Human PPL(Periplakin) ELISA Kit

Human PPL(Periplakin) ELISA Kit

To Order Contact us below: 

Human Periplakin (PPL) ELISA Kit
RD-PPL-Hu-48Tests 48 Tests
EUR 521
Human Periplakin (PPL) ELISA Kit
RD-PPL-Hu-96Tests 96 Tests
EUR 723
Human Periplakin (PPL) ELISA Kit
RDR-PPL-Hu-48Tests 48 Tests
EUR 544
Human Periplakin (PPL) ELISA Kit
RDR-PPL-Hu-96Tests 96 Tests
EUR 756
Mouse Periplakin (PPL) ELISA Kit
DLR-PPL-Mu-48T 48T
EUR 527
  • Should the Mouse Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
DLR-PPL-Mu-96T 96T
EUR 688
  • Should the Mouse Periplakin (PPL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
RD-PPL-Mu-48Tests 48 Tests
EUR 533
Mouse Periplakin (PPL) ELISA Kit
RD-PPL-Mu-96Tests 96 Tests
EUR 740
Mouse Periplakin (PPL) ELISA Kit
RDR-PPL-Mu-48Tests 48 Tests
EUR 557
Mouse Periplakin (PPL) ELISA Kit
RDR-PPL-Mu-96Tests 96 Tests
EUR 774
Human Periplakin, PPL ELISA KIT
ELI-15152h 96 Tests
EUR 824
Human Periplakin (PPL) ELISA Kit
20-abx152709
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Periplakin(PPL)ELISA Kit
QY-E02006 96T
EUR 361
Human Periplakin (PPL) ELISA Kit
SEH334Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Periplakin (PPL) ELISA Kit
SEH334Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Periplakin (PPL) ELISA Kit
SEH334Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Periplakin (PPL) ELISA Kit
SEH334Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Periplakin (PPL) ELISA Kit
4-SEH334Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen
  • 195 kDa cornified envelope precursor protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Periplakin (PPL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Periplakin, Ppl ELISA KIT
ELI-35659m 96 Tests
EUR 865
Mouse Periplakin (PPL) ELISA Kit
20-abx154532
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Periplakin(PPL)ELISA Kit
QY-E21728 96T
EUR 374
Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
SEH334Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Periplakin (PPL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Periplakin (PPL) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Mouse Periplakin (PPL) ELISA Kit
4-SEH334Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Periplakin elisa. Alternative names of the recognized antigen: 190 kDa paraneoplastic pemphigus antigen
  • 195 kDa cornified envelope precursor protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Periplakin (PPL) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Periplakin (PPL) Antibody
20-abx129708
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Periplakin (PPL) Antibody
abx038117-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Periplakin (PPL) Antibody
20-abx100391
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Periplakin (PPL) Antibody
20-abx100392
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Periplakin (PPL) Antibody
20-abx005273
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Periplakin (PPL) Antibody
20-abx177959
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Periplakin (PPL)
4-RPH334Hu01
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60437
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Periplakin expressed in: E.coli
Recombinant Periplakin (PPL)
4-RPH334Hu02
  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60437
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 64.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Periplakin expressed in: E.coli
Recombinant Periplakin (PPL)
4-RPH334Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9R269
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.1kDa
  • Isoelectric Point: 6
Description: Recombinant Mouse Periplakin expressed in: E.coli
ELISA kit for Human PPL (Periplakin)
ELK3840 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL).
  • Show more
Description: A sandwich ELISA kit for detection of Periplakin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Periplakin (PPL) CLIA Kit
20-abx495434
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Periplakin (PPL) Protein
20-abx068469
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Periplakin (PPL) Protein
20-abx068470
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
ELISA kit for Mouse PPL (Periplakin)
ELK6363 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Periplakin (PPL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Periplakin (PPL).
  • Show more
Description: A sandwich ELISA kit for detection of Periplakin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Periplakin (PPL)
KTE70706-48T 48T
EUR 332
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Periplakin (PPL)
KTE70706-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Periplakin (PPL)
KTE70706-96T 96T
EUR 539
  • Periplakin is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. This protein may serv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Periplakin (PPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Periplakin (PPL) CLIA Kit
20-abx495435
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Periplakin (PPL) Protein
20-abx167309
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Anti-Periplakin/PPL Antibody
A02098-1 100ug/vial
EUR 334
Periplakin (PPL) Polyclonal Antibody (Human)
4-PAH334Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL)
Periplakin (PPL) Polyclonal Antibody (Mouse)
4-PAH334Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL)
Periplakin (PPL) Polyclonal Antibody (Human, Pig)
4-PAH334Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL)
Periplakin (PPL) Polyclonal Antibody (Human), APC
4-PAH334Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC.
Periplakin (PPL) Polyclonal Antibody (Human), Biotinylated
4-PAH334Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Biotin.
Periplakin (PPL) Polyclonal Antibody (Human), Cy3
4-PAH334Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with Cy3.
Periplakin (PPL) Polyclonal Antibody (Human), FITC
4-PAH334Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with FITC.
Periplakin (PPL) Polyclonal Antibody (Human), HRP
4-PAH334Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with HRP.
Periplakin (PPL) Polyclonal Antibody (Human), PE
4-PAH334Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with PE.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC
4-PAH334Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAH334Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Biotin.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), Cy3
4-PAH334Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with Cy3.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), FITC
4-PAH334Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with FITC.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), HRP
4-PAH334Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with HRP.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), PE
4-PAH334Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with PE.
Periplakin (PPL) Polyclonal Antibody (Human), APC-Cy7
4-PAH334Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Periplakin (PPL). This antibody is labeled with APC-Cy7.
Periplakin (PPL) Polyclonal Antibody (Mouse), APC
4-PAH334Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC.
Periplakin (PPL) Polyclonal Antibody (Mouse), Biotinylated
4-PAH334Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Biotin.
Periplakin (PPL) Polyclonal Antibody (Mouse), Cy3
4-PAH334Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with Cy3.
Periplakin (PPL) Polyclonal Antibody (Mouse), FITC
4-PAH334Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with FITC.
Periplakin (PPL) Polyclonal Antibody (Mouse), HRP
4-PAH334Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with HRP.
Periplakin (PPL) Polyclonal Antibody (Mouse), PE
4-PAH334Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with PE.
Periplakin (PPL) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAH334Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1439~Gly1716)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Periplakin (PPL). This antibody is labeled with APC-Cy7.
Periplakin (PPL) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH334Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPL (Glu1501~Lys1754)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Periplakin (PPL). This antibody is labeled with APC-Cy7.
Periplakin Antibody
20-abx141927
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Periplakin antibody
70R-2652 50 ug
EUR 467
Description: Rabbit polyclonal Periplakin antibody raised against the middle region of PPL
Periplakin antibody
PAab10072 100 ug
EUR 386
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
PPL siRNA
20-abx929423
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PPL siRNA
20-abx929424
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PPL Antibody
39987-100ul 100ul
EUR 390
PPL antibody
20R-2607 100 uL
EUR 571
Description: Guinea Pig polyclonal Periplakin antibody
anti- Periplakin antibody
FNab10072 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: periplakin
  • Uniprot ID: O60437
  • Gene ID: 5493
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against Periplakin
Periplakin Blocking Peptide
33R-2523 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPL antibody, catalog no. 70R-2652
Human PPL shRNA Plasmid
20-abx953679
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PPL cloning plasmid
CSB-CL018488HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5271
  • Sequence: ATGAACTCGCTCTTCAGGAAGAGAAACAAAGGCAAATACAGCCCCACTGTGCAGACCCGGAGCATCTCTAACAAGGAGCTCTCGGAGCTGATCGAGCAGCTGCAGAAGAATGCCGACCAGGTGGAGAAGAACATCGTGGACACAGAGGCCAAGATGCAGAGTGACCTGGCTCGGC
  • Show more
Description: A cloning plasmid for the PPL gene.
PPL Rabbit pAb
A14051-100ul 100 ul
EUR 308
PPL Rabbit pAb
A14051-200ul 200 ul
EUR 459
PPL Rabbit pAb
A14051-20ul 20 ul
EUR 183
PPL Rabbit pAb
A14051-50ul 50 ul
EUR 223
PPL Rabbit pAb
A6950-100ul 100 ul
EUR 308
PPL Rabbit pAb
A6950-200ul 200 ul
EUR 459
PPL Rabbit pAb
A6950-20ul 20 ul
EUR 183
PPL Rabbit pAb
A6950-50ul 50 ul
EUR 223
PPL Polyclonal Antibody
30769-100ul 100ul
EUR 252
PPL Polyclonal Antibody
30769-50ul 50ul
EUR 187

Human PPL(Periplakin) ELISA Kit