Human RNASEL(Ribonuclease L) ELISA Kit

Human RNASEL(Ribonuclease L) ELISA Kit

To Order Contact us below: 

Human Ribonuclease L (RNASEL) ELISA Kit

RDR-RNASEL-Hu-96Tests 96 Tests
EUR 756

Human Ribonuclease L (RNASEL) ELISA Kit

RD-RNASEL-Hu-48Tests 48 Tests
EUR 521

Human Ribonuclease L (RNASEL) ELISA Kit

RD-RNASEL-Hu-96Tests 96 Tests
EUR 723

Human Ribonuclease L (RNASEL) ELISA Kit

20-abx152969
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribonuclease L(RNASEL)ELISA Kit

QY-E03164 96T
EUR 394

Human Ribonuclease L ELISA Kit (RNASEL)

RK02204 96 Tests
EUR 521

Human Ribonuclease L (RNASEL) ELISA Kit

SED164Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease L (RNASEL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease L (RNASEL) in serum, plasma, tissue homogenates and other biological fluids.

Human Ribonuclease L (RNASEL) ELISA Kit

SED164Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease L (RNASEL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease L (RNASEL) in serum, plasma, tissue homogenates and other biological fluids.

Human Ribonuclease L (RNASEL) ELISA Kit

SED164Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease L (RNASEL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease L (RNASEL) in serum, plasma, tissue homogenates and other biological fluids.

Human Ribonuclease L (RNASEL) ELISA Kit

SED164Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease L (RNASEL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease L (RNASEL) in serum, plasma, tissue homogenates and other biological fluids.

Human Ribonuclease L (RNASEL) ELISA Kit

4-SED164Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribonuclease L elisa. Alternative names of the recognized antigen: Rnase-L
  • RNS4
  • PRCA1
  • 2', 5'-Oligoisoadenylate Synthetase-Dependent
  • Prostate Cancer 1
  • 2-5A-dependent ribonuclease
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease L (RNASEL) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ribonuclease L (RNASEL) Antibody

20-abx178273
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribonuclease L (RNASEL) Antibody

20-abx128619
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribonuclease L (RNASEL) Antibody

20-abx135784
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribonuclease L (RNASEL) Antibody

abx237331-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Ribonuclease L (RNASEL)

4-RPD164Hu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q05823
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribonuclease L expressed in: E.coli

Recombinant Ribonuclease L (RNASEL)

4-RPD164Hu02
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q05823
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribonuclease L expressed in: E.coli

ELISA kit for Human RNASEL (Ribonuclease L)

ELK3754 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribonuclease L (RNASEL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ribonuclea
  • Show more
Description: A sandwich ELISA kit for detection of Ribonuclease L from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Ribonuclease L (RNASEL) Protein

20-abx068927
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Ribonuclease L (RNASEL) Protein

20-abx652212
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Ribonuclease L (RNASEL) CLIA Kit

20-abx494117
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Ribonuclease L (RNASEL) Polyclonal Antibody (Human)

4-PAD164Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASEL (Ile358~His583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL)

Ribonuclease L (RNASEL) Polyclonal Antibody (Human), APC

4-PAD164Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASEL (Ile358~His583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with APC.

Ribonuclease L (RNASEL) Polyclonal Antibody (Human), Biotinylated

4-PAD164Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASEL (Ile358~His583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with Biotin.

Ribonuclease L (RNASEL) Polyclonal Antibody (Human), Cy3

4-PAD164Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASEL (Ile358~His583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with Cy3.

Ribonuclease L (RNASEL) Polyclonal Antibody (Human), FITC

4-PAD164Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASEL (Ile358~His583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with FITC.

Ribonuclease L (RNASEL) Polyclonal Antibody (Human), HRP

4-PAD164Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASEL (Ile358~His583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with HRP.

Ribonuclease L (RNASEL) Polyclonal Antibody (Human), PE

4-PAD164Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASEL (Ile358~His583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with PE.

Ribonuclease L (RNASEL) Polyclonal Antibody (Human), APC-Cy7

4-PAD164Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RNASEL (Ile358~His583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease L (RNASEL). This antibody is labeled with APC-Cy7.

Human 2- 5A- dependent ribonuclease, RNASEL ELISA KIT

ELI-14516h 96 Tests
EUR 824

Human 2-5A-dependent ribonuclease (RNASEL)

1-CSB-EP313223HU(F2)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 63.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 2-5A-dependent ribonuclease(RNASEL),partial expressed in E.coli

Mouse 2- 5A- dependent ribonuclease, Rnasel ELISA KIT

ELI-14679m 96 Tests
EUR 865

RNASEL ELISA KIT|Human

EF002499 96 Tests
EUR 689

Human Ribonuclease ELISA kit

E01R0357-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease ELISA kit

E01R0357-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease ELISA kit

E01R0357-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease ELISA Kit

ELA-E0297h 96 Tests
EUR 824

RNASEL antibody

20R-1317 100 ug
EUR 377
Description: Rabbit polyclonal RNASEL antibody

RNASEL Antibody

1-CSB-PA313223LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNASEL. Recognizes RNASEL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RNASEL siRNA

20-abx931642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNASEL siRNA

20-abx931643
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human RNASEL shRNA Plasmid

20-abx954091
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RNASEL Recombinant Protein (Human)

RP042934 100 ug Ask for price

Human Ribonuclease,RNASE ELISA Kit

201-12-0767 96 tests
EUR 440
  • This Ribonuclease ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ribonuclease Inhibitor ELISA kit

E01R0052-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease Inhibitor ELISA kit

E01R0052-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease Inhibitor ELISA kit

E01R0052-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease A ELISA kit

E01R0055-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease A ELISA kit

E01R0055-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease A ELISA kit

E01R0055-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease H ELISA kit

E01R0060-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease H ELISA kit

E01R0060-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease H ELISA kit

E01R0060-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease T2 ELISA kit

E01R0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease T2 ELISA kit

E01R0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease T2 ELISA kit

E01R0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease (RNASE) ELISA Kit

abx253109-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human RNASE(Ribonuclease) ELISA Kit

EH3719 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Alias: RNASE
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human targeted ribonuclease ELISA Kit

ELA-E1382h 96 Tests
EUR 824

Human Ribonuclease,RNASE ELISA Kit

CN-04532H1 96T
EUR 447

Human Ribonuclease,RNASE ELISA Kit

CN-04532H2 48T
EUR 296

Human Ribonuclease(RNASE)ELISA Kit

GA-E0783HM-48T 48T
EUR 289

Human Ribonuclease(RNASE)ELISA Kit

GA-E0783HM-96T 96T
EUR 466

Human Ribonuclease(RNASE)ELISA Kit

QY-E03180 96T
EUR 361

RNASEL Blocking Peptide

33R-6150 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNASEL antibody, catalog no. 20R-1317

RNASEL Polyclonal Antibody

31753-100ul 100ul
EUR 252

RNASEL Polyclonal Antibody

31753-50ul 50ul
EUR 187

RNASEL cloning plasmid

CSB-CL313223HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2226
  • Sequence: ATGGAGAGCAGGGATCATAACAACCCCCAGGAGGGACCCACGTCCTCCAGCGGTAGAAGGGCTGCAGTGGAAGACAATCACTTGCTGATTAAAGCTGTTCAAAACGAAGATGTTGACCTGGTCCAGCAATTGCTGGAAGGTGGAGCCAATGTTAATTTCCAGGAAGAGGAAGGGG
  • Show more
Description: A cloning plasmid for the RNASEL gene.

RNASEL Rabbit pAb

A9840-100ul 100 ul
EUR 308

RNASEL Rabbit pAb

A9840-200ul 200 ul
EUR 459

RNASEL Rabbit pAb

A9840-20ul 20 ul
EUR 183

RNASEL Rabbit pAb

A9840-50ul 50 ul
EUR 223

RNASEL Polyclonal Antibody

A55090 100 µg
EUR 570.55
Description: fast delivery possible

anti- RNASEL antibody

FNab07331 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
  • Uniprot ID: Q05823
  • Gene ID: 6041
  • Research Area: Immunology, Metabolism
Description: Antibody raised against RNASEL

Anti-RNASEL antibody

PAab07331 100 ug
EUR 355

Anti-RNASEL antibody

STJ111882 100 µl
EUR 277
Description: This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele.

Rabbit Ribonuclease ELISA kit

E04R0357-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribonuclease ELISA kit

E04R0357-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribonuclease ELISA kit

E04R0357-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribonuclease ELISA kit

E02R0357-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribonuclease ELISA kit

E02R0357-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribonuclease ELISA kit

E02R0357-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribonuclease ELISA kit

E03R0357-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribonuclease ELISA kit

E03R0357-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribonuclease ELISA kit

E03R0357-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribonuclease ELISA kit

E06R0357-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribonuclease ELISA kit

E06R0357-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribonuclease ELISA kit

E06R0357-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribonuclease ELISA kit

E08R0357-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribonuclease ELISA kit

E08R0357-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribonuclease ELISA kit

E08R0357-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribonuclease ELISA kit

E09R0357-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribonuclease ELISA kit

E09R0357-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribonuclease ELISA kit

E09R0357-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribonuclease ELISA kit

E07R0357-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribonuclease ELISA kit

E07R0357-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribonuclease ELISA kit

E07R0357-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human targeted ribonuclease, TR ELISA Kit

201-12-0836 96 tests
EUR 440
  • This targeted ribonuclease ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human RNASE (Ribonuclease)

E-EL-H1383 1 plate of 96 wells
EUR 534
  • Gentaur's RNASE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RNASE. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RNASE (Ribonuclease) in samples from Serum, Plasma, Cell supernatant

Human Ribonuclease A (RNASE1) ELISA Kit

DLR-RNASE1-Hu-48T 48T
EUR 479
  • Should the Human Ribonuclease A (RNASE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A (RNASE1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A (RNASE1) ELISA Kit

DLR-RNASE1-Hu-96T 96T
EUR 621
  • Should the Human Ribonuclease A (RNASE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A (RNASE1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A3 (RNASE3) ELISA Kit

DLR-RNASE3-Hu-48T 48T
EUR 498
  • Should the Human Ribonuclease A3 (RNASE3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A3 (RNASE3) in samples from serum, plasma, cell lysates or other biological fluids.

Human Ribonuclease A3 (RNASE3) ELISA Kit

DLR-RNASE3-Hu-96T 96T
EUR 647
  • Should the Human Ribonuclease A3 (RNASE3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A3 (RNASE3) in samples from serum, plasma, cell lysates or other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit

DLR-RNASE6-Hu-48T 48T
EUR 517
  • Should the Human Ribonuclease A6 (RNASE6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit

DLR-RNASE6-Hu-96T 96T
EUR 673
  • Should the Human Ribonuclease A6 (RNASE6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A7 (RNASE7) ELISA Kit

DLR-RNASE7-Hu-48T 48T
EUR 517
  • Should the Human Ribonuclease A7 (RNASE7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A7 (RNASE7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A7 (RNASE7) ELISA Kit

DLR-RNASE7-Hu-96T 96T
EUR 673
  • Should the Human Ribonuclease A7 (RNASE7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A7 (RNASE7) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A8 (RNASE8) ELISA Kit

DLR-RNASE8-Hu-48T 48T
EUR 517
  • Should the Human Ribonuclease A8 (RNASE8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A8 (RNASE8) in samples from tissue homogenates or other biological fluids.

Human Ribonuclease A8 (RNASE8) ELISA Kit

DLR-RNASE8-Hu-96T 96T
EUR 673
  • Should the Human Ribonuclease A8 (RNASE8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A8 (RNASE8) in samples from tissue homogenates or other biological fluids.

Human Ribonuclease H (RNASEH) ELISA Kit

DLR-RNASEH-Hu-48T 48T
EUR 479
  • Should the Human Ribonuclease H (RNASEH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease H (RNASEH) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ribonuclease H (RNASEH) ELISA Kit

DLR-RNASEH-Hu-96T 96T
EUR 621
  • Should the Human Ribonuclease H (RNASEH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease H (RNASEH) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ribonuclease T2 (RNASET2) ELISA Kit

DLR-RNASET2-Hu-48T 48T
EUR 479
  • Should the Human Ribonuclease T2 (RNASET2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease T2 (RNASET2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Ribonuclease T2 (RNASET2) ELISA Kit

DLR-RNASET2-Hu-96T 96T
EUR 621
  • Should the Human Ribonuclease T2 (RNASET2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease T2 (RNASET2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Ribonuclease 4(RNASE4) ELISA kit

CSB-EL019796HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 4 (RNASE4) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ribonuclease 4(RNASE4) ELISA kit

1-CSB-EL019796HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 4(RNASE4) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ribonuclease 7(RNASE7) ELISA kit

CSB-EL019798HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 7 (RNASE7) in samples from serum, plasma, urine, saliva, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ribonuclease 7(RNASE7) ELISA kit

1-CSB-EL019798HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 7(RNASE7) in samples from serum, plasma, urine, saliva, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ribonuclease 8(RNASE8) ELISA kit

CSB-EL019799HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 8 (RNASE8) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ribonuclease 8(RNASE8) ELISA kit

1-CSB-EL019799HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ribonuclease 8(RNASE8) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ribonuclease A (RNASE1) ELISA Kit

20-abx152962
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribonuclease A6 (RNASE6) ELISA Kit

20-abx152965
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribonuclease A7 (RNASE7) ELISA Kit

20-abx152966
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribonuclease A8 (RNASE8) ELISA Kit

20-abx152967
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribonuclease H (RNASEH) ELISA Kit

20-abx152968
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribonuclease T2 (RNASET2) ELISA Kit

20-abx152970
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribonuclease 7 (RNASE7) ELISA Kit

abx250366-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Ribonuclease inhibitor (RNH1) ELISA Kit

abx250903-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Ribonuclease inhibitor (RNH1) ELISA Kit

abx253105-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Ribonuclease T2 (RNASET2) ELISA Kit

abx253112-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human RNASET2(Ribonuclease T2) ELISA Kit

EH3723 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O00584
  • Alias: RNASET2/RNASE6PL/Ribonuclease T2/Ribonuclease 6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human Ribonuclease 7

EK2525 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ribonuclease 7 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Ribonuclease inhibitor

EK3409 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ribonuclease inhibitor in samples from serum, plasma, tissue homogenates and other biological fluids.

Human RNASE7/ Ribonuclease 7 ELISA Kit

E2161Hu 1 Kit
EUR 605

Human RNH1/ Ribonuclease inhibitor ELISA Kit

E2837Hu 1 Kit
EUR 571

Human RNASE7(Ribonuclease 7) ELISA Kit

EH1119 96T
EUR 567.6
  • Detection range: 1.56-100 ng/ml
  • Uniprot ID: Q9H1E1
  • Alias: RNase 7(Ribonuclease 7)/RNASE7/SAP-2/Skin-derived antimicrobial protein 2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human RNH1(Ribonuclease inhibitor) ELISA Kit

EH1611 96T
EUR 567.6
  • Detection range: 1.56-100 ng/ml
  • Uniprot ID: P13489
  • Alias: RNH1/RAI/RNH/PRI/Placental RNase inhibitor/Placental ribonuclease inhibitor/Ribonuclease,angiogenin inhibitor 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Ribonuclease pancreatic, RNASE1 ELISA KIT

ELI-14517h 96 Tests
EUR 824

Human Ribonuclease K6, RNASE6 ELISA KIT

ELI-20360h 96 Tests
EUR 824

Human Ribonuclease 4, RNASE4 ELISA KIT

ELI-21945h 96 Tests
EUR 824

Human Ribonuclease 7, RNASE7 ELISA KIT

ELI-21946h 96 Tests
EUR 824

Human Ribonuclease H1, RNASEH1 ELISA KIT

ELI-30261h 96 Tests
EUR 824

Human Ribonuclease inhibitor, RNH1 ELISA KIT

ELI-04719h 96 Tests
EUR 824

Human Ribonuclease T2, RNASET2 ELISA KIT

ELI-07059h 96 Tests
EUR 824

Human Ribonuclease UK114, HRSP12 ELISA KIT

ELI-51363h 96 Tests
EUR 824

Human Ribonuclease 8, RNASE8 ELISA KIT

ELI-42654h 96 Tests
EUR 824

Human targeted ribonuclease, TR ELISA Kit

CN-03499H1 96T
EUR 449

Human targeted ribonuclease, TR ELISA Kit

CN-03499H2 48T
EUR 299

Human Targeted Ribonuclease (TR) ELISA Kit

abx354500-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Ribonuclease 11 (RNASE11) ELISA Kit

abx382830-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribonuclease 13 (RNASE13) ELISA Kit

abx382831-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribonuclease H1 (RNASEH1) ELISA Kit

abx382832-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribonuclease H (RNASEH) ELISA Kit

abx571344-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Ribonuclease kappa, RNASEK ELISA KIT

ELI-35806h 96 Tests
EUR 824

Human Ribonuclease 3, DROSHA ELISA KIT

ELI-38868h 96 Tests
EUR 824

Human Ribonuclease ZC3H12A, ZC3H12A ELISA KIT

ELI-40682h 96 Tests
EUR 824

Human Ribonuclease Inhibitor(RI)ELISA Kit

QY-E03158 96T
EUR 361

Human Ribonuclease T2(RNASET2)ELISA Kit

QY-E03162 96T
EUR 394

Human Ribonuclease P(RNASEP)ELISA Kit

QY-E03163 96T
EUR 394

Human Ribonuclease K(RNASEK)ELISA Kit

QY-E03165 96T
EUR 394

Human Ribonuclease H(RNASEH)ELISA Kit

QY-E03166 96T
EUR 394

Human Ribonuclease A9(RNASE9)ELISA Kit

QY-E03167 96T
EUR 394

Human Ribonuclease A8(RNASE8)ELISA Kit

QY-E03168 96T
EUR 361

Human Ribonuclease A7(RNASE7)ELISA Kit

QY-E03169 96T
EUR 361

Human Ribonuclease A6(RNASE6)ELISA Kit

QY-E03170 96T
EUR 361

Human Ribonuclease A4(RNASE4)ELISA Kit

QY-E03171 96T
EUR 361

Human Ribonuclease A3(RNASE3)ELISA Kit

QY-E03172 96T
EUR 361

Human Ribonuclease A2(RNASE2)ELISA Kit

QY-E03173 96T
EUR 361

Human Ribonuclease A13(RNASE13)ELISA Kit

QY-E03174 96T
EUR 361

Human Ribonuclease A12(RNASE12)ELISA Kit

QY-E03175 96T
EUR 361

Human Ribonuclease A11(RNASE11)ELISA Kit

QY-E03176 96T
EUR 361

Human Ribonuclease A10(RNASE10)ELISA Kit

QY-E03177 96T
EUR 361

Human Ribonuclease A(RNASE1)ELISA Kit

QY-E03178 96T
EUR 361

Human Ribonuclease A ELISA Kit (RNASE1)

RK02199 96 Tests
EUR 521

Human Ribonuclease A2 ELISA Kit (RNASE2)

RK02200 96 Tests
EUR 521

Human Ribonuclease A3 ELISA Kit (RNASE3)

RK02201 96 Tests
EUR 521

Human Ribonuclease A6 ELISA Kit (RNASE6)

RK02202 96 Tests
EUR 521

Human Ribonuclease A7 ELISA Kit (RNASE7)

RK02203 96 Tests
EUR 521

Human Ribonuclease T2 ELISA Kit (RNASET2)

RK02205 96 Tests
EUR 521

Human Ribonuclease A3 (RNASE3) ELISA Kit

SEB758Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A3 (RNASE3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A3 (RNASE3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A3 (RNASE3) ELISA Kit

SEB758Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A3 (RNASE3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A3 (RNASE3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A3 (RNASE3) ELISA Kit

SEB758Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A3 (RNASE3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A3 (RNASE3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A3 (RNASE3) ELISA Kit

SEB758Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A3 (RNASE3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A3 (RNASE3) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A3 (RNASE3) ELISA Kit

4-SEB758Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribonuclease A3 elisa. Alternative names of the recognized antigen: Rnase-A3
  • RnaseA3
  • ECP
  • RNS3
  • Ribonuclease, RNase A Family 3
  • Eosinophil Cationic Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease A3 (RNASE3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Ribonuclease A2 (RNASE2) ELISA Kit

SED169Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A2 (RNASE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A2 (RNASE2) in serum, plasma, tissue homogenates and other biological fluids.

Human Ribonuclease A2 (RNASE2) ELISA Kit

SED169Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A2 (RNASE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A2 (RNASE2) in serum, plasma, tissue homogenates and other biological fluids.

Human RNASEL(Ribonuclease L) ELISA Kit