605
    Human Porphobilinogen deaminase (HMBS) ELISA Kit
    abx573587-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.
    Human Porphobilinogen deaminase, HMBS ELISA KIT
    ELI-48602h 96 Tests
    EUR 824
    Human HMBS Antibody
    35685-05111 150 ug
    EUR 261
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    HMBS antibody
    70R-17754 50 ul
    EUR 435
    Description: Rabbit polyclonal HMBS antibody
    HMBS Antibody
    32430-100ul 100ul
    EUR 252
    HMBS Antibody
    49010-100ul 100ul
    EUR 333
    HMBS Antibody
    49010-50ul 50ul
    EUR 239
    HMBS Antibody
    DF6611 200ul
    EUR 304
    Description: HMBS Antibody detects endogenous levels of total HMBS.
    HMBS antibody
    70R-3585 50 ug
    EUR 467
    Description: Rabbit polyclonal HMBS antibody raised against the middle region of HMBS
    HMBS antibody
    70R-3343 50 ug
    EUR 467
    Description: Rabbit polyclonal HMBS antibody raised against the N terminal of HMBS
    HMBS Antibody
    1-CSB-PA010524GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
    HMBS Antibody
    CSB-PA010524KA01HU-
    EUR 335
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
    HMBS Antibody
    CSB-PA010524KA01HU-100ul 100ul
    EUR 389
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
    HMBS Antibody
    1-CSB-PA010524LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
    HMBS siRNA
    20-abx919588
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    HMBS siRNA
    20-abx919589
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    HMBS Antibody
    ABD6611 100 ug
    EUR 438
    pOTB7-HMBS
    PVT18460 2 ug
    EUR 231
    anti-HMBS
    YF-PA12376 50 ul
    EUR 363
    Description: Mouse polyclonal to HMBS
    anti-HMBS
    YF-PA12377 100 ug
    EUR 403
    Description: Rabbit polyclonal to HMBS
    Mouse Hmbs/ Porphobilinogen deaminase ELISA Kit
    E0677Mo 1 Kit
    EUR 632
    Mouse Porphobilinogen deaminase, Hmbs ELISA KIT
    ELI-30904m 96 Tests
    EUR 865
    Bovine Porphobilinogen deaminase, HMBS ELISA KIT
    ELI-43928b 96 Tests
    EUR 928
    Mouse Porphobilinogen deaminase (HMBS) ELISA Kit
    abx555617-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.
    Rat Porphobilinogen deaminase (HMBS) ELISA Kit
    abx555711-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.
    Cow Porphobilinogen deaminase (HMBS) ELISA Kit
    abx555776-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human HMBS shRNA Plasmid
    20-abx952146
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    HMBS Recombinant Protein (Human)
    RP014953 100 ug Ask for price
    HMBS Rabbit mAb
    A11701-100ul 100 ul
    EUR 410
    HMBS Rabbit mAb
    A11701-200ul 200 ul
    EUR 571
    HMBS Rabbit mAb
    A11701-20ul 20 ul
    EUR 221
    HMBS Rabbit mAb
    A11701-50ul 50 ul
    EUR 287
    HMBS Blocking Peptide
    33R-8825 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMBS antibody, catalog no. 70R-3585
    HMBS Blocking Peptide
    33R-6388 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMBS antibody, catalog no. 70R-3343
    HMBS Blocking Peptide
    DF6611-BP 1mg
    EUR 195
    Anti-HMBS Antibody
    A01506-1 100ug/vial
    EUR 294
    HMBS Conjugated Antibody
    C49010 100ul
    EUR 397
    HMBS Conjugated Antibody
    C32430 100ul
    EUR 397
    HMBS cloning plasmid
    CSB-CL010524HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1086
    • Sequence: atgtctggtaacggcaatgcggctgcaacggcggaagaaaacagcccaaagatgagagtgattcgcgtgggtacccgcaagagccagcttgctcgcatacagacggacagtgtggtggcaacattgaaagcctcgtaccctggcctgcagtttgaaatcattgctatgtccacca
    • Show more
    Description: A cloning plasmid for the HMBS gene.
    HMBS Rabbit pAb
    A1777-100ul 100 ul
    EUR 308
    HMBS Rabbit pAb
    A1777-200ul 200 ul
    EUR 459
    HMBS Rabbit pAb
    A1777-20ul 20 ul
    EUR 183
    HMBS Rabbit pAb
    A1777-50ul 50 ul
    EUR 223
    anti- HMBS antibody
    FNab03918 100µg
    EUR 505.25
    • Immunogen: hydroxymethylbilane synthase
    • Uniprot ID: P08397
    • Gene ID: 3145
    • Research Area: Metabolism
    Description: Antibody raised against HMBS
    Anti-HMBS antibody
    PAab03918 100 ug
    EUR 355
    Anti-HMBS antibody
    STJ24034 100 µl
    EUR 277
    Description: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.
    Anti-HMBS (3E8)
    YF-MA13480 100 ug
    EUR 363
    Description: Mouse monoclonal to HMBS
    Anti-HMBS (2B12)
    YF-MA13481 100 ug
    EUR 363
    Description: Mouse monoclonal to HMBS
    Human HMBS Antibody (Biotin Conjugate)
    35685-05121 150 ug
    EUR 369
    HMBS ORF Vector (Human) (pORF)
    ORF004985 1.0 ug DNA
    EUR 95
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
    Column Packing Kit
    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
    Human Cardiolipin Synthase ELISA kit
    E01C0634-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cardiolipin Synthase ELISA kit
    E01C0634-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cardiolipin Synthase ELISA kit
    E01C0634-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Citrate Synthase ELISA kit
    E01C0830-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Citrate Synthase ELISA kit
    E01C0830-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Citrate Synthase ELISA kit
    E01C0830-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Thromboxane synthase ELISA kit
    E01T0553-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Thromboxane synthase ELISA kit
    E01T0553-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Thromboxane synthase ELISA kit
    E01T0553-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    PCR Mycoplasma Detection Kit
    M034-Kit Kit
    EUR 266
    HMBS protein (His tag)
    80R-2177 100 ug
    EUR 322
    Description: Purified recombinant Human HMBS protein (His tag)
    Porphobilinogen Deaminase (HMBS) Antibody
    abx117159-100ug 100 ug
    EUR 467
    • Shipped within 5-10 working days.
    Porphobilinogen Deaminase (HMBS) Antibody
    abx038138-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Porphobilinogen Deaminase (HMBS) Antibody
    abx145984-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    HMBS Antibody, HRP conjugated
    1-CSB-PA010524LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    HMBS Antibody, FITC conjugated
    1-CSB-PA010524LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    HMBS Antibody, Biotin conjugated
    1-CSB-PA010524LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit