Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit

Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit

To Order Contact us below: 

    Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    RDR-FSIP1-Hu-96Tests 96 Tests
    EUR 756
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
    abx036889-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
    20-abx103912
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
    20-abx103913
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
    20-abx172434
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
    20-abx301576
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Recombinant Fibrous Sheath Interacting Protein 1 (FSIP1)
    4-RPJ086Hu01
    • EUR 512.16
    • EUR 240.00
    • EUR 1645.60
    • EUR 615.20
    • EUR 1130.40
    • EUR 406.00
    • EUR 3964.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q8NA03
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 59.3kDa
    • Isoelectric Point: 5.7
    Description: Recombinant Human Fibrous Sheath Interacting Protein 1 expressed in: E.coli
    Recombinant Fibrous Sheath Interacting Protein 1 (FSIP1)
    4-RPJ086Ra01
    • EUR 521.12
    • EUR 242.00
    • EUR 1679.20
    • EUR 626.40
    • EUR 1152.80
    • EUR 412.00
    • EUR 4048.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q66H16
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 52.2kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Rat Fibrous Sheath Interacting Protein 1 expressed in: E.coli
    Human Fibrous sheath- interacting protein 1, FSIP1 ELISA KIT
    ELI-07804h 96 Tests
    EUR 824
    Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    20-abx151592
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Fibrous Sheath Interacting Protein 1 (FSIP1)ELISA Kit
    201-12-2698 96 tests
    EUR 440
    • This Fibrous Sheath Interacting Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Fibrous Sheath Interacting Protein 1(FSIP1)ELISA Kit
    QY-E00894 96T
    EUR 361
    Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    SEJ086Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inte
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.
    Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    SEJ086Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inte
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.
    Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    SEJ086Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inte
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.
    Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    SEJ086Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inte
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.
    Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    4-SEJ086Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Fibrous Sheath Interacting Protein 1 elisa. Alternative names of the recognized antigen: HDS10
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human Fibrous Sheath Interacting Protein 1 (FSIP1) Protein
    20-abx066630
    • EUR 718.00
    • EUR 286.00
    • EUR 2221.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Mouse Fibrous sheath- interacting protein 1, Fsip1 ELISA KIT
    ELI-27549m 96 Tests
    EUR 865
    Mouse Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    abx389299-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Rat Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
    abx391338-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Fibrous Sheath Interacting Protein 1 (FSIP1) CLIA Kit
    20-abx495612
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Rat Fibrous Sheath Interacting Protein 1 (FSIP1) Protein
    20-abx066631
    • EUR 732.00
    • EUR 286.00
    • EUR 2263.00
    • EUR 871.00
    • EUR 523.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.
    ELISA kit for Human FSIP1 (Fibrous Sheath Interacting Protein 1)
    ELK3921 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fibrous Sheath Interacting Protein 1 (FSIP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
    • Show more
    Description: A sandwich ELISA kit for detection of Fibrous Sheath Interacting Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
    KTE62252-48T 48T
    EUR 332
    • FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
    KTE62252-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
    KTE62252-96T 96T
    EUR 539
    • FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (HRP)
    20-abx309686
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
    20-abx309687
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
    20-abx309688
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
    20-abx271217
    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
    20-abx271287
    • EUR 509.00
    • EUR 258.00
    • EUR 1525.00
    • EUR 704.00
    • EUR 411.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
    20-abx271483
    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
    20-abx271553
    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Fsip1 ELISA Kit| Rat Fibrous sheath-interacting protein 1 ELISA
    EF018693 96 Tests
    EUR 689
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human)
    4-PAJ086Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1)
    Fsip1 ELISA Kit| Mouse Fibrous sheath-interacting protein 1 ELI
    EF014930 96 Tests
    EUR 689
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat)
    4-PAJ086Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1)
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), APC
    4-PAJ086Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), Biotinylated
    4-PAJ086Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Biotin.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), Cy3
    4-PAJ086Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Cy3.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), FITC
    4-PAJ086Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with FITC.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), HRP
    4-PAJ086Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with HRP.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), PE
    4-PAJ086Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with PE.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), APC
    4-PAJ086Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), Biotinylated
    4-PAJ086Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Biotin.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), Cy3
    4-PAJ086Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Cy3.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), FITC
    4-PAJ086Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with FITC.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), HRP
    4-PAJ086Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with HRP.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), PE
    4-PAJ086Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with PE.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), APC-Cy7
    4-PAJ086Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC-Cy7.
    Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), APC-Cy7
    4-PAJ086Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC-Cy7.
    Human Fibrous sheath- interacting protein 2, FSIP2 ELISA KIT
    ELI-44048h 96 Tests
    EUR 824
    Fibrous Sheath-Interacting Protein 2 (FSIP2) Antibody
    20-abx302515
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Mouse Fibrous sheath- interacting protein 2, Fsip2 ELISA KIT
    ELI-13144m 96 Tests
    EUR 865
    Human Fibrous sheath CABYR- binding protein, FSCB ELISA KIT
    ELI-44081h 96 Tests
    EUR 824
    Human Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
    abx384910-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Fibrous sheath CABYR- binding protein, Fscb ELISA KIT
    ELI-13142m 96 Tests
    EUR 865
    Bovine Fibrous sheath CABYR- binding protein, FSCB ELISA KIT
    ELI-32480b 96 Tests
    EUR 928
    Mouse Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
    abx389298-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Rat Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
    abx391337-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Fscb ELISA Kit| Rat Fibrous sheath CABYR-binding protein ELISA
    EF018692 96 Tests
    EUR 689
    Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
    abx036854-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
    abx029847-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
    abx029847-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
    20-abx318381
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Fscb ELISA Kit| Mouse Fibrous sheath CABYR-binding protein ELIS
    EF014929 96 Tests
    EUR 689
    FSCB ELISA Kit| Bovine Fibrous sheath CABYR-binding protein ELI
    EF011387 96 Tests
    EUR 689
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (HRP)
    20-abx307471
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (FITC)
    20-abx307472
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (Biotin)
    20-abx307473
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Fsip1/ Rat Fsip1 ELISA Kit
    ELI-13143r 96 Tests
    EUR 886
    FSIP1 ELISA KIT|Human
    EF004989 96 Tests
    EUR 689
    Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit
    EN2550-1 96 Well Plate
    EUR 477
    FSIP1 ELISA Kit (Human) (OKCD01045)
    OKCD01045 96 Wells
    EUR 831
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL
    FSIP1 Recombinant Protein (Human)
    RP012580 100 ug Ask for price
    FSIP1 siRNA
    20-abx902018
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    FSIP1 siRNA
    20-abx917260
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    FSIP1 siRNA
    20-abx917261
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    FSIP1 antibody
    70R-3397 50 ug
    EUR 467
    Description: Rabbit polyclonal FSIP1 antibody raised against the middle region of FSIP1
    FSIP1 Antibody
    1-CSB-PA843306LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FSIP1. Recognizes FSIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes
    mRNAExpress mRNA Synthesis kit (5 reactions)
    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products
    FSIP1 Recombinant Protein (Rat)
    RP201812 100 ug Ask for price
    FSIP1 Recombinant Protein (Mouse)
    RP135323 100 ug Ask for price
    ARFIP1341 a.a.Human ADP-Ribosylation Factor Interacting Protein 1 341 a.a Human Recombinant Protein
    PROTP53367-1 Regular: 10ug
    EUR 317
    Description: ARFIP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 364 amino acids (1-341 a.a) and having a molecular mass of 41.0kDa.;ARFIP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    Human Postacrosomal sheath WW domain-binding protein (WBP2NL) ELISA Kit
    abx384276-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    DLR-PAWP-Hu-48T 48T
    EUR 554
    • Should the Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
    Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    DLR-PAWP-Hu-96T 96T
    EUR 725
    • Should the Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
    Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RD-PAWP-Hu-48Tests 48 Tests
    EUR 563
    Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RD-PAWP-Hu-96Tests 96 Tests
    EUR 783
    Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RDR-PAWP-Hu-48Tests 48 Tests
    EUR 589
    Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RDR-PAWP-Hu-96Tests 96 Tests
    EUR 820
    Human Huntingtin Interacting Protein 1 (HIP1) ELISA Kit
    20-abx585329
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Nuclear Receptor Interacting Protein 1 ELISA kit
    E01N0045-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Nuclear Receptor Interacting Protein 1 ELISA kit
    E01N0045-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Nuclear Receptor Interacting Protein 1 ELISA kit
    E01N0045-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
    E01P0840-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
    E01P0840-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
    E01P0840-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Folliculin- interacting protein 1, FNIP1 ELISA KIT
    ELI-09886h 96 Tests
    EUR 824
    Human BBSome- interacting protein 1, BBIP1 ELISA KIT
    ELI-11445h 96 Tests
    EUR 824
    Human Max- interacting protein 1, MXI1 ELISA KIT
    ELI-20014h 96 Tests
    EUR 824
    Human PAX- interacting protein 1, PAXIP1 ELISA KIT
    ELI-22834h 96 Tests
    EUR 824
    Human Dysferlin- interacting protein 1, DYSFIP1 ELISA KIT
    ELI-26025h 96 Tests
    EUR 824
    Human Ras- interacting protein 1, RASIP1 ELISA KIT
    ELI-14831h 96 Tests
    EUR 824
    Human PRKR- interacting protein 1, PRKRIP1 ELISA KIT
    ELI-15223h 96 Tests
    EUR 824
    Human PDZK1- interacting protein 1, PDZK1IP1 ELISA KIT
    ELI-15263h 96 Tests
    EUR 824
    Human Huntingtin- interacting protein 1, HIP1 ELISA KIT
    ELI-27119h 96 Tests
    EUR 824
    Human Schwannomin- interacting protein 1, SCHIP1 ELISA KIT
    ELI-53041h 96 Tests
    EUR 824
    Human RAD50- interacting protein 1, RINT1 ELISA KIT
    ELI-45219h 96 Tests
    EUR 824
    Human Mid1- interacting protein 1, MID1IP1 ELISA KIT
    ELI-31441h 96 Tests
    EUR 824
    Human EPM2A- interacting protein 1, EPM2AIP1 ELISA KIT
    ELI-31634h 96 Tests
    EUR 824
    Human TRAF3- interacting protein 1, TRAF3IP1 ELISA KIT
    ELI-38967h 96 Tests
    EUR 824
    Human TNFAIP3- interacting protein 1, TNIP1 ELISA KIT
    ELI-39992h 96 Tests
    EUR 824
    Human ProSAP- interacting protein 1, PROSAPIP1 ELISA KIT
    ELI-37913h 96 Tests
    EUR 824
    Human PAX-Interacting Protein 1 (PAXIP1) ELISA Kit
    abx259801-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human MID1 Interacting Protein 1 (MID1IP1) ELISA Kit
    abx381447-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human PAK1 Interacting Protein 1 (PAK1IP1) ELISA Kit
    abx382035-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Ras-interacting protein 1 (RASIP1) ELISA Kit
    abx382701-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Schwannomin-interacting protein 1 (SCHIP1) ELISA Kit
    abx383047-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human TNFAIP3-interacting protein 1 (TNIP1) ELISA Kit
    abx383851-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human TRAF3 interacting protein 1 (TRAF3IP1) ELISA Kit
    abx383895-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human CASK Interacting Protein 1 (CASKIN1) ELISA Kit
    abx384670-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
    abx384768-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Max-interacting protein 1 (MXI1) ELISA Kit
    abx385133-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Folliculin Interacting Protein 1 (FNIP1) ELISA Kit
    abx387393-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human TNFAIP3-interacting protein 1(TNIP1) ELISA kit
    CSB-EL023999HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human TNFAIP3-interacting protein 1(TNIP1) ELISA kit
    1-CSB-EL023999HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human TNFAIP3-interacting protein 1(TNIP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human FSIP1 shRNA Plasmid
    20-abx965936
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
    KTE61639-48T 48T
    EUR 332
    • Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
    KTE61639-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
    KTE61639-96T 96T
    EUR 539
    • Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    FSIP1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K0817002 1.0 ug DNA
    EUR 154
    Human Cytohesin Interacting Protein ELISA kit
    E01C0575-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cytohesin Interacting Protein ELISA kit
    E01C0575-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cytohesin Interacting Protein ELISA kit
    E01C0575-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Hedgehog Interacting Protein ELISA kit
    E01H0058-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Hedgehog Interacting Protein ELISA kit
    E01H0058-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Hedgehog Interacting Protein ELISA kit
    E01H0058-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    FSIP1 Rabbit pAb
    A14971-100ul 100 ul
    EUR 308
    FSIP1 Rabbit pAb
    A14971-200ul 200 ul
    EUR 459
    FSIP1 Rabbit pAb
    A14971-20ul 20 ul
    EUR 183
    FSIP1 Rabbit pAb
    A14971-50ul 50 ul
    EUR 223
    FSIP1 Polyclonal Antibody
    A66766 100 µg
    EUR 570.55
    Description: The best epigenetics products
    FSIP1 Blocking Peptide
    33R-1906 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FSIP1 antibody, catalog no. 70R-3397
    FSIP1 Polyclonal Antibody
    28786-100ul 100ul
    EUR 252
    FSIP1 Polyclonal Antibody
    28786-50ul 50ul
    EUR 187
    FSIP1 cloning plasmid
    CSB-CL843306HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1746
    • Sequence: atggatattataaagggaaacctagatggaatttcaaaaccagcttcaaattcaagaatacgccctgggagcagaagttcaaatgcttctttggaggtgctctcaacagaaccaggatccttcaaggtcgatactgcaagcaacttgaactctggtaaagaggaccactccgaaa
    • Show more
    Description: A cloning plasmid for the FSIP1 gene.
    Anti-FSIP1 antibody
    STJ117170 100 µl
    EUR 277
    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    Human Huntingtin Interacting Protein 1 Related (HIP1R) ELISA Kit
    20-abx585330
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
    E01C2216-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
    E01C2216-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
    E01C2216-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human A kinase interacting protein 1(C11orf17) ELISA kit
    E01A1790-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human A kinase interacting protein 1(C11orf17) ELISA kit
    E01A1790-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human A kinase interacting protein 1(C11orf17) ELISA kit
    E01A1790-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human β catenin interacting protein 1(CTNNBIP1) ELISA kit
    E01B0897-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human β catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human β catenin interacting protein 1(CTNNBIP1) ELISA kit
    E01B0897-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human β catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human β catenin interacting protein 1(CTNNBIP1) ELISA kit
    E01B0897-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human β catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
    E01G0400-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
    E01G0400-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
    E01G0400-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Beta- catenin- interacting protein 1, CTNNBIP1 ELISA KIT
    ELI-10618h 96 Tests
    EUR 824
    Human NEDD4 family- interacting protein 1, NDFIP1 ELISA KIT
    ELI-20710h 96 Tests
    EUR 824
    Human Nuclear receptor- interacting protein 1, NRIP1 ELISA KIT
    ELI-15105h 96 Tests
    EUR 824
    Human Torsin- 1A- interacting protein 1, TOR1AIP1 ELISA KIT
    ELI-17015h 96 Tests
    EUR 824
    Human Glutamate receptor- interacting protein 1, GRIP1 ELISA KIT
    ELI-08298h 96 Tests
    EUR 824
    Human Homeodomain- interacting protein kinase 1, HIPK1 ELISA KIT
    ELI-08581h 96 Tests
    EUR 824
    Human A- kinase- interacting protein 1, AKIP1 ELISA KIT
    ELI-34608h 96 Tests
    EUR 824
    Human Filamin- A- interacting protein 1, FILIP1 ELISA KIT
    ELI-44006h 96 Tests
    EUR 824
    Human Kv channel- interacting protein 1, KCNIP1 ELISA KIT
    ELI-44157h 96 Tests
    EUR 824
    Human Rab11 family- interacting protein 1, RAB11FIP1 ELISA KIT
    ELI-44329h 96 Tests
    EUR 824
    Human Cytoplasmic FMR1- interacting protein 1, CYFIP1 ELISA KIT
    ELI-47397h 96 Tests
    EUR 824
    Human TEL2- interacting protein 1 homolog, TTI1 ELISA KIT
    ELI-28406h 96 Tests
    EUR 824
    Human Smad nuclear- interacting protein 1, SNIP1 ELISA KIT
    ELI-29579h 96 Tests
    EUR 824
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    20-abx151746
    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human NEDD4 family-interacting protein 1 (NDFIP1) ELISA Kit
    abx381720-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human NUFIP1, FMR1 Interacting Protein 1 (NUFIP1) ELISA Kit
    abx381923-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human PBX Homeobox Interacting Protein 1 (PBXIP1) ELISA Kit
    abx382079-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Rab11 family-interacting protein 1 (RAB11FIP1) ELISA Kit
    abx382595-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Smad nuclear-interacting protein 1 (SNIP1) ELISA Kit
    abx383339-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Torsin 1A interacting protein 1 (TOR1AIP1) ELISA Kit
    abx383871-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human TELO2-Interacting Protein 1 Homolog (TTI1) ELISA Kit
    abx384020-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Catenin Beta Interacting Protein 1 (CTNNBIP1) ELISA Kit
    abx384674-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human EPM2A (Laforin) Interacting Protein 1 (EPM2AIP1) ELISA Kit
    abx384848-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Cytoplasmic FMR1 Interacting Protein 1 (CYFIP1) ELISA Kit
    abx384917-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Nuclear Receptor Interacting Protein 1 (NRIP1) ELISA Kit
    abx385234-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Deoxynucleotidyltransferase Terminal-Interacting Protein 1 (DNTTIP1) ELISA Kit
    abx386960-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human v Channel Interacting Protein 1 (KCNIP1) ELISA Kit
    abx388085-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    DLR-GRIP1-Hu-48T 48T
    EUR 498
    • Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    DLR-GRIP1-Hu-96T 96T
    EUR 647
    • Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
    KTE62342-48T 48T
    EUR 332
    • The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
    KTE62342-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
    KTE62342-96T 96T
    EUR 539
    • The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
    KTE61622-48T 48T
    EUR 332
    • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
    KTE61622-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
    KTE61622-96T 96T
    EUR 539
    • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
    KTE60199-48T 48T
    EUR 332
    • Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
    KTE60199-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
    KTE60199-96T 96T
    EUR 539
    • Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    SEB753Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4502.43
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    SEB753Hu-1x48wellstestplate 1x48-wells test plate
    EUR 458.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    SEB753Hu-1x96wellstestplate 1x96-wells test plate
    EUR 612.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    SEB753Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2454.23
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    4-SEB753Hu
    • EUR 4553.00
    • EUR 2405.00
    • EUR 613.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Glutamate Receptor Interacting Protein 1 elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    RD-GRIP1-Hu-48Tests 48 Tests
    EUR 500
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    RD-GRIP1-Hu-96Tests 96 Tests
    EUR 692
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    RDR-GRIP1-Hu-48Tests 48 Tests
    EUR 522
    Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
    RDR-GRIP1-Hu-96Tests 96 Tests
    EUR 724
    Human Glutamate Receptor Interacting Protein 1(GRIP1)ELISA Kit
    QY-E03336 96T
    EUR 361
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    Human WTIP/ Wilms tumor protein 1-interacting protein ELISA Kit
    E2698Hu 1 Kit
    EUR 571
    Human WTIP(Wilms tumor protein 1-interacting protein) ELISA Kit
    EH2071 96T
    EUR 567.6
    • Detection range: 78-5000 pg/ml
    • Uniprot ID: A6NIX2
    • Alias: WTIP(Wilms tumor protein 1-interacting protein)/WT1-interacting protein
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
    Human Wilms tumor protein 1- interacting protein, WTIP ELISA KIT
    ELI-06581h 96 Tests
    EUR 824
    Human Wilms tumor protein 1-interacting protein (WTIP) ELISA Kit
    abx251402-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    FSIP1 ORF Vector (Human) (pORF)
    ORF004194 1.0 ug DNA
    EUR 95
    Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
    EK2802-1 96 Well Plate
    EUR 477
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools
    FSIP1 Protein Vector (Human) (pPB-C-His)
    PV016773 500 ng
    EUR 329
    FSIP1 Protein Vector (Human) (pPB-N-His)
    PV016774 500 ng
    EUR 329
    FSIP1 Protein Vector (Human) (pPM-C-HA)
    PV016775 500 ng
    EUR 329
    FSIP1 Protein Vector (Human) (pPM-C-His)
    PV016776 500 ng
    EUR 329
    Cow Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    20-abx150178
    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    DLR-PAWP-b-48T 48T
    EUR 637
    • Should the Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
    Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    DLR-PAWP-b-96T 96T
    EUR 839
    • Should the Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
    Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    DLR-PAWP-Mu-48T 48T
    EUR 566
    • Should the Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
    Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    DLR-PAWP-Mu-96T 96T
    EUR 741
    • Should the Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
    Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RD-PAWP-b-48Tests 48 Tests
    EUR 657
    Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RD-PAWP-b-96Tests 96 Tests
    EUR 917
    Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RD-PAWP-Mu-48Tests 48 Tests
    EUR 577
    Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RD-PAWP-Mu-96Tests 96 Tests
    EUR 802
    Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RDR-PAWP-b-48Tests 48 Tests
    EUR 687
    Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RDR-PAWP-b-96Tests 96 Tests
    EUR 960
    Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RDR-PAWP-Mu-48Tests 48 Tests
    EUR 603
    Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    RDR-PAWP-Mu-96Tests 96 Tests
    EUR 840
    Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    SEM974Bo-10x96wellstestplate 10x96-wells test plate
    EUR 6197.58
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.
    Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    SEM974Bo-1x48wellstestplate 1x48-wells test plate
    EUR 598.04
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.
    Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    SEM974Bo-1x96wellstestplate 1x96-wells test plate
    EUR 811.48
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.
    Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    SEM974Bo-5x96wellstestplate 5x96-wells test plate
    EUR 3351.66
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.
    Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
    4-SEM974Bo
    • EUR 6248.00
    • EUR 3302.00
    • EUR 812.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Postacrosomal Sheath WW Domain Binding Protein elisa. Alternative names of the recognized antigen: WBP2NL
    • WBP2 N-Terminal Like
    • WW domain-binding protein 2-like
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
    Monkey Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
    abx360092-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Pig Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
    abx361849-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Rabbit Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
    abx363225-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Rat Nuclear Receptor Interacting Protein 1 ELISA kit
    E02N0045-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Nuclear Receptor Interacting Protein 1 ELISA kit
    E02N0045-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit