Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit

Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit

To Order Contact us below: 

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
RD-TGOLN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Trans-Golgi Network Protein 2 (TGOLN2) Antibody
20-abx116194	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Trans Golgi Network Protein 2 (TGOLN2) Antibody
20-abx124522	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Trans Golgi Network Protein 2 (TGOLN2) Antibody
20-abx131635	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Trans Golgi Network Protein 2 (TGOLN2) Antibody
20-abx174855	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Trans Golgi Network Protein 2 (TGOLN2) Antibody
abx034174-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Trans Golgi Network Protein 2 (TGOLN2) Antibody
abx034174-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Recombinant Trans Golgi NeTwork Protein 2 (TGOLN2)
4-RPH035Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O43493 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Trans Golgi NeTwork Protein 2 expressed in: E.coli

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
20-abx153277	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
abx257683-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Trans Golgi Network Protein 2(TGOLN2)ELISA Kit
QY-E03673	Qayee Biotechnology	96T	EUR 400

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
SEH035Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
SEH035Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
SEH035Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
SEH035Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
4-SEH035Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Trans Golgi Network Protein 2 elisa. Alternative names of the recognized antigen: TGN51 TGN46 TGN48 TGN38 TTGN2 Trans-Golgi Network Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Trans Golgi Network Protein 2 (TGOLN2) Protein
20-abx650705	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Trans Golgi Network Protein 2 (TGOLN2) CLIA Kit
20-abx495361	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human TGOLN2 (Trans Golgi Network Protein 2)
ELK3891	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Trans Golgi Network Protein 2 (TGOLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi Show more
Description: A sandwich ELISA kit for detection of Trans Golgi Network Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human)
4-PAH035Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGOLN2 (Ala22~Glu323) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2)

Human TGOLN2 (Trans-Golgi network integral membrane protein 2) ELISA Kit
EH4979	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O43493
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC
4-PAH035Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGOLN2 (Ala22~Glu323) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Biotinylated
4-PAH035Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGOLN2 (Ala22~Glu323) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Biotin.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Cy3
4-PAH035Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGOLN2 (Ala22~Glu323) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Cy3.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), FITC
4-PAH035Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGOLN2 (Ala22~Glu323) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with FITC.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), HRP
4-PAH035Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGOLN2 (Ala22~Glu323) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with HRP.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), PE
4-PAH035Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGOLN2 (Ala22~Glu323) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with PE.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC-Cy7
4-PAH035Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGOLN2 (Ala22~Glu323) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC-Cy7.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx238653-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx411988-01ml	Abbexa	0.1 ml	EUR 704
Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx412473-01ml	Abbexa	0.1 ml	EUR 704
Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx412474-25ug	Abbexa	25 ug	EUR 1121
Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx412475-10ug	Abbexa	10 ug	EUR 606
Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
abx411994-01ml	Abbexa	0.1 ml	EUR 704
Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
abx412471-01ml	Abbexa	0.1 ml	EUR 801
Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
abx412472-25ug	Abbexa	25 ug	EUR 801
Shipped within 1 week.

TGOLN2 ELISA KIT|Human
EF000179	Lifescience Market	96 Tests	EUR 689

Human TGOLN2 ELISA KIT
ELI-29291h	Lifescience Market	96 Tests	EUR 824

TGOLN2 ELISA Kit (Human) (OKCD01017)
OKCD01017	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May be involved in regulating membrane traffic to and from trans-Golgi network. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

Mouse Tgoln2 ELISA KIT
ELI-29292m	Lifescience Market	96 Tests	EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TGOLN2 Recombinant Protein (Human)
RP031417	ABM	100 ug	Ask for price

TGOLN2 Recombinant Protein (Human)
RP031420	ABM	100 ug	Ask for price

Human Golgi Protein 73 ELISA kit
E01G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Golgi Protein 73 ELISA kit
E01G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Golgi Protein 73 ELISA kit
E01G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Golgi Reassembly Stacking Protein 2 (GORASP2) ELISA Kit
abx387624-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Golgi reassembly- stacking protein 2, GORASP2 ELISA KIT
ELI-39015h	Lifescience Market	96 Tests	EUR 824

TGOLN2 antibody
70R-21719	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TGOLN2 antibody

TGOLN2 antibody
70R-7394	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TGOLN2 antibody raised against the N terminal of TGOLN2

TGOLN2 Antibody
1-CSB-PA023468GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TGOLN2. Recognizes TGOLN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TGOLN2 siRNA
20-abx936650	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGOLN2 siRNA
20-abx936651	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human ERGIC And Golgi 2 (ERGIC2) ELISA Kit
abx387183-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TGOLN2 Recombinant Protein (Mouse)
RP178508	ABM	100 ug	Ask for price

Human Golgi Protein 73 (GP73) ELISA Kit
DLR-GP73-Hu-48T	DL Develop	48T	EUR 498
Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit
DLR-GP73-Hu-96T	DL Develop	96T	EUR 647
Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit
abx052512-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Golgi Protein 73 (GP73) ELISA Kit
20-abx151704	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Golgi Protein 73 (GP73) ELISA Kit
abx252562-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Golgi Protein 73 ELISA Kit (GP73)
RK01490	Abclonal	96 Tests	EUR 521

Human Golgi Protein 73 (GP73) ELISA Kit
SEB668Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit
SEB668Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit
SEB668Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit
SEB668Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit
4-SEB668Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1 GOLPH2 C9orf155 Golgi Membrane Protein 1 Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Golgi Protein 73 (GP73) ELISA Kit
RDR-GP73-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Golgi Protein 73 (GP73) ELISA Kit
RDR-GP73-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Golgi Protein 73 (GP73) ELISA Kit
RD-GP73-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Golgi Protein 73 (GP73) ELISA Kit
RD-GP73-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

trans-2-Hexenal
GK7230-25G	Glentham Life Sciences	25 g	EUR 54

TGOLN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2366803	ABM	1.0 ug DNA	EUR 154

Human TGOLN2 shRNA Plasmid
20-abx957231	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Golgi reassembly- stacking protein 2, Gorasp2 ELISA KIT
ELI-27852m	Lifescience Market	96 Tests	EUR 865

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Rat Golgi Protein 73 ELISA kit
E02G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Golgi Protein 73 ELISA kit
E02G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Golgi Protein 73 ELISA kit
E02G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Golgi Protein 73 ELISA kit
E03G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Golgi Protein 73 ELISA kit
E03G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Golgi Protein 73 ELISA kit
E03G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Golgi Protein 73 ELISA kit
E04G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Golgi Protein 73 ELISA kit
E04G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Golgi Protein 73 ELISA kit
E04G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Golgi Protein 73 ELISA kit
E06G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Golgi Protein 73 ELISA kit
E06G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Golgi Protein 73 ELISA kit
E06G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Golgi Protein 73 ELISA kit
E09G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Golgi Protein 73 ELISA kit
E09G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Golgi Protein 73 ELISA kit
E09G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Golgi Protein 73 ELISA kit
E08G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Golgi Protein 73 ELISA kit
E08G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Golgi Protein 73 ELISA kit
E08G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Golgi Protein 73 ELISA kit
E07G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Golgi Protein 73 ELISA kit
E07G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Golgi Protein 73 ELISA kit
E07G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human golgi protein 73,GP-73 ELISA Kit
201-12-1433	SunredBio	96 tests	EUR 440
This golgi protein 73 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Golgi Membrane Protein 1 (GOLM1) ELISA Kit
abx251193-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human GP-73(Golgi Protein 73) ELISA Kit
EH3162	FN Test	96T	EUR 524.1
Detection range: 0.625-40 ng/ml Alias: GP-73
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

ELISA kit for Human Golgi apparatus protein 1
EK3366	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi apparatus protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Golgi membrane protein 1
EK3857	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi membrane protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GLG1/ Golgi apparatus protein 1 ELISA Kit
E1014Hu	Sunlong	1 Kit	EUR 605

Human GOLM1/ Golgi membrane protein 1 ELISA Kit
E1032Hu	Sunlong	1 Kit	EUR 571

Human Golgi resident protein GCP60, ACBD3 ELISA KIT
ELI-12528h	Lifescience Market	96 Tests	EUR 824

Human Golgi membrane protein 1, GOLM1 ELISA KIT
ELI-05457h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human GP73 (Golgi Protein 73)
ELK2140	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Golgi Protein 73 (GP73). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Golgi Prot Show more
Description: A sandwich ELISA kit for detection of Golgi Protein 73 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human golgi protein 73, GP-73 ELISA Kit
CSB-E11332h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human golgi protein 73, GP-73 ELISA Kit
1-CSB-E11332h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Golgi Apparatus Protein 1 (GLG1) ELISA Kit
abx555387-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Human golgi protein 73(GP-73)ELISA Kit
GA-E1449HM-48T	GenAsia Biotech	48T	EUR 289

Human golgi protein 73(GP-73)ELISA Kit
GA-E1449HM-96T	GenAsia Biotech	96T	EUR 466

Human Golgi apparatus protein 1, GLG1 ELISA KIT
ELI-39078h	Lifescience Market	96 Tests	EUR 824

Human golgi protein 73(GP-73)ELISA Kit
QY-E03381	Qayee Biotechnology	96T	EUR 361

TGOLN2 Polyclonal Antibody
29941-100ul	SAB	100ul	EUR 252

TGOLN2 Polyclonal Antibody
29941-50ul	SAB	50ul	EUR 187

TGOLN2 Blocking Peptide
33R-7348	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGOLN2 antibody, catalog no. 70R-7394

TGOLN2 cloning plasmid
CSB-CL023468HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1344 Sequence: atgcggttcgtggttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagaagctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg Show more
Description: A cloning plasmid for the TGOLN2 gene.

TGOLN2 cloning plasmid
CSB-CL023468HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1314 Sequence: atgcggttcgtagttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagatgctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg Show more
Description: A cloning plasmid for the TGOLN2 gene.

TGOLN2 Rabbit pAb
A8914-100ul	Abclonal	100 ul	EUR 308

TGOLN2 Rabbit pAb
A8914-200ul	Abclonal	200 ul	EUR 459

TGOLN2 Rabbit pAb
A8914-20ul	Abclonal	20 ul	Ask for price

TGOLN2 Rabbit pAb
A8914-50ul	Abclonal	50 ul	Ask for price

TGOLN2 Rabbit pAb
A16707-100ul	Abclonal	100 ul	EUR 308

TGOLN2 Rabbit pAb
A16707-200ul	Abclonal	200 ul	EUR 459

TGOLN2 Rabbit pAb
A16707-20ul	Abclonal	20 ul	EUR 183

TGOLN2 Rabbit pAb
A16707-50ul	Abclonal	50 ul	EUR 223

Anti-TGOLN2 antibody
STJ111478	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a type I integral membrane protein that is localized to the trans-Golgi network, a major sorting station for secretory and membrane proteins. The encoded protein cycles between early endosomes and the trans-Golgi network, and may play a role in exocytic vesicle formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-TGOLN2 antibody
STJ119129	St John's Laboratory	100 µl	EUR 277

Mouse ERGIC And Golgi 2 (ERGIC2) ELISA Kit
abx389190-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Potassium Trans-2-Methylcyclohexyltrifluoroborate
abx188856-100g	Abbexa	100 g	EUR 1386
Shipped within 1-2 weeks.

Trans-2-aminocyclohexanol hydrochloride
20-abx184451	Abbexa	EUR 217.00 EUR 746.00 EUR 342.00	1 g 25 g 5 g
Shipped within 1-2 weeks.

Trans-2-Phenylcyclopropylamine hydrochloride
M55000	EpiGentek	250 mg	EUR 196.45
Description: The best epigenetics products

TGOLN2 ORF Vector (Human) (pORF)
ORF010473	ABM	1.0 ug DNA	EUR 95

TGOLN2 ORF Vector (Human) (pORF)
ORF010474	ABM	1.0 ug DNA	EUR 95

Human Peroxisomal trans- 2- enoyl- CoA reductase, PECR ELISA KIT
ELI-22081h	Lifescience Market	96 Tests	EUR 824

Human Peroxisomal trans-2-enoyl-CoA reductase (PECR) ELISA Kit
abx382149-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
E01C1881-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
E01C1881-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
E01C1881-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Golgi SNAP Receptor Complex Member 2 (GOSR2) ELISA Kit
abx259601-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Golgi SNAP receptor complex member 2, GOSR2 ELISA KIT
ELI-27259h	Lifescience Market	96 Tests	EUR 824

Human Component Of Oligomeric Golgi Complex 2 (COG2) ELISA Kit
abx384724-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TGOLN2 Protein Vector (Human) (pPB-C-His)
PV041889	ABM	500 ng	EUR 329

TGOLN2 Protein Vector (Human) (pPB-N-His)
PV041890	ABM	500 ng	EUR 329

TGOLN2 Protein Vector (Human) (pPM-C-HA)
PV041891	ABM	500 ng	EUR 329

TGOLN2 Protein Vector (Human) (pPM-C-His)
PV041892	ABM	500 ng	EUR 329

TGOLN2 Protein Vector (Human) (pPB-C-His)
PV041893	ABM	500 ng	EUR 329

TGOLN2 Protein Vector (Human) (pPB-N-His)
PV041894	ABM	500 ng	EUR 329

TGOLN2 Protein Vector (Human) (pPM-C-HA)
PV041895	ABM	500 ng	EUR 329

TGOLN2 Protein Vector (Human) (pPM-C-His)
PV041896	ABM	500 ng	EUR 329

Mouse Golgi Protein 73 (GP73) ELISA Kit
DLR-GP73-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit
DLR-GP73-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Guinea pig Golgi Protein 73 ELISA kit
E05G0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Golgi Protein 73 ELISA kit
E05G0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Golgi Protein 73 ELISA kit
E05G0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Golgi Protein 73 (GP73) ELISA Kit
20-abx154099	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Golgi Protein 73 (GP73) ELISA Kit
20-abx258885	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Monkey Golgi Protein 73 (GP73) ELISA Kit
abx359502-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Golgi Protein 73 (GP73) ELISA Kit
abx361254-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Golgi Protein 73 (GP73) ELISA Kit
abx356107-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Golgi Protein 73 (GP73) ELISA Kit
abx363412-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Golgi Protein 73 (GP73) ELISA Kit
SEB668Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit
SEB668Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit
SEB668Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit
SEB668Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit
4-SEB668Mu	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1 GOLPH2 C9orf155 Golgi Membrane Protein 1 Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Golgi Protein 73 (GP73) ELISA Kit
SEB668Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4875.49
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Rat Golgi Protein 73 (GP73) ELISA Kit
SEB668Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 489.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Rat Golgi Protein 73 (GP73) ELISA Kit
SEB668Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 655.94
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Rat Golgi Protein 73 (GP73) ELISA Kit
SEB668Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2651.73
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Rat Golgi Protein 73 (GP73) ELISA Kit
4-SEB668Ra	Cloud-Clone	EUR 4926.00 EUR 2602.00 EUR 656.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1 GOLPH2 C9orf155 Golgi Membrane Protein 1 Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Golgi Protein 73 (GP73) ELISA Kit
RDR-GP73-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Golgi Protein 73 (GP73) ELISA Kit
RDR-GP73-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Mouse Golgi Protein 73 ELISA Kit (GP73)
RK02859	Abclonal	96 Tests	EUR 521

Rat Golgi Protein 73 ELISA Kit (GP73)
RK03694	Abclonal	96 Tests	EUR 521

Mouse Golgi Protein 73 (GP73) ELISA Kit
RD-GP73-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Golgi Protein 73 (GP73) ELISA Kit
RD-GP73-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

trans-trans Muconic acid
B7915-100	ApexBio	100 mg	EUR 108

trans-trans Muconic acid
B7915-500	ApexBio	500 mg	EUR 166

trans-trans-Muconic acid
HY-113247	MedChemExpress	100mg	EUR 108

Tgoln2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3377103	ABM	1.0 ug DNA	EUR 154

Human Golgi Glycoprotein 1 (GLG1)ELISA Kit
201-12-2724	SunredBio	96 tests	EUR 440
This Golgi Glycoprotein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Golgi Phosphoprotein 3 (GOLPH3)ELISA Kit
201-12-2725	SunredBio	96 tests	EUR 440
This Golgi Phosphoprotein 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human Golgi phosphoprotein 3
EK3275	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi phosphoprotein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GOLPH3/ Golgi phosphoprotein 3 ELISA Kit
E1033Hu	Sunlong	1 Kit	EUR 605

Human Golgi phosphoprotein 3, GOLPH3 ELISA KIT
ELI-09745h	Lifescience Market	96 Tests	EUR 824

Human Golgi phosphoprotein 3 (GOLPH3) ELISA Kit
abx556004-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Golgi Glycoprotein 1(GLG1)ELISA Kit
QY-E03379	Qayee Biotechnology	96T	EUR 361

Human Golgi Phosphoprotein 3(GOLPH3)ELISA Kit
QY-E03380	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human GP-73 (Golgi Protein 73)
E-EL-H1313	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GP-73 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GP-73. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GP-73 (Golgi Protein 73) in samples from Serum, Plasma, Cell supernatant

Human Golgi Reassembly Stacking Protein 1 (GORASP1) ELISA Kit
abx259607-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human GORASP1(Golgi reassembly-stacking protein 1) ELISA Kit
EH8929	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q9BQQ3 Alias: Golgi peripheral membrane protein p65/Golgi phosphoprotein 5/GOLPH5/Golgi reassembly-stacking protein of 65 kDa/GRASP65
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Golgi integral membrane protein 4, GOLIM4 ELISA KIT
ELI-27934h	Lifescience Market	96 Tests	EUR 824

Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit