Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit

Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit

To Order Contact us below: 

Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
RD-FSIP1-Hu-96Tests 96 Tests
EUR 723
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
20-abx103912
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
20-abx103913
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
abx036889-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
20-abx172434
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
20-abx301576
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Fibrous Sheath Interacting Protein 1 (FSIP1)
4-RPJ086Hu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8NA03
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 59.3kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Fibrous Sheath Interacting Protein 1 expressed in: E.coli
Recombinant Fibrous Sheath Interacting Protein 1 (FSIP1)
4-RPJ086Ra01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q66H16
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 52.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Fibrous Sheath Interacting Protein 1 expressed in: E.coli
Human Fibrous Sheath Interacting Protein 1 (FSIP1)ELISA Kit
201-12-2698 96 tests
EUR 440
  • This Fibrous Sheath Interacting Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
20-abx151592
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Fibrous sheath- interacting protein 1, FSIP1 ELISA KIT
ELI-07804h 96 Tests
EUR 824
Human Fibrous Sheath Interacting Protein 1(FSIP1)ELISA Kit
QY-E00894 96T
EUR 361
Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
SEJ086Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.
Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
SEJ086Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.
Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
SEJ086Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.
Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
SEJ086Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.
Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
4-SEJ086Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fibrous Sheath Interacting Protein 1 elisa. Alternative names of the recognized antigen: HDS10
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Fibrous Sheath Interacting Protein 1 (FSIP1) Protein
20-abx066630
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Fibrous sheath- interacting protein 1, Fsip1 ELISA KIT
ELI-27549m 96 Tests
EUR 865
Rat Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
abx391338-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
abx389299-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Fibrous Sheath Interacting Protein 1 (FSIP1) CLIA Kit
20-abx495612
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Rat Fibrous Sheath Interacting Protein 1 (FSIP1) Protein
20-abx066631
  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
ELISA kit for Human FSIP1 (Fibrous Sheath Interacting Protein 1)
ELK3921 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fibrous Sheath Interacting Protein 1 (FSIP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Fibrous Sheath Interacting Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
KTE62252-48T 48T
EUR 332
  • FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
KTE62252-5platesof96wells 5 plates of 96 wells
EUR 2115
  • FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
KTE62252-96T 96T
EUR 539
  • FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
20-abx271217
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
20-abx271287
  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
20-abx271483
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
20-abx271553
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (HRP)
20-abx309686
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
20-abx309687
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
20-abx309688
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fsip1 ELISA Kit| Rat Fibrous sheath-interacting protein 1 ELISA
EF018693 96 Tests
EUR 689
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human)
4-PAJ086Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1)
Fsip1 ELISA Kit| Mouse Fibrous sheath-interacting protein 1 ELI
EF014930 96 Tests
EUR 689
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat)
4-PAJ086Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1)
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), APC
4-PAJ086Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), Biotinylated
4-PAJ086Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Biotin.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), Cy3
4-PAJ086Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Cy3.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), FITC
4-PAJ086Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with FITC.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), HRP
4-PAJ086Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with HRP.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), PE
4-PAJ086Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with PE.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), APC
4-PAJ086Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), Biotinylated
4-PAJ086Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Biotin.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), Cy3
4-PAJ086Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Cy3.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), FITC
4-PAJ086Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with FITC.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), HRP
4-PAJ086Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with HRP.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), PE
4-PAJ086Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with PE.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), APC-Cy7
4-PAJ086Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Asp55~Asp287)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC-Cy7.
Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAJ086Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FSIP1 (Lys109~Glu328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC-Cy7.
Human Fibrous sheath- interacting protein 2, FSIP2 ELISA KIT
ELI-44048h 96 Tests
EUR 824
Mouse Fibrous sheath- interacting protein 2, Fsip2 ELISA KIT
ELI-13144m 96 Tests
EUR 865
Fibrous Sheath-Interacting Protein 2 (FSIP2) Antibody
20-abx302515
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Fibrous sheath CABYR- binding protein, FSCB ELISA KIT
ELI-44081h 96 Tests
EUR 824
Human Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
abx384910-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Fibrous sheath CABYR- binding protein, Fscb ELISA KIT
ELI-13142m 96 Tests
EUR 865
Rat Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
abx391337-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
abx389298-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Bovine Fibrous sheath CABYR- binding protein, FSCB ELISA KIT
ELI-32480b 96 Tests
EUR 928
Fscb ELISA Kit| Rat Fibrous sheath CABYR-binding protein ELISA
EF018692 96 Tests
EUR 689
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
abx036854-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
abx029847-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
abx029847-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
20-abx318381
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fscb ELISA Kit| Mouse Fibrous sheath CABYR-binding protein ELIS
EF014929 96 Tests
EUR 689
FSCB ELISA Kit| Bovine Fibrous sheath CABYR-binding protein ELI
EF011387 96 Tests
EUR 689
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (HRP)
20-abx307471
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (FITC)
20-abx307472
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (Biotin)
20-abx307473
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Fsip1/ Rat Fsip1 ELISA Kit
ELI-13143r 96 Tests
EUR 886
FSIP1 ELISA KIT|Human
EF004989 96 Tests
EUR 689
Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit
EN2550-1 96 Well Plate
EUR 477
FSIP1 Recombinant Protein (Human)
RP012580 100 ug Ask for price
FSIP1 Antibody
1-CSB-PA843306LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSIP1. Recognizes FSIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
FSIP1 antibody
70R-3397 50 ug
EUR 467
Description: Rabbit polyclonal FSIP1 antibody raised against the middle region of FSIP1
FSIP1 siRNA
20-abx902018
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FSIP1 siRNA
20-abx917260
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FSIP1 siRNA
20-abx917261
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
FSIP1 Recombinant Protein (Rat)
RP201812 100 ug Ask for price
FSIP1 Recombinant Protein (Mouse)
RP135323 100 ug Ask for price
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
ARFIP1341 a.a.Human ADP-Ribosylation Factor Interacting Protein 1 341 a.a Human Recombinant Protein
PROTP53367-1 Regular: 10ug
EUR 317
Description: ARFIP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 364 amino acids (1-341 a.a) and having a molecular mass of 41.0kDa.;ARFIP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-Hu-48T 48T
EUR 554
  • Should the Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-Hu-96T 96T
EUR 725
  • Should the Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
Human Postacrosomal sheath WW domain-binding protein (WBP2NL) ELISA Kit
abx384276-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-Hu-48Tests 48 Tests
EUR 589
Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-Hu-96Tests 96 Tests
EUR 820
Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-Hu-48Tests 48 Tests
EUR 563
Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-Hu-96Tests 96 Tests
EUR 783
Human TNFAIP3-interacting protein 1(TNIP1) ELISA kit
CSB-EL023999HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human TNFAIP3-interacting protein 1(TNIP1) ELISA kit
1-CSB-EL023999HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human TNFAIP3-interacting protein 1(TNIP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
E01P0840-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
E01P0840-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
E01P0840-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human PAX-Interacting Protein 1 (PAXIP1) ELISA Kit
abx259801-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Ras- interacting protein 1, RASIP1 ELISA KIT
ELI-14831h 96 Tests
EUR 824
Human PRKR- interacting protein 1, PRKRIP1 ELISA KIT
ELI-15223h 96 Tests
EUR 824
Human PDZK1- interacting protein 1, PDZK1IP1 ELISA KIT
ELI-15263h 96 Tests
EUR 824
Human Folliculin- interacting protein 1, FNIP1 ELISA KIT
ELI-09886h 96 Tests
EUR 824
Human BBSome- interacting protein 1, BBIP1 ELISA KIT
ELI-11445h 96 Tests
EUR 824
Human Max- interacting protein 1, MXI1 ELISA KIT
ELI-20014h 96 Tests
EUR 824
Human PAX- interacting protein 1, PAXIP1 ELISA KIT
ELI-22834h 96 Tests
EUR 824
Human Mid1- interacting protein 1, MID1IP1 ELISA KIT
ELI-31441h 96 Tests
EUR 824
Human EPM2A- interacting protein 1, EPM2AIP1 ELISA KIT
ELI-31634h 96 Tests
EUR 824
Human Dysferlin- interacting protein 1, DYSFIP1 ELISA KIT
ELI-26025h 96 Tests
EUR 824
Human Huntingtin- interacting protein 1, HIP1 ELISA KIT
ELI-27119h 96 Tests
EUR 824
Human Schwannomin- interacting protein 1, SCHIP1 ELISA KIT
ELI-53041h 96 Tests
EUR 824
Human RAD50- interacting protein 1, RINT1 ELISA KIT
ELI-45219h 96 Tests
EUR 824
Human TNFAIP3-interacting protein 1 (TNIP1) ELISA Kit
abx383851-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human TRAF3 interacting protein 1 (TRAF3IP1) ELISA Kit
abx383895-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human CASK Interacting Protein 1 (CASKIN1) ELISA Kit
abx384670-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
abx384768-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Max-interacting protein 1 (MXI1) ELISA Kit
abx385133-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human MID1 Interacting Protein 1 (MID1IP1) ELISA Kit
abx381447-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human PAK1 Interacting Protein 1 (PAK1IP1) ELISA Kit
abx382035-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Ras-interacting protein 1 (RASIP1) ELISA Kit
abx382701-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Schwannomin-interacting protein 1 (SCHIP1) ELISA Kit
abx383047-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Huntingtin Interacting Protein 1 (HIP1) ELISA Kit
20-abx585329
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Folliculin Interacting Protein 1 (FNIP1) ELISA Kit
abx387393-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human ProSAP- interacting protein 1, PROSAPIP1 ELISA KIT
ELI-37913h 96 Tests
EUR 824
Human TRAF3- interacting protein 1, TRAF3IP1 ELISA KIT
ELI-38967h 96 Tests
EUR 824
Human TNFAIP3- interacting protein 1, TNIP1 ELISA KIT
ELI-39992h 96 Tests
EUR 824
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Human FSIP1 shRNA Plasmid
20-abx965936
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
KTE61639-48T 48T
EUR 332
  • Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
KTE61639-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
KTE61639-96T 96T
EUR 539
  • Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Cytohesin Interacting Protein ELISA kit
E01C0575-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytohesin Interacting Protein ELISA kit
E01C0575-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytohesin Interacting Protein ELISA kit
E01C0575-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hedgehog Interacting Protein ELISA kit
E01H0058-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hedgehog Interacting Protein ELISA kit
E01H0058-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hedgehog Interacting Protein ELISA kit
E01H0058-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
FSIP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0817002 1.0 ug DNA
EUR 154
FSIP1 Polyclonal Antibody
28786-100ul 100ul
EUR 252
FSIP1 Polyclonal Antibody
28786-50ul 50ul
EUR 187
FSIP1 Blocking Peptide
33R-1906 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FSIP1 antibody, catalog no. 70R-3397
FSIP1 cloning plasmid
CSB-CL843306HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1746
  • Sequence: atggatattataaagggaaacctagatggaatttcaaaaccagcttcaaattcaagaatacgccctgggagcagaagttcaaatgcttctttggaggtgctctcaacagaaccaggatccttcaaggtcgatactgcaagcaacttgaactctggtaaagaggaccactccgaaa
  • Show more
Description: A cloning plasmid for the FSIP1 gene.
FSIP1 Polyclonal Antibody
A66766 100 µg
EUR 570.55
Description: The best epigenetics products
FSIP1 Rabbit pAb
A14971-100ul 100 ul
EUR 308
FSIP1 Rabbit pAb
A14971-200ul 200 ul
EUR 459
FSIP1 Rabbit pAb
A14971-20ul 20 ul
EUR 183
FSIP1 Rabbit pAb
A14971-50ul 50 ul
EUR 223
Anti-FSIP1 antibody
STJ117170 100 µl
EUR 277
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-48T 48T
EUR 498
  • Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-96T 96T
EUR 647
  • Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human β catenin interacting protein 1(CTNNBIP1) ELISA kit
E01B0897-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human β catenin interacting protein 1(CTNNBIP1) ELISA kit
E01B0897-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human β catenin interacting protein 1(CTNNBIP1) ELISA kit
E01B0897-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human β catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human A kinase interacting protein 1(C11orf17) ELISA kit
E01A1790-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human A kinase interacting protein 1(C11orf17) ELISA kit
E01A1790-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human A kinase interacting protein 1(C11orf17) ELISA kit
E01A1790-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E01G0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E01G0400-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E01G0400-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E01C2216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E01C2216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E01C2216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
20-abx151746
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Nuclear receptor- interacting protein 1, NRIP1 ELISA KIT
ELI-15105h 96 Tests
EUR 824
Human Torsin- 1A- interacting protein 1, TOR1AIP1 ELISA KIT
ELI-17015h 96 Tests
EUR 824
Human Beta- catenin- interacting protein 1, CTNNBIP1 ELISA KIT
ELI-10618h 96 Tests
EUR 824
Human NEDD4 family- interacting protein 1, NDFIP1 ELISA KIT
ELI-20710h 96 Tests
EUR 824
Human TEL2- interacting protein 1 homolog, TTI1 ELISA KIT
ELI-28406h 96 Tests
EUR 824
Human Smad nuclear- interacting protein 1, SNIP1 ELISA KIT
ELI-29579h 96 Tests
EUR 824
Human Glutamate receptor- interacting protein 1, GRIP1 ELISA KIT
ELI-08298h 96 Tests
EUR 824
Human Homeodomain- interacting protein kinase 1, HIPK1 ELISA KIT
ELI-08581h 96 Tests
EUR 824
Human Filamin- A- interacting protein 1, FILIP1 ELISA KIT
ELI-44006h 96 Tests
EUR 824
Human Kv channel- interacting protein 1, KCNIP1 ELISA KIT
ELI-44157h 96 Tests
EUR 824
Human Rab11 family- interacting protein 1, RAB11FIP1 ELISA KIT
ELI-44329h 96 Tests
EUR 824
Human Torsin 1A interacting protein 1 (TOR1AIP1) ELISA Kit
abx383871-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human TELO2-Interacting Protein 1 Homolog (TTI1) ELISA Kit
abx384020-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Catenin Beta Interacting Protein 1 (CTNNBIP1) ELISA Kit
abx384674-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human EPM2A (Laforin) Interacting Protein 1 (EPM2AIP1) ELISA Kit
abx384848-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Cytoplasmic FMR1 Interacting Protein 1 (CYFIP1) ELISA Kit
abx384917-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Nuclear Receptor Interacting Protein 1 (NRIP1) ELISA Kit
abx385234-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human NEDD4 family-interacting protein 1 (NDFIP1) ELISA Kit
abx381720-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human NUFIP1, FMR1 Interacting Protein 1 (NUFIP1) ELISA Kit
abx381923-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human PBX Homeobox Interacting Protein 1 (PBXIP1) ELISA Kit
abx382079-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Rab11 family-interacting protein 1 (RAB11FIP1) ELISA Kit
abx382595-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Smad nuclear-interacting protein 1 (SNIP1) ELISA Kit
abx383339-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Huntingtin Interacting Protein 1 Related (HIP1R) ELISA Kit
20-abx585330
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Deoxynucleotidyltransferase Terminal-Interacting Protein 1 (DNTTIP1) ELISA Kit
abx386960-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human v Channel Interacting Protein 1 (KCNIP1) ELISA Kit
abx388085-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human A- kinase- interacting protein 1, AKIP1 ELISA KIT
ELI-34608h 96 Tests
EUR 824
Human Cytoplasmic FMR1- interacting protein 1, CYFIP1 ELISA KIT
ELI-47397h 96 Tests
EUR 824
ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
KTE62342-48T 48T
EUR 332
  • The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini
  • Show more
Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
KTE62342-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini
  • Show more
Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
KTE62342-96T 96T
EUR 539
  • The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini
  • Show more
Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-48T 48T
EUR 332
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-96T 96T
EUR 539
  • MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
KTE60199-48T 48T
EUR 332
  • Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
KTE60199-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
KTE60199-96T 96T
EUR 539
  • Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Glutamate Receptor Interacting Protein 1(GRIP1)ELISA Kit
QY-E03336 96T
EUR 361
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
SEB753Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
SEB753Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
SEB753Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
SEB753Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
4-SEB753Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glutamate Receptor Interacting Protein 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-48Tests 48 Tests
EUR 522
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-96Tests 96 Tests
EUR 724
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-48Tests 48 Tests
EUR 500
Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-96Tests 96 Tests
EUR 692
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Human Wilms tumor protein 1-interacting protein (WTIP) ELISA Kit
abx251402-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human WTIP/ Wilms tumor protein 1-interacting protein ELISA Kit
E2698Hu 1 Kit
EUR 571
Human WTIP(Wilms tumor protein 1-interacting protein) ELISA Kit
EH2071 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: A6NIX2
  • Alias: WTIP(Wilms tumor protein 1-interacting protein)/WT1-interacting protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human Wilms tumor protein 1- interacting protein, WTIP ELISA KIT
ELI-06581h 96 Tests
EUR 824
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1 96 Well Plate
EUR 477
FSIP1 ORF Vector (Human) (pORF)
ORF004194 1.0 ug DNA
EUR 95
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
FSIP1 Protein Vector (Human) (pPB-C-His)
PV016773 500 ng
EUR 329
FSIP1 Protein Vector (Human) (pPB-N-His)
PV016774 500 ng
EUR 329
FSIP1 Protein Vector (Human) (pPM-C-HA)
PV016775 500 ng
EUR 329
FSIP1 Protein Vector (Human) (pPM-C-His)
PV016776 500 ng
EUR 329
Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-b-48T 48T
EUR 637
  • Should the Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-b-96T 96T
EUR 839
  • Should the Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-Mu-48T 48T
EUR 566
  • Should the Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-Mu-96T 96T
EUR 741
  • Should the Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.
Cow Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
20-abx150178
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-b-48Tests 48 Tests
EUR 687
Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-b-96Tests 96 Tests
EUR 960
Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-Mu-48Tests 48 Tests
EUR 603
Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-Mu-96Tests 96 Tests
EUR 840
Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-b-48Tests 48 Tests
EUR 657
Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-b-96Tests 96 Tests
EUR 917
Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-Mu-48Tests 48 Tests
EUR 577
Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-Mu-96Tests 96 Tests
EUR 802
Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
SEM974Bo-10x96wellstestplate 10x96-wells test plate
EUR 6197.58
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.
Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
SEM974Bo-1x48wellstestplate 1x48-wells test plate
EUR 598.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.
Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
SEM974Bo-1x96wellstestplate 1x96-wells test plate
EUR 811.48
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.
Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
SEM974Bo-5x96wellstestplate 5x96-wells test plate
EUR 3351.66
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.
Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
4-SEM974Bo
  • EUR 6248.00
  • EUR 3302.00
  • EUR 812.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Postacrosomal Sheath WW Domain Binding Protein elisa. Alternative names of the recognized antigen: WBP2NL
  • WBP2 N-Terminal Like
  • WW domain-binding protein 2-like
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mxi1 ELISA Kit| Rat Max-interacting protein 1 ELISA Kit
EF018943 96 Tests
EUR 689
Epm2aip1 ELISA Kit| Mouse EPM2A-interacting protein 1 ELISA Kit
EF014810 96 Tests
EUR 689
Mxi1 ELISA Kit| Mouse Max-interacting protein 1 ELISA Kit
EF015464 96 Tests
EUR 689
Rasip1 ELISA Kit| Mouse Ras-interacting protein 1 ELISA Kit
EF016054 96 Tests
EUR 689
Rat Nuclear Receptor Interacting Protein 1 ELISA kit
E02N0045-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Nuclear Receptor Interacting Protein 1 ELISA kit
E02N0045-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Nuclear Receptor Interacting Protein 1 ELISA kit
E02N0045-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit