Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit

Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit

To Order Contact us below: 

    Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
    RD-TGOLN2-Hu-96Tests 96 Tests
    EUR 723
    Trans Golgi Network Protein 2 (TGOLN2) Antibody
    20-abx124522
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.
    Trans-Golgi Network Protein 2 (TGOLN2) Antibody
    20-abx116194
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Trans Golgi Network Protein 2 (TGOLN2) Antibody
    20-abx131635
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Trans Golgi Network Protein 2 (TGOLN2) Antibody
    abx034174-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Trans Golgi Network Protein 2 (TGOLN2) Antibody
    abx034174-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Trans Golgi Network Protein 2 (TGOLN2) Antibody
    20-abx174855
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Recombinant Trans Golgi NeTwork Protein 2 (TGOLN2)
    4-RPH035Hu01
    • EUR 413.60
    • EUR 214.00
    • EUR 1276.00
    • EUR 492.00
    • EUR 884.00
    • EUR 340.00
    • EUR 3040.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: O43493
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 34.7kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Trans Golgi NeTwork Protein 2 expressed in: E.coli
    Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
    20-abx153277
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
    abx257683-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.
    Human Trans Golgi Network Protein 2(TGOLN2)ELISA Kit
    QY-E03673 96T
    EUR 400
    Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
    SEH035Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assa
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.
    Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
    SEH035Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assa
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.
    Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
    SEH035Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assa
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.
    Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
    SEH035Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assa
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.
    Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
    4-SEH035Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Trans Golgi Network Protein 2 elisa. Alternative names of the recognized antigen: TGN51
    • TGN46
    • TGN48
    • TGN38
    • TTGN2
    • Trans-Golgi Network Protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Trans Golgi Network Protein 2 (TGOLN2) Protein
    20-abx650705
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Trans Golgi Network Protein 2 (TGOLN2) CLIA Kit
    20-abx495361
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human TGOLN2 (Trans Golgi Network Protein 2)
    ELK3891 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Trans Golgi Network Protein 2 (TGOLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
    • Show more
    Description: A sandwich ELISA kit for detection of Trans Golgi Network Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human)
    4-PAH035Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2)
    Human TGOLN2 (Trans-Golgi network integral membrane protein 2) ELISA Kit
    EH4979 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: O43493
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC
    4-PAH035Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC.
    Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Biotinylated
    4-PAH035Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Biotin.
    Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Cy3
    4-PAH035Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Cy3.
    Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), FITC
    4-PAH035Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with FITC.
    Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), HRP
    4-PAH035Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with HRP.
    Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), PE
    4-PAH035Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with PE.
    Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC-Cy7
    4-PAH035Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC-Cy7.
    Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
    abx411988-01ml 0.1 ml
    EUR 704
    • Shipped within 1 week.
    Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
    abx412473-01ml 0.1 ml
    EUR 704
    • Shipped within 1 week.
    Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
    abx412474-25ug 25 ug
    EUR 1121
    • Shipped within 1 week.
    Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
    abx412475-10ug 10 ug
    EUR 606
    • Shipped within 1 week.
    Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
    abx238653-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.
    Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
    abx411994-01ml 0.1 ml
    EUR 704
    • Shipped within 1 week.
    Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
    abx412471-01ml 0.1 ml
    EUR 801
    • Shipped within 1 week.
    Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
    abx412472-25ug 25 ug
    EUR 801
    • Shipped within 1 week.
    TGOLN2 ELISA KIT|Human
    EF000179 96 Tests
    EUR 689
    Human TGOLN2 ELISA KIT
    ELI-29291h 96 Tests
    EUR 824
    TGOLN2 ELISA Kit (Human) (OKCD01017)
    OKCD01017 96 Wells
    EUR 831
    Description: Description of target: May be involved in regulating membrane traffic to and from trans-Golgi network. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL
    Mouse Tgoln2 ELISA KIT
    ELI-29292m 96 Tests
    EUR 865
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    TGOLN2 Recombinant Protein (Human)
    RP031417 100 ug Ask for price
    TGOLN2 Recombinant Protein (Human)
    RP031420 100 ug Ask for price
    Human Golgi Protein 73 ELISA kit
    E01G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Golgi Protein 73 ELISA kit
    E01G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Golgi Protein 73 ELISA kit
    E01G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Golgi reassembly- stacking protein 2, GORASP2 ELISA KIT
    ELI-39015h 96 Tests
    EUR 824
    Human Golgi Reassembly Stacking Protein 2 (GORASP2) ELISA Kit
    abx387624-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    TGOLN2 siRNA
    20-abx936650
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    TGOLN2 siRNA
    20-abx936651
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    TGOLN2 antibody
    70R-21719 50 ul
    EUR 435
    Description: Rabbit polyclonal TGOLN2 antibody
    TGOLN2 antibody
    70R-7394 50 ug
    EUR 467
    Description: Rabbit polyclonal TGOLN2 antibody raised against the N terminal of TGOLN2
    TGOLN2 Antibody
    1-CSB-PA023468GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against TGOLN2. Recognizes TGOLN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    Human ERGIC And Golgi 2 (ERGIC2) ELISA Kit
    abx387183-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    TGOLN2 Recombinant Protein (Mouse)
    RP178508 100 ug Ask for price
    Human Golgi Protein 73 (GP73) ELISA Kit
    20-abx151704
    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Golgi Protein 73 (GP73) ELISA Kit
    abx052512-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human Golgi Protein 73 (GP73) ELISA Kit
    abx252562-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human Golgi Protein 73 (GP73) ELISA Kit
    DLR-GP73-Hu-48T 48T
    EUR 498
    • Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Golgi Protein 73 (GP73) ELISA Kit
    DLR-GP73-Hu-96T 96T
    EUR 647
    • Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Golgi Protein 73 (GP73) ELISA Kit
    SEB668Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4502.43
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
    Human Golgi Protein 73 (GP73) ELISA Kit
    SEB668Hu-1x48wellstestplate 1x48-wells test plate
    EUR 458.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
    Human Golgi Protein 73 (GP73) ELISA Kit
    SEB668Hu-1x96wellstestplate 1x96-wells test plate
    EUR 612.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
    Human Golgi Protein 73 (GP73) ELISA Kit
    SEB668Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2454.23
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
    Human Golgi Protein 73 (GP73) ELISA Kit
    4-SEB668Hu
    • EUR 4553.00
    • EUR 2405.00
    • EUR 613.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
    • GOLPH2
    • C9orf155
    • Golgi Membrane Protein 1
    • Golgi Phosphoprotein 2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Golgi Protein 73 ELISA Kit (GP73)
    RK01490 96 Tests
    EUR 521
    Human Golgi Protein 73 (GP73) ELISA Kit
    RD-GP73-Hu-48Tests 48 Tests
    EUR 500
    Human Golgi Protein 73 (GP73) ELISA Kit
    RD-GP73-Hu-96Tests 96 Tests
    EUR 692
    Human Golgi Protein 73 (GP73) ELISA Kit
    RDR-GP73-Hu-48Tests 48 Tests
    EUR 522
    Human Golgi Protein 73 (GP73) ELISA Kit
    RDR-GP73-Hu-96Tests 96 Tests
    EUR 724
    trans-2-Hexenal
    GK7230-25G 25 g
    EUR 54
    TGOLN2 sgRNA CRISPR Lentivector (Human) (Target 2)
    K2366803 1.0 ug DNA
    EUR 154
    Human TGOLN2 shRNA Plasmid
    20-abx957231
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse Golgi reassembly- stacking protein 2, Gorasp2 ELISA KIT
    ELI-27852m 96 Tests
    EUR 865
    AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
    Goat Golgi Protein 73 ELISA kit
    E06G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Golgi Protein 73 ELISA kit
    E06G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Golgi Protein 73 ELISA kit
    E06G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Golgi Protein 73 ELISA kit
    E02G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Golgi Protein 73 ELISA kit
    E02G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Golgi Protein 73 ELISA kit
    E02G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Golgi Protein 73 ELISA kit
    E03G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Golgi Protein 73 ELISA kit
    E03G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Golgi Protein 73 ELISA kit
    E03G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Golgi Protein 73 ELISA kit
    E04G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Golgi Protein 73 ELISA kit
    E04G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Golgi Protein 73 ELISA kit
    E04G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Golgi Protein 73 ELISA kit
    E08G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Golgi Protein 73 ELISA kit
    E08G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Golgi Protein 73 ELISA kit
    E08G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Golgi Protein 73 ELISA kit
    E07G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Golgi Protein 73 ELISA kit
    E07G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Golgi Protein 73 ELISA kit
    E07G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Golgi Protein 73 ELISA kit
    E09G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Golgi Protein 73 ELISA kit
    E09G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Golgi Protein 73 ELISA kit
    E09G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    TGOLN2 cloning plasmid
    CSB-CL023468HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1344
    • Sequence: atgcggttcgtggttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagaagctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg
    • Show more
    Description: A cloning plasmid for the TGOLN2 gene.
    TGOLN2 cloning plasmid
    CSB-CL023468HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1314
    • Sequence: atgcggttcgtagttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagatgctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg
    • Show more
    Description: A cloning plasmid for the TGOLN2 gene.
    TGOLN2 Rabbit pAb
    A16707-100ul 100 ul
    EUR 308
    TGOLN2 Rabbit pAb
    A16707-200ul 200 ul
    EUR 459
    TGOLN2 Rabbit pAb
    A16707-20ul 20 ul
    EUR 183
    TGOLN2 Rabbit pAb
    A16707-50ul 50 ul
    EUR 223
    TGOLN2 Rabbit pAb
    A8914-100ul 100 ul
    EUR 308
    TGOLN2 Rabbit pAb
    A8914-200ul 200 ul
    EUR 459
    TGOLN2 Rabbit pAb
    A8914-20ul 20 ul Ask for price
    TGOLN2 Rabbit pAb
    A8914-50ul 50 ul Ask for price
    TGOLN2 Blocking Peptide
    33R-7348 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGOLN2 antibody, catalog no. 70R-7394
    TGOLN2 Polyclonal Antibody
    29941-100ul 100ul
    EUR 252
    TGOLN2 Polyclonal Antibody
    29941-50ul 50ul
    EUR 187
    Anti-TGOLN2 antibody
    STJ111478 100 µl
    EUR 277
    Description: This gene encodes a type I integral membrane protein that is localized to the trans-Golgi network, a major sorting station for secretory and membrane proteins. The encoded protein cycles between early endosomes and the trans-Golgi network, and may play a role in exocytic vesicle formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
    Anti-TGOLN2 antibody
    STJ119129 100 µl
    EUR 277
    Human Golgi Apparatus Protein 1 (GLG1) ELISA Kit
    abx555387-96tests 96 tests
    EUR 739
    • Shipped within 1-3 weeks.
    ELISA kit for Human Golgi apparatus protein 1
    EK3366 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi apparatus protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    ELISA kit for Human Golgi membrane protein 1
    EK3857 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi membrane protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    Human GLG1/ Golgi apparatus protein 1 ELISA Kit
    E1014Hu 1 Kit
    EUR 605
    Human GOLM1/ Golgi membrane protein 1 ELISA Kit
    E1032Hu 1 Kit
    EUR 571
    Human GP-73(Golgi Protein 73) ELISA Kit
    EH3162 96T
    EUR 524.1
    • Detection range: 0.625-40 ng/ml
    • Alias: GP-73
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
    Human Golgi resident protein GCP60, ACBD3 ELISA KIT
    ELI-12528h 96 Tests
    EUR 824
    Human Golgi membrane protein 1, GOLM1 ELISA KIT
    ELI-05457h 96 Tests
    EUR 824
    ELISA kit for Human GP73 (Golgi Protein 73)
    ELK2140 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Golgi Protein 73 (GP73). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Golgi Prot
    • Show more
    Description: A sandwich ELISA kit for detection of Golgi Protein 73 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Human golgi protein 73(GP-73)ELISA Kit
    GA-E1449HM-48T 48T
    EUR 289
    Human golgi protein 73(GP-73)ELISA Kit
    GA-E1449HM-96T 96T
    EUR 466
    Human Golgi apparatus protein 1, GLG1 ELISA KIT
    ELI-39078h 96 Tests
    EUR 824
    Human Golgi Membrane Protein 1 (GOLM1) ELISA Kit
    abx251193-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human golgi protein 73,GP-73 ELISA Kit
    201-12-1433 96 tests
    EUR 440
    • This golgi protein 73 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human golgi protein 73, GP-73 ELISA Kit
    CSB-E11332h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human golgi protein 73, GP-73 ELISA Kit
    1-CSB-E11332h
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human golgi protein 73(GP-73)ELISA Kit
    QY-E03381 96T
    EUR 361
    Mouse ERGIC And Golgi 2 (ERGIC2) ELISA Kit
    abx389190-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Trans-2-aminocyclohexanol hydrochloride
    20-abx184451
    • EUR 217.00
    • EUR 746.00
    • EUR 342.00
    • 1 g
    • 25 g
    • 5 g
    • Shipped within 1-2 weeks.
    Potassium Trans-2-Methylcyclohexyltrifluoroborate
    abx188856-100g 100 g
    EUR 1386
    • Shipped within 1-2 weeks.
    Trans-2-Phenylcyclopropylamine hydrochloride
    M55000 250 mg
    EUR 196.45
    Description: The best epigenetics products
    TGOLN2 ORF Vector (Human) (pORF)
    ORF010473 1.0 ug DNA
    EUR 95
    TGOLN2 ORF Vector (Human) (pORF)
    ORF010474 1.0 ug DNA
    EUR 95
    Human Peroxisomal trans- 2- enoyl- CoA reductase, PECR ELISA KIT
    ELI-22081h 96 Tests
    EUR 824
    Human Peroxisomal trans-2-enoyl-CoA reductase (PECR) ELISA Kit
    abx382149-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    TGOLN2 Protein Vector (Human) (pPB-C-His)
    PV041889 500 ng
    EUR 329
    TGOLN2 Protein Vector (Human) (pPB-N-His)
    PV041890 500 ng
    EUR 329
    TGOLN2 Protein Vector (Human) (pPM-C-HA)
    PV041891 500 ng
    EUR 329
    TGOLN2 Protein Vector (Human) (pPM-C-His)
    PV041892 500 ng
    EUR 329
    TGOLN2 Protein Vector (Human) (pPB-C-His)
    PV041893 500 ng
    EUR 329
    TGOLN2 Protein Vector (Human) (pPB-N-His)
    PV041894 500 ng
    EUR 329
    TGOLN2 Protein Vector (Human) (pPM-C-HA)
    PV041895 500 ng
    EUR 329
    TGOLN2 Protein Vector (Human) (pPM-C-His)
    PV041896 500 ng
    EUR 329
    Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
    E01C1881-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
    E01C1881-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
    E01C1881-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Golgi SNAP receptor complex member 2, GOSR2 ELISA KIT
    ELI-27259h 96 Tests
    EUR 824
    Human Golgi SNAP Receptor Complex Member 2 (GOSR2) ELISA Kit
    abx259601-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Component Of Oligomeric Golgi Complex 2 (COG2) ELISA Kit
    abx384724-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Pig Golgi Protein 73 (GP73) ELISA Kit
    abx361254-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Rabbit Golgi Protein 73 (GP73) ELISA Kit
    abx363412-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Guinea pig Golgi Protein 73 ELISA kit
    E05G0001-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Golgi Protein 73 ELISA kit
    E05G0001-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Golgi Protein 73 ELISA kit
    E05G0001-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    20-abx154099
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Rat Golgi Protein 73 (GP73) ELISA Kit
    20-abx258885
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Chicken Golgi Protein 73 (GP73) ELISA Kit
    abx356107-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Monkey Golgi Protein 73 (GP73) ELISA Kit
    abx359502-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    DLR-GP73-Mu-48T 48T
    EUR 508
    • Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    DLR-GP73-Mu-96T 96T
    EUR 661
    • Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    SEB668Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4626.78
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    SEB668Mu-1x48wellstestplate 1x48-wells test plate
    EUR 468.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    SEB668Mu-1x96wellstestplate 1x96-wells test plate
    EUR 626.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    SEB668Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2520.06
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    4-SEB668Mu
    • EUR 4677.00
    • EUR 2471.00
    • EUR 627.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
    • GOLPH2
    • C9orf155
    • Golgi Membrane Protein 1
    • Golgi Phosphoprotein 2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Rat Golgi Protein 73 (GP73) ELISA Kit
    SEB668Ra-10x96wellstestplate 10x96-wells test plate
    EUR 4875.49
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
    Rat Golgi Protein 73 (GP73) ELISA Kit
    SEB668Ra-1x48wellstestplate 1x48-wells test plate
    EUR 489.16
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
    Rat Golgi Protein 73 (GP73) ELISA Kit
    SEB668Ra-1x96wellstestplate 1x96-wells test plate
    EUR 655.94
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
    Rat Golgi Protein 73 (GP73) ELISA Kit
    SEB668Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2651.73
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
    Rat Golgi Protein 73 (GP73) ELISA Kit
    4-SEB668Ra
    • EUR 4926.00
    • EUR 2602.00
    • EUR 656.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
    • GOLPH2
    • C9orf155
    • Golgi Membrane Protein 1
    • Golgi Phosphoprotein 2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Mouse Golgi Protein 73 ELISA Kit (GP73)
    RK02859 96 Tests
    EUR 521
    Rat Golgi Protein 73 ELISA Kit (GP73)
    RK03694 96 Tests
    EUR 521
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    RD-GP73-Mu-48Tests 48 Tests
    EUR 511
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    RD-GP73-Mu-96Tests 96 Tests
    EUR 709
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    RDR-GP73-Mu-48Tests 48 Tests
    EUR 534
    Mouse Golgi Protein 73 (GP73) ELISA Kit
    RDR-GP73-Mu-96Tests 96 Tests
    EUR 742
    trans-trans Muconic acid
    B7915-100 100 mg
    EUR 108
    trans-trans Muconic acid
    B7915-500 500 mg
    EUR 166
    trans-trans-Muconic acid
    HY-113247 100mg
    EUR 108
    Tgoln2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3377103 1.0 ug DNA
    EUR 154
    Human Golgi phosphoprotein 3 (GOLPH3) ELISA Kit
    abx556004-96tests 96 tests
    EUR 668
    • Shipped within 1-3 weeks.
    ELISA kit for Human Golgi phosphoprotein 3
    EK3275 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi phosphoprotein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.
    Human GOLPH3/ Golgi phosphoprotein 3 ELISA Kit
    E1033Hu 1 Kit
    EUR 605
    Human Golgi phosphoprotein 3, GOLPH3 ELISA KIT
    ELI-09745h 96 Tests
    EUR 824
    Human Golgi Glycoprotein 1 (GLG1)ELISA Kit
    201-12-2724 96 tests
    EUR 440
    • This Golgi Glycoprotein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Golgi Phosphoprotein 3 (GOLPH3)ELISA Kit
    201-12-2725 96 tests
    EUR 440
    • This Golgi Phosphoprotein 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Golgi Glycoprotein 1(GLG1)ELISA Kit
    QY-E03379 96T
    EUR 361
    Human Golgi Phosphoprotein 3(GOLPH3)ELISA Kit
    QY-E03380 96T
    EUR 361
    Human GORASP1(Golgi reassembly-stacking protein 1) ELISA Kit
    EH8929 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q9BQQ3
    • Alias: Golgi peripheral membrane protein p65/Golgi phosphoprotein 5/GOLPH5/Golgi reassembly-stacking protein of 65 kDa/GRASP65
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
    Human Golgi reassembly- stacking protein 1, GORASP1 ELISA KIT
    ELI-27463h 96 Tests
    EUR 824
    Human Golgi integral membrane protein 4, GOLIM4 ELISA KIT
    ELI-27934h 96 Tests
    EUR 824
    Human Golgi Reassembly Stacking Protein 1 (GORASP1) ELISA Kit
    abx259607-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit