Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit

Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit

To Order Contact us below: 

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
RDR-HMBS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
RDR-HMBS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
RD-HMBS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
RD-HMBS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
20-abx151823	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Hydroxymethylbilane Synthase ELISA Kit (HMBS)
RK01572	Abclonal	96 Tests	EUR 521

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
SEE673Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
SEE673Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
SEE673Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
SEE673Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hydroxymethylbilane Synthase (HMBS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hydroxymethylbilane Synthase (HMBS) in tissue homogenates, cell lysates and other biological fluids.

Human Hydroxymethylbilane Synthase (HMBS) ELISA Kit
4-SEE673Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hydroxymethylbilane Synthase elisa. Alternative names of the recognized antigen: PBG-D PBGD UPS Hydroxymethylbilane Synthase Uroporphyrinogen I Synthase Porphobilinogen deaminase Pre-uroporphyrinogen synthase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hydroxymethylbilane Synthase (HMBS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Hydroxymethylbilane Synthase (HMBS) Antibody
20-abx113081	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Hydroxymethylbilane Synthase (HMBS) Antibody
20-abx129004	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hydroxymethylbilane Synthase (HMBS) Antibody
20-abx172852	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Hydroxymethylbilane Synthase (HMBS)
4-RPE673Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P08397 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.6kDa Isoelectric Point: 6.5
Description: Recombinant Human Hydroxymethylbilane Synthase expressed in: E.coli

Human Hydroxymethylbilane Synthase (HMBS) Protein
20-abx168094	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Hydroxymethylbilane Synthase (HMBS) CLIA Kit
20-abx494686	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human HMBS (Hydroxymethylbilane Synthase)
ELK4111	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hydroxymethylbilane Synthase (HMBS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t Show more
Description: A sandwich ELISA kit for detection of Hydroxymethylbilane Synthase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

HMBS Hydroxymethylbilane Synthase Human Recombinant Protein
PROTP08397	BosterBio	Regular: 20ug	EUR 317
Description: HMBS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 385 amino acids (1-361) and having a molecular mass of 41.9kDa.;HMBS is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig)
4-PAE673Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMBS (Leu85~Ser337) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS)

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), APC
4-PAE673Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMBS (Leu85~Ser337) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with APC.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAE673Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMBS (Leu85~Ser337) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with Biotin.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), Cy3
4-PAE673Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMBS (Leu85~Ser337) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with Cy3.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), FITC
4-PAE673Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMBS (Leu85~Ser337) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with FITC.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), HRP
4-PAE673Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMBS (Leu85~Ser337) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with HRP.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), PE
4-PAE673Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMBS (Leu85~Ser337) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with PE.

Hydroxymethylbilane Synthase (HMBS) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAE673Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMBS (Leu85~Ser337) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Hydroxymethylbilane Synthase (HMBS). This antibody is labeled with APC-Cy7.

Hydroxymethylbilane Synthase (Recombinant)
20-abx073331	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Hmbs/ Rat Hmbs ELISA Kit
ELI-30905r	Lifescience Market	96 Tests	EUR 886

HMBS ELISA KIT|Human
EF010156	Lifescience Market	96 Tests	EUR 689

HMBS ELISA Kit (Human) (OKAN06214)
OKAN06214	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.26 ng/mL

HMBS ELISA Kit (Human) (OKCD08681)
OKCD08681	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: HMBS is a member of the hydroxymethylbilane synthase superfamily. It is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria.This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.26ng/mL

HMBS ELISA Kit (Human) (OKEH02521)
OKEH02521	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.327 ng/mL

Human HMBS/ Porphobilinogen deaminase ELISA Kit
E1138Hu	Sunlong	1 Kit	EUR 605

Human Porphobilinogen deaminase (HMBS) ELISA Kit
abx573587-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Porphobilinogen deaminase, HMBS ELISA KIT
ELI-48602h	Lifescience Market	96 Tests	EUR 824

Human HMBS Antibody
35685-05111	AssayPro	150 ug	EUR 261

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

HMBS antibody
70R-17754	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HMBS antibody

HMBS Antibody
32430-100ul	SAB	100ul	EUR 252

HMBS Antibody
49010-100ul	SAB	100ul	EUR 333

HMBS Antibody
49010-50ul	SAB	50ul	EUR 239

HMBS Antibody
DF6611	Affbiotech	200ul	EUR 304
Description: HMBS Antibody detects endogenous levels of total HMBS.

HMBS antibody
70R-3585	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HMBS antibody raised against the middle region of HMBS

HMBS antibody
70R-3343	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HMBS antibody raised against the N terminal of HMBS

HMBS Antibody
1-CSB-PA010524GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

HMBS Antibody
CSB-PA010524KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

HMBS Antibody
CSB-PA010524KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

HMBS Antibody
1-CSB-PA010524LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMBS. Recognizes HMBS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HMBS siRNA
20-abx919588	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HMBS siRNA
20-abx919589	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HMBS Antibody
ABD6611	Lifescience Market	100 ug	EUR 438

pOTB7-HMBS
PVT18460	Lifescience Market	2 ug	EUR 231

anti-HMBS
YF-PA12376	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to HMBS

anti-HMBS
YF-PA12377	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to HMBS

Mouse Hmbs/ Porphobilinogen deaminase ELISA Kit
E0677Mo	Sunlong	1 Kit	EUR 632

Mouse Porphobilinogen deaminase, Hmbs ELISA KIT
ELI-30904m	Lifescience Market	96 Tests	EUR 865

Bovine Porphobilinogen deaminase, HMBS ELISA KIT
ELI-43928b	Lifescience Market	96 Tests	EUR 928

Mouse Porphobilinogen deaminase (HMBS) ELISA Kit
abx555617-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Porphobilinogen deaminase (HMBS) ELISA Kit
abx555711-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Cow Porphobilinogen deaminase (HMBS) ELISA Kit
abx555776-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human HMBS shRNA Plasmid
20-abx952146	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HMBS Recombinant Protein (Human)
RP014953	ABM	100 ug	Ask for price

HMBS Rabbit mAb
A11701-100ul	Abclonal	100 ul	EUR 410

HMBS Rabbit mAb
A11701-200ul	Abclonal	200 ul	EUR 571

HMBS Rabbit mAb
A11701-20ul	Abclonal	20 ul	EUR 221

HMBS Rabbit mAb
A11701-50ul	Abclonal	50 ul	EUR 287

HMBS Blocking Peptide
33R-8825	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMBS antibody, catalog no. 70R-3585

HMBS Blocking Peptide
33R-6388	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMBS antibody, catalog no. 70R-3343

HMBS Blocking Peptide
DF6611-BP	Affbiotech	1mg	EUR 195

Anti-HMBS Antibody
A01506-1	BosterBio	100ug/vial	EUR 294

HMBS Conjugated Antibody
C49010	SAB	100ul	EUR 397

HMBS Conjugated Antibody
C32430	SAB	100ul	EUR 397

HMBS cloning plasmid
CSB-CL010524HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1086 Sequence: atgtctggtaacggcaatgcggctgcaacggcggaagaaaacagcccaaagatgagagtgattcgcgtgggtacccgcaagagccagcttgctcgcatacagacggacagtgtggtggcaacattgaaagcctcgtaccctggcctgcagtttgaaatcattgctatgtccacca Show more
Description: A cloning plasmid for the HMBS gene.

HMBS Rabbit pAb
A1777-100ul	Abclonal	100 ul	EUR 308

HMBS Rabbit pAb
A1777-200ul	Abclonal	200 ul	EUR 459

HMBS Rabbit pAb
A1777-20ul	Abclonal	20 ul	EUR 183

HMBS Rabbit pAb
A1777-50ul	Abclonal	50 ul	EUR 223

anti- HMBS antibody
FNab03918	FN Test	100µg	EUR 505.25
Immunogen: hydroxymethylbilane synthase Uniprot ID: P08397 Gene ID: 3145 Research Area: Metabolism
Description: Antibody raised against HMBS

Anti-HMBS antibody
PAab03918	Lifescience Market	100 ug	EUR 355

Anti-HMBS antibody
STJ24034	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-HMBS (3E8)
YF-MA13480	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HMBS

Anti-HMBS (2B12)
YF-MA13481	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HMBS

Human HMBS Antibody (Biotin Conjugate)
35685-05121	AssayPro	150 ug	EUR 369

HMBS ORF Vector (Human) (pORF)
ORF004985	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Cardiolipin Synthase ELISA kit
E01C0634-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cardiolipin Synthase ELISA kit
E01C0634-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cardiolipin Synthase ELISA kit
E01C0634-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cardiolipin Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Citrate Synthase ELISA kit
E01C0830-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Citrate Synthase ELISA kit
E01C0830-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Citrate Synthase ELISA kit
E01C0830-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Citrate Synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thromboxane synthase ELISA kit
E01T0553-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thromboxane synthase ELISA kit
E01T0553-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thromboxane synthase ELISA kit
E01T0553-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Thromboxane synthase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

HMBS protein (His tag)
80R-2177	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human HMBS protein (His tag)

Human HMBS(Hydroxymethylbilane Synthase) ELISA Kit