Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit

Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit

To Order Contact us below:

Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
RDR-FSIP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
abx036889-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
20-abx103912	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
20-abx103913	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
20-abx172434	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody
20-abx301576	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Fibrous Sheath Interacting Protein 1 (FSIP1)
4-RPJ086Hu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8NA03 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 59.3kDa Isoelectric Point: 5.7
Description: Recombinant Human Fibrous Sheath Interacting Protein 1 expressed in: E.coli

Recombinant Fibrous Sheath Interacting Protein 1 (FSIP1)
4-RPJ086Ra01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q66H16 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 52.2kDa Isoelectric Point: Inquire
Description: Recombinant Rat Fibrous Sheath Interacting Protein 1 expressed in: E.coli

Human Fibrous sheath- interacting protein 1, FSIP1 ELISA KIT
ELI-07804h	Lifescience Market	96 Tests	EUR 824

Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
20-abx151592	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Fibrous Sheath Interacting Protein 1 (FSIP1)ELISA Kit
201-12-2698	SunredBio	96 tests	EUR 440
This Fibrous Sheath Interacting Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Fibrous Sheath Interacting Protein 1(FSIP1)ELISA Kit
QY-E00894	Qayee Biotechnology	96T	EUR 361

Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
SEJ086Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.

Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
SEJ086Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.

Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
SEJ086Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.

Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
SEJ086Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibrous Sheath Interacting Protein 1 (FSIP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in Tissue homogenates and other biological fluids.

Human Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
4-SEJ086Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fibrous Sheath Interacting Protein 1 elisa. Alternative names of the recognized antigen: HDS10
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fibrous Sheath Interacting Protein 1 (FSIP1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Fibrous Sheath Interacting Protein 1 (FSIP1) Protein
20-abx066630	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Fibrous sheath- interacting protein 1, Fsip1 ELISA KIT
ELI-27549m	Lifescience Market	96 Tests	EUR 865

Mouse Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
abx389299-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Fibrous Sheath Interacting Protein 1 (FSIP1) ELISA Kit
abx391338-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Fibrous Sheath Interacting Protein 1 (FSIP1) CLIA Kit
20-abx495612	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Fibrous Sheath Interacting Protein 1 (FSIP1) Protein
20-abx066631	Abbexa	EUR 732.00 EUR 286.00 EUR 2263.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

ELISA kit for Human FSIP1 (Fibrous Sheath Interacting Protein 1)
ELK3921	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fibrous Sheath Interacting Protein 1 (FSIP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s Show more
Description: A sandwich ELISA kit for detection of Fibrous Sheath Interacting Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
KTE62252-48T	Abbkine	48T	EUR 332
FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha Show more
Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
KTE62252-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha Show more
Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Fibrous sheath-interacting protein 1 (FSIP1)
KTE62252-96T	Abbkine	96T	EUR 539
FSIP1, also known as HDS10, is a recently discovered gene that encodes fibrous sheath interacting protein 1, and is regulated by amyloid beta precursor protein (APP). Recently, it has been reported that a peptide derived from APP is cleaved by alpha Show more
Description: Quantitative sandwich ELISA for measuring Human Fibrous sheath-interacting protein 1 (FSIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (HRP)
20-abx309686	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
20-abx309687	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
20-abx309688	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
20-abx271217	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (FITC)
20-abx271287	Abbexa	EUR 509.00 EUR 258.00 EUR 1525.00 EUR 704.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
20-abx271483	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fibrous Sheath Interacting Protein 1 (FSIP1) Antibody (Biotin)
20-abx271553	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fsip1 ELISA Kit\| Rat Fibrous sheath-interacting protein 1 ELISA
EF018693	Lifescience Market	96 Tests	EUR 689

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human)
4-PAJ086Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Asp55~Asp287) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1)

Fsip1 ELISA Kit\| Mouse Fibrous sheath-interacting protein 1 ELI
EF014930	Lifescience Market	96 Tests	EUR 689

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat)
4-PAJ086Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Lys109~Glu328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1)

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), APC
4-PAJ086Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Asp55~Asp287) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), Biotinylated
4-PAJ086Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Asp55~Asp287) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Biotin.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), Cy3
4-PAJ086Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Asp55~Asp287) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Cy3.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), FITC
4-PAJ086Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Asp55~Asp287) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with FITC.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), HRP
4-PAJ086Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Asp55~Asp287) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with HRP.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), PE
4-PAJ086Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Asp55~Asp287) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with PE.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), APC
4-PAJ086Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Lys109~Glu328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), Biotinylated
4-PAJ086Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Lys109~Glu328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Biotin.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), Cy3
4-PAJ086Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Lys109~Glu328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with Cy3.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), FITC
4-PAJ086Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Lys109~Glu328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with FITC.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), HRP
4-PAJ086Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Lys109~Glu328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with HRP.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), PE
4-PAJ086Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Lys109~Glu328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with PE.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Human), APC-Cy7
4-PAJ086Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Asp55~Asp287) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC-Cy7.

Fibrous Sheath Interacting Protein 1 (FSIP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAJ086Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FSIP1 (Lys109~Glu328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibrous Sheath Interacting Protein 1 (FSIP1). This antibody is labeled with APC-Cy7.

Human Fibrous sheath- interacting protein 2, FSIP2 ELISA KIT
ELI-44048h	Lifescience Market	96 Tests	EUR 824

Fibrous Sheath-Interacting Protein 2 (FSIP2) Antibody
20-abx302515	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Fibrous sheath- interacting protein 2, Fsip2 ELISA KIT
ELI-13144m	Lifescience Market	96 Tests	EUR 865

Human Fibrous sheath CABYR- binding protein, FSCB ELISA KIT
ELI-44081h	Lifescience Market	96 Tests	EUR 824

Human Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
abx384910-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Fibrous sheath CABYR- binding protein, Fscb ELISA KIT
ELI-13142m	Lifescience Market	96 Tests	EUR 865

Bovine Fibrous sheath CABYR- binding protein, FSCB ELISA KIT
ELI-32480b	Lifescience Market	96 Tests	EUR 928

Mouse Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
abx389298-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Fibrous Sheath CABYR Binding Protein (FSCB) ELISA Kit
abx391337-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Fscb ELISA Kit\| Rat Fibrous sheath CABYR-binding protein ELISA
EF018692	Lifescience Market	96 Tests	EUR 689

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
abx036854-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
abx029847-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
abx029847-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody
20-abx318381	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fscb ELISA Kit\| Mouse Fibrous sheath CABYR-binding protein ELIS
EF014929	Lifescience Market	96 Tests	EUR 689

FSCB ELISA Kit\| Bovine Fibrous sheath CABYR-binding protein ELI
EF011387	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (HRP)
20-abx307471	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (FITC)
20-abx307472	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (Biotin)
20-abx307473	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fsip1/ Rat Fsip1 ELISA Kit
ELI-13143r	Lifescience Market	96 Tests	EUR 886

FSIP1 ELISA KIT\|Human
EF004989	Lifescience Market	96 Tests	EUR 689

Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit
EN2550-1	AssayPro	96 Well Plate	EUR 477

FSIP1 ELISA Kit (Human) (OKCD01045)
OKCD01045	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL

FSIP1 Recombinant Protein (Human)
RP012580	ABM	100 ug	Ask for price

FSIP1 siRNA
20-abx902018	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FSIP1 siRNA
20-abx917260	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FSIP1 siRNA
20-abx917261	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FSIP1 antibody
70R-3397	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FSIP1 antibody raised against the middle region of FSIP1

FSIP1 Antibody
1-CSB-PA843306LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FSIP1. Recognizes FSIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

FSIP1 Recombinant Protein (Rat)
RP201812	ABM	100 ug	Ask for price

FSIP1 Recombinant Protein (Mouse)
RP135323	ABM	100 ug	Ask for price

ARFIP1341 a.a.Human ADP-Ribosylation Factor Interacting Protein 1 341 a.a Human Recombinant Protein
PROTP53367-1	BosterBio	Regular: 10ug	EUR 317
Description: ARFIP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 364 amino acids (1-341 a.a) and having a molecular mass of 41.0kDa.;ARFIP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Postacrosomal sheath WW domain-binding protein (WBP2NL) ELISA Kit
abx384276-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-Hu-48T	DL Develop	48T	EUR 554
Should the Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.

Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-Hu-96T	DL Develop	96T	EUR 725
Should the Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.

Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Huntingtin Interacting Protein 1 (HIP1) ELISA Kit
20-abx585329	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
E01P0840-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
E01P0840-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDZK1 interacting protein 1(PDZK1IP1) ELISA kit
E01P0840-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human PDZK1 interacting protein 1(PDZK1IP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Folliculin- interacting protein 1, FNIP1 ELISA KIT
ELI-09886h	Lifescience Market	96 Tests	EUR 824

Human BBSome- interacting protein 1, BBIP1 ELISA KIT
ELI-11445h	Lifescience Market	96 Tests	EUR 824

Human Max- interacting protein 1, MXI1 ELISA KIT
ELI-20014h	Lifescience Market	96 Tests	EUR 824

Human PAX- interacting protein 1, PAXIP1 ELISA KIT
ELI-22834h	Lifescience Market	96 Tests	EUR 824

Human Dysferlin- interacting protein 1, DYSFIP1 ELISA KIT
ELI-26025h	Lifescience Market	96 Tests	EUR 824

Human Ras- interacting protein 1, RASIP1 ELISA KIT
ELI-14831h	Lifescience Market	96 Tests	EUR 824

Human PRKR- interacting protein 1, PRKRIP1 ELISA KIT
ELI-15223h	Lifescience Market	96 Tests	EUR 824

Human PDZK1- interacting protein 1, PDZK1IP1 ELISA KIT
ELI-15263h	Lifescience Market	96 Tests	EUR 824

Human Huntingtin- interacting protein 1, HIP1 ELISA KIT
ELI-27119h	Lifescience Market	96 Tests	EUR 824

Human Schwannomin- interacting protein 1, SCHIP1 ELISA KIT
ELI-53041h	Lifescience Market	96 Tests	EUR 824

Human RAD50- interacting protein 1, RINT1 ELISA KIT
ELI-45219h	Lifescience Market	96 Tests	EUR 824

Human Mid1- interacting protein 1, MID1IP1 ELISA KIT
ELI-31441h	Lifescience Market	96 Tests	EUR 824

Human EPM2A- interacting protein 1, EPM2AIP1 ELISA KIT
ELI-31634h	Lifescience Market	96 Tests	EUR 824

Human TRAF3- interacting protein 1, TRAF3IP1 ELISA KIT
ELI-38967h	Lifescience Market	96 Tests	EUR 824

Human TNFAIP3- interacting protein 1, TNIP1 ELISA KIT
ELI-39992h	Lifescience Market	96 Tests	EUR 824

Human ProSAP- interacting protein 1, PROSAPIP1 ELISA KIT
ELI-37913h	Lifescience Market	96 Tests	EUR 824

Human PAX-Interacting Protein 1 (PAXIP1) ELISA Kit
abx259801-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human MID1 Interacting Protein 1 (MID1IP1) ELISA Kit
abx381447-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human PAK1 Interacting Protein 1 (PAK1IP1) ELISA Kit
abx382035-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ras-interacting protein 1 (RASIP1) ELISA Kit
abx382701-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Schwannomin-interacting protein 1 (SCHIP1) ELISA Kit
abx383047-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human TNFAIP3-interacting protein 1 (TNIP1) ELISA Kit
abx383851-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human TRAF3 interacting protein 1 (TRAF3IP1) ELISA Kit
abx383895-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human CASK Interacting Protein 1 (CASKIN1) ELISA Kit
abx384670-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
abx384768-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Max-interacting protein 1 (MXI1) ELISA Kit
abx385133-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Folliculin Interacting Protein 1 (FNIP1) ELISA Kit
abx387393-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human TNFAIP3-interacting protein 1(TNIP1) ELISA kit
CSB-EL023999HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human TNFAIP3-interacting protein 1(TNIP1) ELISA kit
1-CSB-EL023999HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human TNFAIP3-interacting protein 1(TNIP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human FSIP1 shRNA Plasmid
20-abx965936	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
KTE61639-48T	Abbkine	48T	EUR 332
Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l Show more
Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
KTE61639-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l Show more
Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1)
KTE61639-96T	Abbkine	96T	EUR 539
Identified in a human 8p amplicon, MFHAS1 is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a l Show more
Description: Quantitative sandwich ELISA for measuring Human Malignant fibrous histiocytoma-amplified sequence 1 (MFHAS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

FSIP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0817002	ABM	1.0 ug DNA	EUR 154

Human Cytohesin Interacting Protein ELISA kit
E01C0575-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytohesin Interacting Protein ELISA kit
E01C0575-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytohesin Interacting Protein ELISA kit
E01C0575-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytohesin Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hedgehog Interacting Protein ELISA kit
E01H0058-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hedgehog Interacting Protein ELISA kit
E01H0058-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hedgehog Interacting Protein ELISA kit
E01H0058-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hedgehog Interacting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FSIP1 Rabbit pAb
A14971-100ul	Abclonal	100 ul	EUR 308

FSIP1 Rabbit pAb
A14971-200ul	Abclonal	200 ul	EUR 459

FSIP1 Rabbit pAb
A14971-20ul	Abclonal	20 ul	EUR 183

FSIP1 Rabbit pAb
A14971-50ul	Abclonal	50 ul	EUR 223

FSIP1 Polyclonal Antibody
A66766	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

FSIP1 Blocking Peptide
33R-1906	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FSIP1 antibody, catalog no. 70R-3397

FSIP1 Polyclonal Antibody
28786-100ul	SAB	100ul	EUR 252

FSIP1 Polyclonal Antibody
28786-50ul	SAB	50ul	EUR 187

FSIP1 cloning plasmid
CSB-CL843306HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1746 Sequence: atggatattataaagggaaacctagatggaatttcaaaaccagcttcaaattcaagaatacgccctgggagcagaagttcaaatgcttctttggaggtgctctcaacagaaccaggatccttcaaggtcgatactgcaagcaacttgaactctggtaaagaggaccactccgaaa Show more
Description: A cloning plasmid for the FSIP1 gene.

Anti-FSIP1 antibody
STJ117170	St John's Laboratory	100 µl	EUR 277

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human Huntingtin Interacting Protein 1 Related (HIP1R) ELISA Kit
20-abx585330	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E01C2216-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E01C2216-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E01C2216-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A kinase interacting protein 1(C11orf17) ELISA kit
E01A1790-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A kinase interacting protein 1(C11orf17) ELISA kit
E01A1790-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A kinase interacting protein 1(C11orf17) ELISA kit
E01A1790-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A kinase interacting protein 1(C11orf17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Î² catenin interacting protein 1(CTNNBIP1) ELISA kit
E01B0897-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Î² catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Î² catenin interacting protein 1(CTNNBIP1) ELISA kit
E01B0897-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Î² catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Î² catenin interacting protein 1(CTNNBIP1) ELISA kit
E01B0897-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Î² catenin interacting protein 1(CTNNBIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E01G0400-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E01G0400-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E01G0400-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta- catenin- interacting protein 1, CTNNBIP1 ELISA KIT
ELI-10618h	Lifescience Market	96 Tests	EUR 824

Human NEDD4 family- interacting protein 1, NDFIP1 ELISA KIT
ELI-20710h	Lifescience Market	96 Tests	EUR 824

Human Nuclear receptor- interacting protein 1, NRIP1 ELISA KIT
ELI-15105h	Lifescience Market	96 Tests	EUR 824

Human Torsin- 1A- interacting protein 1, TOR1AIP1 ELISA KIT
ELI-17015h	Lifescience Market	96 Tests	EUR 824

Human Glutamate receptor- interacting protein 1, GRIP1 ELISA KIT
ELI-08298h	Lifescience Market	96 Tests	EUR 824

Human Homeodomain- interacting protein kinase 1, HIPK1 ELISA KIT
ELI-08581h	Lifescience Market	96 Tests	EUR 824

Human A- kinase- interacting protein 1, AKIP1 ELISA KIT
ELI-34608h	Lifescience Market	96 Tests	EUR 824

Human Filamin- A- interacting protein 1, FILIP1 ELISA KIT
ELI-44006h	Lifescience Market	96 Tests	EUR 824

Human Kv channel- interacting protein 1, KCNIP1 ELISA KIT
ELI-44157h	Lifescience Market	96 Tests	EUR 824

Human Rab11 family- interacting protein 1, RAB11FIP1 ELISA KIT
ELI-44329h	Lifescience Market	96 Tests	EUR 824

Human Cytoplasmic FMR1- interacting protein 1, CYFIP1 ELISA KIT
ELI-47397h	Lifescience Market	96 Tests	EUR 824

Human TEL2- interacting protein 1 homolog, TTI1 ELISA KIT
ELI-28406h	Lifescience Market	96 Tests	EUR 824

Human Smad nuclear- interacting protein 1, SNIP1 ELISA KIT
ELI-29579h	Lifescience Market	96 Tests	EUR 824

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
20-abx151746	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human NEDD4 family-interacting protein 1 (NDFIP1) ELISA Kit
abx381720-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human NUFIP1, FMR1 Interacting Protein 1 (NUFIP1) ELISA Kit
abx381923-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human PBX Homeobox Interacting Protein 1 (PBXIP1) ELISA Kit
abx382079-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Rab11 family-interacting protein 1 (RAB11FIP1) ELISA Kit
abx382595-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Smad nuclear-interacting protein 1 (SNIP1) ELISA Kit
abx383339-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Torsin 1A interacting protein 1 (TOR1AIP1) ELISA Kit
abx383871-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human TELO2-Interacting Protein 1 Homolog (TTI1) ELISA Kit
abx384020-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Catenin Beta Interacting Protein 1 (CTNNBIP1) ELISA Kit
abx384674-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human EPM2A (Laforin) Interacting Protein 1 (EPM2AIP1) ELISA Kit
abx384848-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Cytoplasmic FMR1 Interacting Protein 1 (CYFIP1) ELISA Kit
abx384917-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Nuclear Receptor Interacting Protein 1 (NRIP1) ELISA Kit
abx385234-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Deoxynucleotidyltransferase Terminal-Interacting Protein 1 (DNTTIP1) ELISA Kit
abx386960-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human v Channel Interacting Protein 1 (KCNIP1) ELISA Kit
abx388085-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.

ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
KTE62342-48T	Abbkine	48T	EUR 332
The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini Show more
Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
KTE62342-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini Show more
Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human PRKR-interacting protein 1 (PRKRIP1)
KTE62342-96T	Abbkine	96T	EUR 539
The C114 cDNA contains an open reading frame of 187 amino acids with a predicted mass of 21 kDa. Using green fluorescent protein (GFP)-C114 fusion plasmids, amino acids 126-131 are shown to be essential for the nuclear localization of C114. An argini Show more
Description: Quantitative sandwich ELISA for measuring Human PRKR-interacting protein 1 (PRKRIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-48T	Abbkine	48T	EUR 332
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mid1-interacting protein 1 (MID1IP1)
KTE61622-96T	Abbkine	96T	EUR 539
MID1IP1 (MID1 Interacting Protein 1) is a Protein Coding gene. Among its related pathways are Metabolism and Import of palmitoyl-CoA into the mitochondrial matrix. GO annotations related to this gene include protein C-terminus binding. An important p Show more
Description: Quantitative sandwich ELISA for measuring Human Mid1-interacting protein 1 (MID1IP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
KTE60199-48T	Abbkine	48T	EUR 332
Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
KTE60199-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TNFAIP3-interacting protein 1 (TNIP1)
KTE60199-96T	Abbkine	96T	EUR 539
Using a yeast 2-hybrid screen to identify proteins that interact with the human immunodeficiency virus (HIV)-1 Nef protein, Fukushi et al. (1999) isolated TNIP1, which they designated NAF1, from an activated leukocyte cDNA library. They obtained full Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 1 (TNIP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
SEB753Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
SEB753Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
SEB753Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
SEB753Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Receptor Interacting Protein 1 (GRIP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
4-SEB753Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glutamate Receptor Interacting Protein 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Glutamate Receptor Interacting Protein 1(GRIP1)ELISA Kit
QY-E03336	Qayee Biotechnology	96T	EUR 361

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Human WTIP/ Wilms tumor protein 1-interacting protein ELISA Kit
E2698Hu	Sunlong	1 Kit	EUR 571

Human WTIP(Wilms tumor protein 1-interacting protein) ELISA Kit
EH2071	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: A6NIX2 Alias: WTIP(Wilms tumor protein 1-interacting protein)/WT1-interacting protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Wilms tumor protein 1- interacting protein, WTIP ELISA KIT
ELI-06581h	Lifescience Market	96 Tests	EUR 824

Human Wilms tumor protein 1-interacting protein (WTIP) ELISA Kit
abx251402-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

FSIP1 ORF Vector (Human) (pORF)
ORF004194	ABM	1.0 ug DNA	EUR 95

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

FSIP1 Protein Vector (Human) (pPB-C-His)
PV016773	ABM	500 ng	EUR 329

FSIP1 Protein Vector (Human) (pPB-N-His)
PV016774	ABM	500 ng	EUR 329

FSIP1 Protein Vector (Human) (pPM-C-HA)
PV016775	ABM	500 ng	EUR 329

FSIP1 Protein Vector (Human) (pPM-C-His)
PV016776	ABM	500 ng	EUR 329

Cow Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
20-abx150178	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-b-48T	DL Develop	48T	EUR 637
Should the Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.

Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-b-96T	DL Develop	96T	EUR 839
Should the Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.

Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.

Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
DLR-PAWP-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from tissue homogenates or other biological fluids.

Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-b-48Tests	Reddot Biotech	48 Tests	EUR 657

Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-b-96Tests	Reddot Biotech	96 Tests	EUR 917

Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RD-PAWP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-b-48Tests	Reddot Biotech	48 Tests	EUR 687

Bovine Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-b-96Tests	Reddot Biotech	96 Tests	EUR 960

Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
RDR-PAWP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
SEM974Bo-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 6197.58
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.

Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
SEM974Bo-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 598.04
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.

Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
SEM974Bo-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 811.48
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.

Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
SEM974Bo-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3351.66
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in Tissue homogenates and other biological fluids.

Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) ELISA Kit
4-SEM974Bo	Cloud-Clone	EUR 6248.00 EUR 3302.00 EUR 812.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Postacrosomal Sheath WW Domain Binding Protein elisa. Alternative names of the recognized antigen: WBP2NL WBP2 N-Terminal Like WW domain-binding protein 2-like
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Cattle Postacrosomal Sheath WW Domain Binding Protein (PAWP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Monkey Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
abx360092-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
abx361849-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Cytohesin 1 Interacting Protein (CYTIP) ELISA Kit
abx363225-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Nuclear Receptor Interacting Protein 1 ELISA kit
E02N0045-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Nuclear Receptor Interacting Protein 1 ELISA kit
E02N0045-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FSIP1(Fibrous Sheath Interacting Protein 1) ELISA Kit