Human PPL(Periplakin) ELISA Kit

Human PPL(Periplakin) ELISA Kit

To Order Contact us below: 

    Human Periplakin (PPL) ELISA Kit
    RDR-PPL-Hu-48Tests 48 Tests
    EUR 544
    Human Periplakin (PPL) ELISA Kit
    RDR-PPL-Hu-96Tests 96 Tests
    EUR 756
    Human Periplakin (PPL) ELISA Kit
    RD-PPL-Hu-48Tests 48 Tests
    EUR 521
    Human Periplakin (PPL) ELISA Kit
    RD-PPL-Hu-96Tests 96 Tests
    EUR 723
    Mouse Periplakin (PPL) ELISA Kit
    DLR-PPL-Mu-48T 48T
    EUR 527
    • Should the Mouse Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
    Mouse Periplakin (PPL) ELISA Kit
    DLR-PPL-Mu-96T 96T
    EUR 688
    • Should the Mouse Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
    Mouse Periplakin (PPL) ELISA Kit
    RDR-PPL-Mu-48Tests 48 Tests
    EUR 557
    Mouse Periplakin (PPL) ELISA Kit
    RDR-PPL-Mu-96Tests 96 Tests
    EUR 774
    Mouse Periplakin (PPL) ELISA Kit
    RD-PPL-Mu-48Tests 48 Tests
    EUR 533
    Mouse Periplakin (PPL) ELISA Kit
    RD-PPL-Mu-96Tests 96 Tests
    EUR 740
    Human Periplakin (PPL) ELISA Kit
    20-abx152709
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Periplakin, PPL ELISA KIT
    ELI-15152h 96 Tests
    EUR 824
    Human Periplakin(PPL)ELISA Kit
    QY-E02006 96T
    EUR 361
    Human Periplakin (PPL) ELISA Kit
    SEH334Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Periplakin (PPL) ELISA Kit
    SEH334Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Periplakin (PPL) ELISA Kit
    SEH334Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Periplakin (PPL) ELISA Kit
    SEH334Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Periplakin (PPL) ELISA Kit
    4-SEH334Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen
    • 195 kDa cornified envelope precursor protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Mouse Periplakin (PPL) ELISA Kit
    20-abx154532
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Mouse Periplakin, Ppl ELISA KIT
    ELI-35659m 96 Tests
    EUR 865
    Mouse Periplakin(PPL)ELISA Kit
    QY-E21728 96T
    EUR 374
    Mouse Periplakin (PPL) ELISA Kit
    SEH334Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4862.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Mouse Periplakin (PPL) ELISA Kit
    SEH334Mu-1x48wellstestplate 1x48-wells test plate
    EUR 488.08
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Mouse Periplakin (PPL) ELISA Kit
    SEH334Mu-1x96wellstestplate 1x96-wells test plate
    EUR 654.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Mouse Periplakin (PPL) ELISA Kit
    SEH334Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2644.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Mouse Periplakin (PPL) ELISA Kit
    4-SEH334Mu
    • EUR 4913.00
    • EUR 2595.00
    • EUR 655.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen
    • 195 kDa cornified envelope precursor protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Periplakin (PPL) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Periplakin (PPL) Antibody
    20-abx005273
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Periplakin (PPL) Antibody
    20-abx177959
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Periplakin (PPL) Antibody
    20-abx100391
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Periplakin (PPL) Antibody
    20-abx100392
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Periplakin (PPL) Antibody
    abx038117-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Periplakin (PPL) Antibody
    20-abx129708
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Recombinant Periplakin (PPL)
    4-RPH334Hu01
    • EUR 528.29
    • EUR 244.00
    • EUR 1706.08
    • EUR 635.36
    • EUR 1170.72
    • EUR 416.00
    • EUR 4115.20
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: O60437
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 36.1kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Periplakin expressed in: E.coli
    Recombinant Periplakin (PPL)
    4-RPH334Hu02
    • EUR 528.29
    • EUR 244.00
    • EUR 1706.08
    • EUR 635.36
    • EUR 1170.72
    • EUR 416.00
    • EUR 4115.20
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: O60437
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 64.2kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Periplakin expressed in: E.coli
    Recombinant Periplakin (PPL)
    4-RPH334Mu01
    • EUR 492.45
    • EUR 235.00
    • EUR 1571.68
    • EUR 590.56
    • EUR 1081.12
    • EUR 392.00
    • EUR 3779.20
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9R269
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 33.1kDa
    • Isoelectric Point: 6
    Description: Recombinant Mouse Periplakin expressed in: E.coli
    ELISA kit for Human PPL (Periplakin)
    ELK3840 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL).
    • Show more
    Description: A sandwich ELISA kit for detection of Periplakin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Human Periplakin (PPL) CLIA Kit
    20-abx495434
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Human Periplakin (PPL) Protein
    20-abx068469
    • EUR 732.00
    • EUR 286.00
    • EUR 2291.00
    • EUR 871.00
    • EUR 523.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Periplakin (PPL) Protein
    20-abx068470
    • EUR 732.00
    • EUR 286.00
    • EUR 2291.00
    • EUR 871.00
    • EUR 523.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.
    ELISA kit for Mouse PPL (Periplakin)
    ELK6363 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL).
    • Show more
    Description: A sandwich ELISA kit for detection of Periplakin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Mouse Periplakin (PPL)
    KTE70706-48T 48T
    EUR 332
    • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Periplakin (PPL)
    KTE70706-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Periplakin (PPL)
    KTE70706-96T 96T
    EUR 539
    • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Mouse Periplakin (PPL) CLIA Kit
    20-abx495435
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Anti-Periplakin/PPL Antibody
    A02098-1 100ug/vial
    EUR 334
    Mouse Periplakin (PPL) Protein
    20-abx167309
    • EUR 690.00
    • EUR 286.00
    • EUR 2124.00
    • EUR 815.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Periplakin (PPL) Polyclonal Antibody (Human)
    4-PAH334Hu02
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Periplakin (PPL)
    Periplakin (PPL) Polyclonal Antibody (Mouse)
    4-PAH334Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1501~Lys1754)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL)
    Periplakin (PPL) Polyclonal Antibody (Human, Pig)
    4-PAH334Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL)
    Periplakin (PPL) Polyclonal Antibody (Human), APC
    4-PAH334Hu02-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC.
    Periplakin (PPL) Polyclonal Antibody (Human), Biotinylated
    4-PAH334Hu02-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Biotin.
    Periplakin (PPL) Polyclonal Antibody (Human), Cy3
    4-PAH334Hu02-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Cy3.
    Periplakin (PPL) Polyclonal Antibody (Human), FITC
    4-PAH334Hu02-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with FITC.
    Periplakin (PPL) Polyclonal Antibody (Human), HRP
    4-PAH334Hu02-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with HRP.
    Periplakin (PPL) Polyclonal Antibody (Human), PE
    4-PAH334Hu02-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with PE.
    Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC
    4-PAH334Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC.
    Periplakin (PPL) Polyclonal Antibody (Human, Pig), Biotinylated
    4-PAH334Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Biotin.
    Periplakin (PPL) Polyclonal Antibody (Human, Pig), Cy3
    4-PAH334Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Cy3.
    Periplakin (PPL) Polyclonal Antibody (Human, Pig), FITC
    4-PAH334Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with FITC.
    Periplakin (PPL) Polyclonal Antibody (Human, Pig), HRP
    4-PAH334Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with HRP.
    Periplakin (PPL) Polyclonal Antibody (Human, Pig), PE
    4-PAH334Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with PE.
    Periplakin (PPL) Polyclonal Antibody (Human), APC-Cy7
    4-PAH334Hu02-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC-Cy7.
    Periplakin (PPL) Polyclonal Antibody (Mouse), APC
    4-PAH334Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1501~Lys1754)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC.
    Periplakin (PPL) Polyclonal Antibody (Mouse), Biotinylated
    4-PAH334Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1501~Lys1754)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Biotin.
    Periplakin (PPL) Polyclonal Antibody (Mouse), Cy3
    4-PAH334Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1501~Lys1754)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Cy3.
    Periplakin (PPL) Polyclonal Antibody (Mouse), FITC
    4-PAH334Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1501~Lys1754)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with FITC.
    Periplakin (PPL) Polyclonal Antibody (Mouse), HRP
    4-PAH334Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1501~Lys1754)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with HRP.
    Periplakin (PPL) Polyclonal Antibody (Mouse), PE
    4-PAH334Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1501~Lys1754)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with PE.
    Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC-Cy7
    4-PAH334Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1439~Gly1716)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC-Cy7.
    Periplakin (PPL) Polyclonal Antibody (Mouse), APC-Cy7
    4-PAH334Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PPL (Glu1501~Lys1754)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC-Cy7.
    PPL ELISA Kit (Human) (OKCD01030)
    OKCD01030 96 Wells
    EUR 831
    Description: Description of target: Component of the cornified envelope of keratinocytes. May link the cornified envelope to desmosomes and intermediate filaments. May act as a localization signal in PKB/AKT-mediated signaling.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Periplakin, a novel component of cornified envelopes and desmosomes that belongs to the plakin family and forms complexes with envoplakin."_x005F_x005F_x000D_Ruhrberg C., Hajibagheri M.A.N., Parry D.A.D., Watt F.M._x005F_x005F_x000D_J. Cell Biol. 139:1835-1849(1997) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA], FUNCTION, TISSUE SPECIFICITY, SUBCELLULAR LOCATION, INDUCTION, INTERACTION WITH EVPL, VARIANTS GLN-589 AND SER-819. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.121 ng/mL
    PPL ELISA Kit (Mouse) (OKCD00775)
    OKCD00775 96 Wells
    EUR 857
    Description: Description of target: Component of the cornified envelope of keratinocytes. May link the cornified envelope to desmosomes and intermediate filaments. May act as a localization signal in PKB/AKT-mediated signaling. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 14.0 pg/mL
    Periplakin antibody
    70R-2652 50 ug
    EUR 467
    Description: Rabbit polyclonal Periplakin antibody raised against the middle region of PPL
    Periplakin Antibody
    20-abx141927
    • EUR 370.00
    • EUR 606.00
    • EUR 300.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Periplakin antibody
    PAab10072 100 ug
    EUR 386
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    PPL antibody
    20R-2607 100 uL
    EUR 571
    Description: Guinea Pig polyclonal Periplakin antibody
    PPL Antibody
    39987-100ul 100ul
    EUR 390
    PPL siRNA
    20-abx929423
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PPL siRNA
    20-abx929424
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Periplakin Blocking Peptide
    33R-2523 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPL antibody, catalog no. 70R-2652
    anti- Periplakin antibody
    FNab10072 100µg
    EUR 548.75
    • Recommended dilution: IHC: 1:20-1:200
    • Immunogen: periplakin
    • Uniprot ID: O60437
    • Gene ID: 5493
    • Research Area: Immunology, Signal Transduction
    Description: Antibody raised against Periplakin
    Human PPL shRNA Plasmid
    20-abx953679
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    PPL Polyclonal Antibody
    30769-100ul 100ul
    EUR 252
    PPL Polyclonal Antibody
    30769-50ul 50ul
    EUR 187
    PPL Polyclonal Antibody
    28423-100ul 100ul
    EUR 252
    PPL Polyclonal Antibody
    28423-50ul 50ul
    EUR 187
    PPL Rabbit pAb
    A14051-100ul 100 ul
    EUR 308
    PPL Rabbit pAb
    A14051-200ul 200 ul
    EUR 459
    PPL Rabbit pAb
    A14051-20ul 20 ul
    EUR 183
    PPL Rabbit pAb
    A14051-50ul 50 ul
    EUR 223
    PPL cloning plasmid
    CSB-CL018488HU-10ug 10ug
    EUR 2770
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 5271
    • Sequence: ATGAACTCGCTCTTCAGGAAGAGAAACAAAGGCAAATACAGCCCCACTGTGCAGACCCGGAGCATCTCTAACAAGGAGCTCTCGGAGCTGATCGAGCAGCTGCAGAAGAATGCCGACCAGGTGGAGAAGAACATCGTGGACACAGAGGCCAAGATGCAGAGTGACCTGGCTCGGC
    • Show more
    Description: A cloning plasmid for the PPL gene.

    Human PPL(Periplakin) ELISA Kit