Human RNASEL(Ribonuclease L) ELISA Kit

Human RNASEL(Ribonuclease L) ELISA Kit

To Order Contact us below: 

    Human Ribonuclease L (RNASEL) ELISA Kit
    RD-RNASEL-Hu-96Tests 96 Tests
    EUR 723

    Human Ribonuclease L (RNASEL) ELISA Kit
    RDR-RNASEL-Hu-48Tests 48 Tests
    EUR 544

    Human Ribonuclease L (RNASEL) ELISA Kit
    RDR-RNASEL-Hu-96Tests 96 Tests
    EUR 756

    Human Ribonuclease L (RNASEL) ELISA Kit
    20-abx152969
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ribonuclease L ELISA Kit (RNASEL)
    RK02204 96 Tests
    EUR 521

    Human Ribonuclease L(RNASEL)ELISA Kit
    QY-E03164 96T
    EUR 394

    Human Ribonuclease L (RNASEL) ELISA Kit
    SED164Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease L (RNASEL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease L (RNASEL) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ribonuclease L (RNASEL) ELISA Kit
    SED164Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease L (RNASEL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease L (RNASEL) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ribonuclease L (RNASEL) ELISA Kit
    SED164Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease L (RNASEL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease L (RNASEL) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ribonuclease L (RNASEL) ELISA Kit
    SED164Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease L (RNASEL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease L (RNASEL) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ribonuclease L (RNASEL) ELISA Kit
    4-SED164Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ribonuclease L elisa. Alternative names of the recognized antigen: Rnase-L
    • RNS4
    • PRCA1
    • 2', 5'-Oligoisoadenylate Synthetase-Dependent
    • Prostate Cancer 1
    • 2-5A-dependent ribonuclease
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease L (RNASEL) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Ribonuclease L (RNASEL) Antibody
    20-abx128619
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Ribonuclease L (RNASEL) Antibody
    20-abx135784
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ribonuclease L (RNASEL) Antibody
    20-abx178273
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Ribonuclease L (RNASEL) Antibody
    abx237331-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Recombinant Ribonuclease L (RNASEL)
    4-RPD164Hu01
    • EUR 512.16
    • EUR 240.00
    • EUR 1645.60
    • EUR 615.20
    • EUR 1130.40
    • EUR 406.00
    • EUR 3964.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q05823
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 27.2kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Ribonuclease L expressed in: E.coli

    Recombinant Ribonuclease L (RNASEL)
    4-RPD164Hu02
    • EUR 413.60
    • EUR 214.00
    • EUR 1276.00
    • EUR 492.00
    • EUR 884.00
    • EUR 340.00
    • EUR 3040.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q05823
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 17.8kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Ribonuclease L expressed in: E.coli

    Human Ribonuclease L (RNASEL) Protein
    20-abx652212
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human Ribonuclease L (RNASEL) Protein
    20-abx068927
    • EUR 718.00
    • EUR 286.00
    • EUR 2221.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Human Ribonuclease L (RNASEL) CLIA Kit
    20-abx494117
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human RNASEL (Ribonuclease L)
    ELK3754 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribonuclease L (RNASEL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ribonuclea
    • Show more
    Description: A sandwich ELISA kit for detection of Ribonuclease L from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Ribonuclease L (RNASEL) Polyclonal Antibody (Human)
    4-PAD164Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RNASEL (Ile358~His583)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL)

    Ribonuclease L (RNASEL) Polyclonal Antibody (Human), APC
    4-PAD164Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RNASEL (Ile358~His583)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with APC.

    Ribonuclease L (RNASEL) Polyclonal Antibody (Human), Biotinylated
    4-PAD164Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RNASEL (Ile358~His583)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with Biotin.

    Ribonuclease L (RNASEL) Polyclonal Antibody (Human), Cy3
    4-PAD164Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RNASEL (Ile358~His583)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with Cy3.

    Ribonuclease L (RNASEL) Polyclonal Antibody (Human), FITC
    4-PAD164Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RNASEL (Ile358~His583)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with FITC.

    Ribonuclease L (RNASEL) Polyclonal Antibody (Human), HRP
    4-PAD164Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RNASEL (Ile358~His583)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with HRP.

    Ribonuclease L (RNASEL) Polyclonal Antibody (Human), PE
    4-PAD164Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RNASEL (Ile358~His583)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with PE.

    Ribonuclease L (RNASEL) Polyclonal Antibody (Human), APC-Cy7
    4-PAD164Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RNASEL (Ile358~His583)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with APC-Cy7.

    Human 2- 5A- dependent ribonuclease, RNASEL ELISA KIT
    ELI-14516h 96 Tests
    EUR 824

    Human 2-5A-dependent ribonuclease (RNASEL)
    1-CSB-EP313223HU(F2)
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 63.4 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human 2-5A-dependent ribonuclease(RNASEL),partial expressed in E.coli

    Mouse 2- 5A- dependent ribonuclease, Rnasel ELISA KIT
    ELI-14679m 96 Tests
    EUR 865

    RNASEL ELISA KIT|Human
    EF002499 96 Tests
    EUR 689

    RNASEL ELISA Kit (Human) (OKCD00189)
    OKCD00189 96 Wells
    EUR 831
    Description: Description of target: Endoribonuclease that functions in the interferon (IFN) antiviral response. In INF treated and virus infected cells, RNASEL probably mediates its antiviral effects through a combination of direct cleavage of single-stranded viral RNAs, inhibition of protein synthesis through the degradation of rRNA, induction of apoptosis, and induction of other antiviral genes. RNASEL mediated apoptosis is the result of a JNK-dependent stress-response pathway leading to cytochrome c release from mitochondria and caspase-dependent apoptosis. Therefore, activation of RNASEL could lead to elimination of virus infected cells under some circumstances. In the crosstalk between autophagy and apoptosis proposed to induce autophagy as an early stress response to small double-stranded RNA and at later stages of prolonged stress to activate caspase-dependent proteolytic cleavage of BECN1 to terminate autophagy and promote apoptosis (PubMed:26263979). Might play a central role in the regulation of mRNA turnover (PubMed:11585831).2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"The 2-5A/RNase L/RNase L inhibitor (RNI) pathway regulates mitochondrial mRNAs stability in interferon alpha-treated H9 cells."_x005F_x005F_x000D_Le Roy F., Bisbal C., Silhol M., Martinand C., Lebleu B., Salehzada T._x005F_x005F_x000D_J. Biol. Chem. 276:48473-48482(2001) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.14"RNase L cleavage products promote switch from autophagy to apoptosis by caspase-mediated cleavage of beclin-1."_x005F_x005F_x000D_Siddiqui M.A., Mukherjee S., Manivannan P., Malathi K._x005F_x005F_x000D_Int. J. Mol. Sci. 16:17611-17636(2015) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.5 pg/mL

    RNASEL ELISA Kit (Human) (OKAN06411)
    OKAN06411 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

    Human Ribonuclease ELISA kit
    E01R0357-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease ELISA kit
    E01R0357-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease ELISA kit
    E01R0357-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease ELISA Kit
    ELA-E0297h 96 Tests
    EUR 824

    RNASEL siRNA
    20-abx931642
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RNASEL siRNA
    20-abx931643
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RNASEL antibody
    20R-1317 100 ug
    EUR 377
    Description: Rabbit polyclonal RNASEL antibody

    RNASEL Antibody
    1-CSB-PA313223LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RNASEL. Recognizes RNASEL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202

    Human RNASEL shRNA Plasmid
    20-abx954091
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    RNASEL Recombinant Protein (Human)
    RP042934 100 ug Ask for price

    Human Ribonuclease Inhibitor ELISA kit
    E01R0052-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease Inhibitor ELISA kit
    E01R0052-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease Inhibitor ELISA kit
    E01R0052-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease A ELISA kit
    E01R0055-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease A ELISA kit
    E01R0055-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease A ELISA kit
    E01R0055-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease H ELISA kit
    E01R0060-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease H ELISA kit
    E01R0060-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease H ELISA kit
    E01R0060-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease T2 ELISA kit
    E01R0063-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease T2 ELISA kit
    E01R0063-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ribonuclease T2 ELISA kit
    E01R0063-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human targeted ribonuclease ELISA Kit
    ELA-E1382h 96 Tests
    EUR 824

    Human RNASE(Ribonuclease) ELISA Kit
    EH3719 96T
    EUR 524.1
    • Detection range: 78.125-5000 pg/ml
    • Alias: RNASE
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

    Human Ribonuclease(RNASE)ELISA Kit
    GA-E0783HM-48T 48T
    EUR 289

    Human Ribonuclease(RNASE)ELISA Kit
    GA-E0783HM-96T 96T
    EUR 466

    Human Ribonuclease (RNASE) ELISA Kit
    abx253109-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Ribonuclease,RNASE ELISA Kit
    201-12-0767 96 tests
    EUR 440
    • This Ribonuclease ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Ribonuclease,RNASE ELISA Kit
    CN-04532H1 96T
    EUR 447

    Human Ribonuclease,RNASE ELISA Kit
    CN-04532H2 48T
    EUR 296

    Human Ribonuclease(RNASE)ELISA Kit
    QY-E03180 96T
    EUR 361

    RNASEL cloning plasmid
    CSB-CL313223HU-10ug 10ug
    EUR 474
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2226
    • Sequence: ATGGAGAGCAGGGATCATAACAACCCCCAGGAGGGACCCACGTCCTCCAGCGGTAGAAGGGCTGCAGTGGAAGACAATCACTTGCTGATTAAAGCTGTTCAAAACGAAGATGTTGACCTGGTCCAGCAATTGCTGGAAGGTGGAGCCAATGTTAATTTCCAGGAAGAGGAAGGGG
    • Show more
    Description: A cloning plasmid for the RNASEL gene.

    anti- RNASEL antibody
    FNab07331 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
    • Uniprot ID: Q05823
    • Gene ID: 6041
    • Research Area: Immunology, Metabolism
    Description: Antibody raised against RNASEL

    RNASEL Polyclonal Antibody
    A55090 100 µg
    EUR 570.55
    Description: fast delivery possible

    RNASEL Rabbit pAb
    A9840-100ul 100 ul
    EUR 308

    RNASEL Rabbit pAb
    A9840-200ul 200 ul
    EUR 459

    RNASEL Rabbit pAb
    A9840-20ul 20 ul
    EUR 183

    RNASEL Rabbit pAb
    A9840-50ul 50 ul
    EUR 223

    RNASEL Blocking Peptide
    33R-6150 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNASEL antibody, catalog no. 20R-1317

    RNASEL Polyclonal Antibody
    31753-100ul 100ul
    EUR 252

    RNASEL Polyclonal Antibody
    31753-50ul 50ul
    EUR 187

    Anti-RNASEL antibody
    PAab07331 100 ug
    EUR 355

    Anti-RNASEL antibody
    STJ111882 100 µl
    EUR 277
    Description: This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele.

    Rat Ribonuclease ELISA kit
    E02R0357-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Ribonuclease ELISA kit
    E02R0357-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Ribonuclease ELISA kit
    E02R0357-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Ribonuclease ELISA kit
    E03R0357-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Ribonuclease ELISA kit
    E03R0357-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Ribonuclease ELISA kit
    E03R0357-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Ribonuclease ELISA kit
    E04R0357-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Ribonuclease ELISA kit
    E04R0357-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Ribonuclease ELISA kit
    E04R0357-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Ribonuclease ELISA kit
    E06R0357-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Ribonuclease ELISA kit
    E06R0357-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Ribonuclease ELISA kit
    E06R0357-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Ribonuclease ELISA kit
    E07R0357-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Ribonuclease ELISA kit
    E07R0357-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Ribonuclease ELISA kit
    E07R0357-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Ribonuclease ELISA kit
    E08R0357-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Ribonuclease ELISA kit
    E08R0357-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Ribonuclease ELISA kit
    E08R0357-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Ribonuclease ELISA kit
    E09R0357-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Ribonuclease ELISA kit
    E09R0357-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Ribonuclease ELISA kit
    E09R0357-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    RNASEL ORF Vector (Human) (pORF)
    ORF014312 1.0 ug DNA
    EUR 95

    Human Ribonuclease H (RNASEH) ELISA Kit
    abx571344-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    ELISA kit for Human Ribonuclease 7
    EK2525 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ribonuclease 7 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Ribonuclease inhibitor
    EK3409 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ribonuclease inhibitor in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human RNASE7/ Ribonuclease 7 ELISA Kit
    E2161Hu 1 Kit
    EUR 605

    Human RNH1/ Ribonuclease inhibitor ELISA Kit
    E2837Hu 1 Kit
    EUR 571

    Human RNASE7(Ribonuclease 7) ELISA Kit
    EH1119 96T
    EUR 567.6
    • Detection range: 1.56-100 ng/ml
    • Uniprot ID: Q9H1E1
    • Alias: RNase 7(Ribonuclease 7)/RNASE7/SAP-2/Skin-derived antimicrobial protein 2
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

    Human RNH1(Ribonuclease inhibitor) ELISA Kit
    EH1611 96T
    EUR 567.6
    • Detection range: 1.56-100 ng/ml
    • Uniprot ID: P13489
    • Alias: RNH1/RAI/RNH/PRI/Placental RNase inhibitor/Placental ribonuclease inhibitor/Ribonuclease,angiogenin inhibitor 1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

    Human RNASET2(Ribonuclease T2) ELISA Kit
    EH3723 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: O00584
    • Alias: RNASET2/RNASE6PL/Ribonuclease T2/Ribonuclease 6
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human Ribonuclease pancreatic, RNASE1 ELISA KIT
    ELI-14517h 96 Tests
    EUR 824

    Human Ribonuclease K6, RNASE6 ELISA KIT
    ELI-20360h 96 Tests
    EUR 824

    Human Ribonuclease 4, RNASE4 ELISA KIT
    ELI-21945h 96 Tests
    EUR 824

    Human Ribonuclease 7, RNASE7 ELISA KIT
    ELI-21946h 96 Tests
    EUR 824

    Human Ribonuclease inhibitor, RNH1 ELISA KIT
    ELI-04719h 96 Tests
    EUR 824

    Human Ribonuclease T2, RNASET2 ELISA KIT
    ELI-07059h 96 Tests
    EUR 824

    Human Ribonuclease kappa, RNASEK ELISA KIT
    ELI-35806h 96 Tests
    EUR 824

    Human Ribonuclease H1, RNASEH1 ELISA KIT
    ELI-30261h 96 Tests
    EUR 824

    Human Ribonuclease 3, DROSHA ELISA KIT
    ELI-38868h 96 Tests
    EUR 824

    Human Ribonuclease ZC3H12A, ZC3H12A ELISA KIT
    ELI-40682h 96 Tests
    EUR 824

    Human Ribonuclease 8, RNASE8 ELISA KIT
    ELI-42654h 96 Tests
    EUR 824

    Human Ribonuclease UK114, HRSP12 ELISA KIT
    ELI-51363h 96 Tests
    EUR 824

    Human Ribonuclease A (RNASE1) ELISA Kit
    20-abx152962
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ribonuclease A6 (RNASE6) ELISA Kit
    20-abx152965
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ribonuclease A7 (RNASE7) ELISA Kit
    20-abx152966
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ribonuclease A8 (RNASE8) ELISA Kit
    20-abx152967
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ribonuclease H (RNASEH) ELISA Kit
    20-abx152968
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    20-abx152970
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Targeted Ribonuclease (TR) ELISA Kit
    abx354500-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Ribonuclease 11 (RNASE11) ELISA Kit
    abx382830-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Ribonuclease 13 (RNASE13) ELISA Kit
    abx382831-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Ribonuclease H1 (RNASEH1) ELISA Kit
    abx382832-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Ribonuclease inhibitor (RNH1) ELISA Kit
    abx250903-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Ribonuclease inhibitor (RNH1) ELISA Kit
    abx253105-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    abx253112-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Ribonuclease 7 (RNASE7) ELISA Kit
    abx250366-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Human targeted ribonuclease, TR ELISA Kit
    201-12-0836 96 tests
    EUR 440
    • This targeted ribonuclease ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Ribonuclease A (RNASE1) ELISA Kit
    DLR-RNASE1-Hu-48T 48T
    EUR 479
    • Should the Human Ribonuclease A (RNASE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A (RNASE1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ribonuclease A (RNASE1) ELISA Kit
    DLR-RNASE1-Hu-96T 96T
    EUR 621
    • Should the Human Ribonuclease A (RNASE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A (RNASE1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ribonuclease A3 (RNASE3) ELISA Kit
    DLR-RNASE3-Hu-48T 48T
    EUR 498
    • Should the Human Ribonuclease A3 (RNASE3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A3 (RNASE3) in samples from serum, plasma, cell lysates or other biological fluids.

    Human Ribonuclease A3 (RNASE3) ELISA Kit
    DLR-RNASE3-Hu-96T 96T
    EUR 647
    • Should the Human Ribonuclease A3 (RNASE3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A3 (RNASE3) in samples from serum, plasma, cell lysates or other biological fluids.

    Human Ribonuclease A6 (RNASE6) ELISA Kit
    DLR-RNASE6-Hu-48T 48T
    EUR 517
    • Should the Human Ribonuclease A6 (RNASE6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ribonuclease A6 (RNASE6) ELISA Kit
    DLR-RNASE6-Hu-96T 96T
    EUR 673
    • Should the Human Ribonuclease A6 (RNASE6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ribonuclease A7 (RNASE7) ELISA Kit
    DLR-RNASE7-Hu-48T 48T
    EUR 517
    • Should the Human Ribonuclease A7 (RNASE7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A7 (RNASE7) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ribonuclease A7 (RNASE7) ELISA Kit
    DLR-RNASE7-Hu-96T 96T
    EUR 673
    • Should the Human Ribonuclease A7 (RNASE7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A7 (RNASE7) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ribonuclease A8 (RNASE8) ELISA Kit
    DLR-RNASE8-Hu-48T 48T
    EUR 517
    • Should the Human Ribonuclease A8 (RNASE8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A8 (RNASE8) in samples from tissue homogenates or other biological fluids.

    Human Ribonuclease A8 (RNASE8) ELISA Kit
    DLR-RNASE8-Hu-96T 96T
    EUR 673
    • Should the Human Ribonuclease A8 (RNASE8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A8 (RNASE8) in samples from tissue homogenates or other biological fluids.

    Human Ribonuclease H (RNASEH) ELISA Kit
    DLR-RNASEH-Hu-48T 48T
    EUR 479
    • Should the Human Ribonuclease H (RNASEH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease H (RNASEH) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Ribonuclease H (RNASEH) ELISA Kit
    DLR-RNASEH-Hu-96T 96T
    EUR 621
    • Should the Human Ribonuclease H (RNASEH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease H (RNASEH) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    DLR-RNASET2-Hu-48T 48T
    EUR 479
    • Should the Human Ribonuclease T2 (RNASET2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease T2 (RNASET2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    DLR-RNASET2-Hu-96T 96T
    EUR 621
    • Should the Human Ribonuclease T2 (RNASET2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease T2 (RNASET2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Ribonuclease 4(RNASE4) ELISA kit
    CSB-EL019796HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 4 (RNASE4) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Ribonuclease 4(RNASE4) ELISA kit
    1-CSB-EL019796HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 4(RNASE4) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Ribonuclease 7(RNASE7) ELISA kit
    CSB-EL019798HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 7 (RNASE7) in samples from serum, plasma, urine, saliva, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Ribonuclease 7(RNASE7) ELISA kit
    1-CSB-EL019798HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 7(RNASE7) in samples from serum, plasma, urine, saliva, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Ribonuclease 8(RNASE8) ELISA kit
    CSB-EL019799HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 8 (RNASE8) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Ribonuclease 8(RNASE8) ELISA kit
    1-CSB-EL019799HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 8(RNASE8) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human targeted ribonuclease, TR ELISA Kit
    CN-03499H1 96T
    EUR 449

    Human targeted ribonuclease, TR ELISA Kit
    CN-03499H2 48T
    EUR 299

    ELISA kit for Human RNASE (Ribonuclease)
    E-EL-H1383 1 plate of 96 wells
    EUR 534
    • Gentaur's RNASE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RNASE. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human RNASE (Ribonuclease) in samples from Serum, Plasma, Cell supernatant

    Human Ribonuclease A3 (RNASE3) ELISA Kit
    SEB758Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4502.43
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A3 (RNASE3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A3 (RNASE3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ribonuclease A3 (RNASE3) ELISA Kit
    SEB758Hu-1x48wellstestplate 1x48-wells test plate
    EUR 458.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A3 (RNASE3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A3 (RNASE3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ribonuclease A3 (RNASE3) ELISA Kit
    SEB758Hu-1x96wellstestplate 1x96-wells test plate
    EUR 612.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A3 (RNASE3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A3 (RNASE3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ribonuclease A3 (RNASE3) ELISA Kit
    SEB758Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2454.23
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A3 (RNASE3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A3 (RNASE3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ribonuclease A3 (RNASE3) ELISA Kit
    4-SEB758Hu
    • EUR 4553.00
    • EUR 2405.00
    • EUR 613.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ribonuclease A3 elisa. Alternative names of the recognized antigen: Rnase-A3
    • RnaseA3
    • ECP
    • RNS3
    • Ribonuclease, RNase A Family 3
    • Eosinophil Cationic Protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease A3 (RNASE3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Ribonuclease A (RNASE1) ELISA Kit
    SEA297Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4273.35
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A (RNASE1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A (RNASE1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ribonuclease A (RNASE1) ELISA Kit
    SEA297Hu-1x48wellstestplate 1x48-wells test plate
    EUR 439.57
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A (RNASE1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A (RNASE1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ribonuclease A (RNASE1) ELISA Kit
    SEA297Hu-1x96wellstestplate 1x96-wells test plate
    EUR 585.1
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A (RNASE1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A (RNASE1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ribonuclease A (RNASE1) ELISA Kit
    SEA297Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2332.95
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A (RNASE1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A (RNASE1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ribonuclease A (RNASE1) ELISA Kit
    4-SEA297Hu
    • EUR 4324.00
    • EUR 2283.00
    • EUR 586.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ribonuclease A elisa. Alternative names of the recognized antigen: RNASE
    • Rnase-A
    • RNase UpI-1
    • RIB-1
    • Ribonuclease, RNase A Family, 1(Pancreatic)
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease A (RNASE1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    SEA113Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4273.35
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease T2 (RNASET2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease T2 (RNASET2) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    SEA113Hu-1x48wellstestplate 1x48-wells test plate
    EUR 439.57
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease T2 (RNASET2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease T2 (RNASET2) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    SEA113Hu-1x96wellstestplate 1x96-wells test plate
    EUR 585.1
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease T2 (RNASET2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease T2 (RNASET2) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    SEA113Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2332.95
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease T2 (RNASET2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease T2 (RNASET2) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Ribonuclease T2 (RNASET2) ELISA Kit
    4-SEA113Hu
    • EUR 4324.00
    • EUR 2283.00
    • EUR 586.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ribonuclease T2 elisa. Alternative names of the recognized antigen: Rnase-T2
    • RNASE6PL
    • RNASE6-PL
    • Ribonuclease 6
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease T2 (RNASET2) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Ribonuclease H (RNASEH) ELISA Kit
    SEA200Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4273.35
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease H (RNASEH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease H (RNASEH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ribonuclease H (RNASEH) ELISA Kit
    SEA200Hu-1x48wellstestplate 1x48-wells test plate
    EUR 439.57
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease H (RNASEH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease H (RNASEH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ribonuclease H (RNASEH) ELISA Kit
    SEA200Hu-1x96wellstestplate 1x96-wells test plate
    EUR 585.1
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease H (RNASEH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease H (RNASEH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ribonuclease H (RNASEH) ELISA Kit
    SEA200Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2332.95
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease H (RNASEH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease H (RNASEH) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ribonuclease H (RNASEH) ELISA Kit
    4-SEA200Hu
    • EUR 4324.00
    • EUR 2283.00
    • EUR 586.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ribonuclease H elisa. Alternative names of the recognized antigen: Rnase-H
    • RNASEH1
    • RNH1
    • Ribonuclease H type II
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease H (RNASEH) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Ribonuclease A ELISA Kit (RNASE1)
    RK02199 96 Tests
    EUR 521

    Human Ribonuclease A2 ELISA Kit (RNASE2)
    RK02200 96 Tests
    EUR 521

    Human Ribonuclease A3 ELISA Kit (RNASE3)
    RK02201 96 Tests
    EUR 521

    Human Ribonuclease A6 ELISA Kit (RNASE6)
    RK02202 96 Tests
    EUR 521

    Human Ribonuclease A7 ELISA Kit (RNASE7)
    RK02203 96 Tests
    EUR 521

    Human Ribonuclease T2 ELISA Kit (RNASET2)
    RK02205 96 Tests
    EUR 521

    Human Ribonuclease A (RNASE1) ELISA Kit
    RD-RNASE1-Hu-48Tests 48 Tests
    EUR 478

    Human RNASEL(Ribonuclease L) ELISA Kit