Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit

Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit

To Order Contact us below: 

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
RD-TGOLN2-Hu-96Tests 96 Tests
EUR 723
Trans-Golgi Network Protein 2 (TGOLN2) Antibody
20-abx116194
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Trans Golgi Network Protein 2 (TGOLN2) Antibody
20-abx124522
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Trans Golgi Network Protein 2 (TGOLN2) Antibody
20-abx131635
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Trans Golgi Network Protein 2 (TGOLN2) Antibody
20-abx174855
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Trans Golgi Network Protein 2 (TGOLN2) Antibody
abx034174-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Trans Golgi Network Protein 2 (TGOLN2) Antibody
abx034174-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Recombinant Trans Golgi NeTwork Protein 2 (TGOLN2)
4-RPH035Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43493
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Trans Golgi NeTwork Protein 2 expressed in: E.coli
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
20-abx153277
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
abx257683-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.
Human Trans Golgi Network Protein 2(TGOLN2)ELISA Kit
QY-E03673 96T
EUR 400
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
SEH035Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
SEH035Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
SEH035Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
SEH035Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.
Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit
4-SEH035Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Trans Golgi Network Protein 2 elisa. Alternative names of the recognized antigen: TGN51
  • TGN46
  • TGN48
  • TGN38
  • TTGN2
  • Trans-Golgi Network Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Trans Golgi Network Protein 2 (TGOLN2) Protein
20-abx650705
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Trans Golgi Network Protein 2 (TGOLN2) CLIA Kit
20-abx495361
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human TGOLN2 (Trans Golgi Network Protein 2)
ELK3891 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Trans Golgi Network Protein 2 (TGOLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Trans Golgi Network Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human)
4-PAH035Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2)
Human TGOLN2 (Trans-Golgi network integral membrane protein 2) ELISA Kit
EH4979 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O43493
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC
4-PAH035Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC.
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Biotinylated
4-PAH035Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Biotin.
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Cy3
4-PAH035Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Cy3.
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), FITC
4-PAH035Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with FITC.
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), HRP
4-PAH035Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with HRP.
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), PE
4-PAH035Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with PE.
Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC-Cy7
4-PAH035Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC-Cy7.
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx238653-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx411988-01ml 0.1 ml
EUR 704
  • Shipped within 1 week.
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx412473-01ml 0.1 ml
EUR 704
  • Shipped within 1 week.
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx412474-25ug 25 ug
EUR 1121
  • Shipped within 1 week.
Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody
abx412475-10ug 10 ug
EUR 606
  • Shipped within 1 week.
Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
abx411994-01ml 0.1 ml
EUR 704
  • Shipped within 1 week.
Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
abx412471-01ml 0.1 ml
EUR 801
  • Shipped within 1 week.
Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody
abx412472-25ug 25 ug
EUR 801
  • Shipped within 1 week.
TGOLN2 ELISA KIT|Human
EF000179 96 Tests
EUR 689
Human TGOLN2 ELISA KIT
ELI-29291h 96 Tests
EUR 824
Mouse Tgoln2 ELISA KIT
ELI-29292m 96 Tests
EUR 865
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
TGOLN2 Recombinant Protein (Human)
RP031417 100 ug Ask for price
TGOLN2 Recombinant Protein (Human)
RP031420 100 ug Ask for price
Human Golgi Protein 73 ELISA kit
E01G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Golgi Protein 73 ELISA kit
E01G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Golgi Protein 73 ELISA kit
E01G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Golgi Reassembly Stacking Protein 2 (GORASP2) ELISA Kit
abx387624-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Golgi reassembly- stacking protein 2, GORASP2 ELISA KIT
ELI-39015h 96 Tests
EUR 824
TGOLN2 antibody
70R-21719 50 ul
EUR 435
Description: Rabbit polyclonal TGOLN2 antibody
TGOLN2 antibody
70R-7394 50 ug
EUR 467
Description: Rabbit polyclonal TGOLN2 antibody raised against the N terminal of TGOLN2
TGOLN2 Antibody
1-CSB-PA023468GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TGOLN2. Recognizes TGOLN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
TGOLN2 siRNA
20-abx936650
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGOLN2 siRNA
20-abx936651
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human ERGIC And Golgi 2 (ERGIC2) ELISA Kit
abx387183-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Golgi Protein 73 (GP73) ELISA Kit
DLR-GP73-Hu-48T 48T
EUR 498
  • Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Golgi Protein 73 (GP73) ELISA Kit
DLR-GP73-Hu-96T 96T
EUR 647
  • Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Golgi Protein 73 (GP73) ELISA Kit
abx052512-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Golgi Protein 73 (GP73) ELISA Kit
20-abx151704
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Golgi Protein 73 (GP73) ELISA Kit
abx252562-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Golgi Protein 73 ELISA Kit (GP73)
RK01490 96 Tests
EUR 521
Human Golgi Protein 73 (GP73) ELISA Kit
SEB668Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
Human Golgi Protein 73 (GP73) ELISA Kit
SEB668Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
Human Golgi Protein 73 (GP73) ELISA Kit
SEB668Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
Human Golgi Protein 73 (GP73) ELISA Kit
SEB668Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
Human Golgi Protein 73 (GP73) ELISA Kit
4-SEB668Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
  • GOLPH2
  • C9orf155
  • Golgi Membrane Protein 1
  • Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Golgi Protein 73 (GP73) ELISA Kit
RDR-GP73-Hu-48Tests 48 Tests
EUR 522
Human Golgi Protein 73 (GP73) ELISA Kit
RDR-GP73-Hu-96Tests 96 Tests
EUR 724
Human Golgi Protein 73 (GP73) ELISA Kit
RD-GP73-Hu-48Tests 48 Tests
EUR 500
Human Golgi Protein 73 (GP73) ELISA Kit
RD-GP73-Hu-96Tests 96 Tests
EUR 692
TGOLN2 Recombinant Protein (Mouse)
RP178508 100 ug Ask for price
trans-2-Hexenal
GK7230-25G 25 g
EUR 54
TGOLN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2366803 1.0 ug DNA
EUR 154
Human TGOLN2 shRNA Plasmid
20-abx957231
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Golgi reassembly- stacking protein 2, Gorasp2 ELISA KIT
ELI-27852m 96 Tests
EUR 865
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Rat Golgi Protein 73 ELISA kit
E02G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Golgi Protein 73 ELISA kit
E02G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Golgi Protein 73 ELISA kit
E02G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Golgi Protein 73 ELISA kit
E03G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Golgi Protein 73 ELISA kit
E03G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Golgi Protein 73 ELISA kit
E03G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Golgi Protein 73 ELISA kit
E04G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Golgi Protein 73 ELISA kit
E04G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Golgi Protein 73 ELISA kit
E04G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Golgi Protein 73 ELISA kit
E06G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Golgi Protein 73 ELISA kit
E06G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Golgi Protein 73 ELISA kit
E06G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Golgi Protein 73 ELISA kit
E09G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Golgi Protein 73 ELISA kit
E09G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Golgi Protein 73 ELISA kit
E09G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Golgi Protein 73 ELISA kit
E08G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Golgi Protein 73 ELISA kit
E08G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Golgi Protein 73 ELISA kit
E08G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Golgi Protein 73 ELISA kit
E07G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Golgi Protein 73 ELISA kit
E07G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Golgi Protein 73 ELISA kit
E07G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human golgi protein 73,GP-73 ELISA Kit
201-12-1433 96 tests
EUR 440
  • This golgi protein 73 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Golgi Membrane Protein 1 (GOLM1) ELISA Kit
abx251193-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human GP-73(Golgi Protein 73) ELISA Kit
EH3162 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Alias: GP-73
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
ELISA kit for Human Golgi apparatus protein 1
EK3366 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi apparatus protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Golgi membrane protein 1
EK3857 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi membrane protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human GLG1/ Golgi apparatus protein 1 ELISA Kit
E1014Hu 1 Kit
EUR 605
Human GOLM1/ Golgi membrane protein 1 ELISA Kit
E1032Hu 1 Kit
EUR 571
Human Golgi resident protein GCP60, ACBD3 ELISA KIT
ELI-12528h 96 Tests
EUR 824
Human Golgi membrane protein 1, GOLM1 ELISA KIT
ELI-05457h 96 Tests
EUR 824
ELISA kit for Human GP73 (Golgi Protein 73)
ELK2140 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Golgi Protein 73 (GP73). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Golgi Prot
  • Show more
Description: A sandwich ELISA kit for detection of Golgi Protein 73 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human golgi protein 73, GP-73 ELISA Kit
CSB-E11332h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human golgi protein 73, GP-73 ELISA Kit
1-CSB-E11332h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Golgi Apparatus Protein 1 (GLG1) ELISA Kit
abx555387-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.
Human golgi protein 73(GP-73)ELISA Kit
GA-E1449HM-48T 48T
EUR 289
Human golgi protein 73(GP-73)ELISA Kit
GA-E1449HM-96T 96T
EUR 466
Human Golgi apparatus protein 1, GLG1 ELISA KIT
ELI-39078h 96 Tests
EUR 824
Human golgi protein 73(GP-73)ELISA Kit
QY-E03381 96T
EUR 361
TGOLN2 Polyclonal Antibody
29941-100ul 100ul
EUR 252
TGOLN2 Polyclonal Antibody
29941-50ul 50ul
EUR 187
TGOLN2 Blocking Peptide
33R-7348 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGOLN2 antibody, catalog no. 70R-7394
TGOLN2 cloning plasmid
CSB-CL023468HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgcggttcgtggttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagaagctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg
  • Show more
Description: A cloning plasmid for the TGOLN2 gene.
TGOLN2 cloning plasmid
CSB-CL023468HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1314
  • Sequence: atgcggttcgtagttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagatgctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg
  • Show more
Description: A cloning plasmid for the TGOLN2 gene.
TGOLN2 Rabbit pAb
A8914-100ul 100 ul
EUR 308
TGOLN2 Rabbit pAb
A8914-200ul 200 ul
EUR 459
TGOLN2 Rabbit pAb
A8914-20ul 20 ul Ask for price
TGOLN2 Rabbit pAb
A8914-50ul 50 ul Ask for price
TGOLN2 Rabbit pAb
A16707-100ul 100 ul
EUR 308
TGOLN2 Rabbit pAb
A16707-200ul 200 ul
EUR 459
TGOLN2 Rabbit pAb
A16707-20ul 20 ul
EUR 183
TGOLN2 Rabbit pAb
A16707-50ul 50 ul
EUR 223
Anti-TGOLN2 antibody
STJ111478 100 µl
EUR 277
Description: This gene encodes a type I integral membrane protein that is localized to the trans-Golgi network, a major sorting station for secretory and membrane proteins. The encoded protein cycles between early endosomes and the trans-Golgi network, and may play a role in exocytic vesicle formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Anti-TGOLN2 antibody
STJ119129 100 µl
EUR 277
Mouse ERGIC And Golgi 2 (ERGIC2) ELISA Kit
abx389190-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
TGOLN2 ORF Vector (Human) (pORF)
ORF010473 1.0 ug DNA
EUR 95
TGOLN2 ORF Vector (Human) (pORF)
ORF010474 1.0 ug DNA
EUR 95
Human Peroxisomal trans- 2- enoyl- CoA reductase, PECR ELISA KIT
ELI-22081h 96 Tests
EUR 824
Human Peroxisomal trans-2-enoyl-CoA reductase (PECR) ELISA Kit
abx382149-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Potassium Trans-2-Methylcyclohexyltrifluoroborate
abx188856-100g 100 g
EUR 1386
  • Shipped within 1-2 weeks.
Trans-2-aminocyclohexanol hydrochloride
20-abx184451
  • EUR 217.00
  • EUR 746.00
  • EUR 342.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Trans-2-Phenylcyclopropylamine hydrochloride
M55000 250 mg
EUR 196.45
Description: The best epigenetics products
Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
E01C1881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
E01C1881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit
E01C1881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Golgi SNAP Receptor Complex Member 2 (GOSR2) ELISA Kit
abx259601-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Golgi SNAP receptor complex member 2, GOSR2 ELISA KIT
ELI-27259h 96 Tests
EUR 824
Human Component Of Oligomeric Golgi Complex 2 (COG2) ELISA Kit
abx384724-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
TGOLN2 Protein Vector (Human) (pPB-C-His)
PV041889 500 ng
EUR 329
TGOLN2 Protein Vector (Human) (pPB-N-His)
PV041890 500 ng
EUR 329
TGOLN2 Protein Vector (Human) (pPM-C-HA)
PV041891 500 ng
EUR 329
TGOLN2 Protein Vector (Human) (pPM-C-His)
PV041892 500 ng
EUR 329
TGOLN2 Protein Vector (Human) (pPB-C-His)
PV041893 500 ng
EUR 329
TGOLN2 Protein Vector (Human) (pPB-N-His)
PV041894 500 ng
EUR 329
TGOLN2 Protein Vector (Human) (pPM-C-HA)
PV041895 500 ng
EUR 329
TGOLN2 Protein Vector (Human) (pPM-C-His)
PV041896 500 ng
EUR 329
Mouse Golgi Protein 73 (GP73) ELISA Kit
DLR-GP73-Mu-48T 48T
EUR 508
  • Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Golgi Protein 73 (GP73) ELISA Kit
DLR-GP73-Mu-96T 96T
EUR 661
  • Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Guinea pig Golgi Protein 73 ELISA kit
E05G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Golgi Protein 73 ELISA kit
E05G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Golgi Protein 73 ELISA kit
E05G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Golgi Protein 73 (GP73) ELISA Kit
20-abx154099
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Golgi Protein 73 (GP73) ELISA Kit
20-abx258885
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Monkey Golgi Protein 73 (GP73) ELISA Kit
abx359502-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Golgi Protein 73 (GP73) ELISA Kit
abx361254-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Golgi Protein 73 (GP73) ELISA Kit
abx356107-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Golgi Protein 73 (GP73) ELISA Kit
abx363412-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Golgi Protein 73 (GP73) ELISA Kit
SEB668Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Golgi Protein 73 (GP73) ELISA Kit
SEB668Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Golgi Protein 73 (GP73) ELISA Kit
SEB668Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Golgi Protein 73 (GP73) ELISA Kit
SEB668Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Golgi Protein 73 (GP73) ELISA Kit
4-SEB668Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
  • GOLPH2
  • C9orf155
  • Golgi Membrane Protein 1
  • Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Golgi Protein 73 (GP73) ELISA Kit
SEB668Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
Rat Golgi Protein 73 (GP73) ELISA Kit
SEB668Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
Rat Golgi Protein 73 (GP73) ELISA Kit
SEB668Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
Rat Golgi Protein 73 (GP73) ELISA Kit
SEB668Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.
Rat Golgi Protein 73 (GP73) ELISA Kit
4-SEB668Ra
  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
  • GOLPH2
  • C9orf155
  • Golgi Membrane Protein 1
  • Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Golgi Protein 73 (GP73) ELISA Kit
RDR-GP73-Mu-48Tests 48 Tests
EUR 534
Mouse Golgi Protein 73 (GP73) ELISA Kit
RDR-GP73-Mu-96Tests 96 Tests
EUR 742
Mouse Golgi Protein 73 ELISA Kit (GP73)
RK02859 96 Tests
EUR 521
Rat Golgi Protein 73 ELISA Kit (GP73)
RK03694 96 Tests
EUR 521
Mouse Golgi Protein 73 (GP73) ELISA Kit
RD-GP73-Mu-48Tests 48 Tests
EUR 511
Mouse Golgi Protein 73 (GP73) ELISA Kit
RD-GP73-Mu-96Tests 96 Tests
EUR 709
trans-trans Muconic acid
B7915-100 100 mg
EUR 108
trans-trans Muconic acid
B7915-500 500 mg
EUR 166
trans-trans-Muconic acid
HY-113247 100mg
EUR 108
Human Golgi Glycoprotein 1 (GLG1)ELISA Kit
201-12-2724 96 tests
EUR 440
  • This Golgi Glycoprotein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Golgi Phosphoprotein 3 (GOLPH3)ELISA Kit
201-12-2725 96 tests
EUR 440
  • This Golgi Phosphoprotein 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
ELISA kit for Human Golgi phosphoprotein 3
EK3275 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi phosphoprotein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human GOLPH3/ Golgi phosphoprotein 3 ELISA Kit
E1033Hu 1 Kit
EUR 605
Human Golgi phosphoprotein 3, GOLPH3 ELISA KIT
ELI-09745h 96 Tests
EUR 824
Human Golgi phosphoprotein 3 (GOLPH3) ELISA Kit
abx556004-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Human Golgi Glycoprotein 1(GLG1)ELISA Kit
QY-E03379 96T
EUR 361
Human Golgi Phosphoprotein 3(GOLPH3)ELISA Kit
QY-E03380 96T
EUR 361
Tgoln2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3377103 1.0 ug DNA
EUR 154
ELISA kit for Human GP-73 (Golgi Protein 73)
E-EL-H1313 1 plate of 96 wells
EUR 534
  • Gentaur's GP-73 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GP-73. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GP-73 (Golgi Protein 73) in samples from Serum, Plasma, Cell supernatant
Human Golgi Reassembly Stacking Protein 1 (GORASP1) ELISA Kit
abx259607-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human GORASP1(Golgi reassembly-stacking protein 1) ELISA Kit
EH8929 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9BQQ3
  • Alias: Golgi peripheral membrane protein p65/Golgi phosphoprotein 5/GOLPH5/Golgi reassembly-stacking protein of 65 kDa/GRASP65
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Golgi integral membrane protein 4, GOLIM4 ELISA KIT
ELI-27934h 96 Tests
EUR 824
Human Golgi reassembly- stacking protein 1, GORASP1 ELISA KIT
ELI-27463h 96 Tests
EUR 824

Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit