Human CYGB(Cytoglobin) ELISA Kit

Human CYGB(Cytoglobin) ELISA Kit

To Order Contact us below: 

Human Cytoglobin (CYGB) ELISA Kit

RDR-CYGB-Hu-48Tests 48 Tests
EUR 544

Human Cytoglobin (CYGB) ELISA Kit

RDR-CYGB-Hu-96Tests 96 Tests
EUR 756

Human Cytoglobin (CYGB) ELISA Kit

RD-CYGB-Hu-48Tests 48 Tests
EUR 521

Human Cytoglobin (CYGB) ELISA Kit

RD-CYGB-Hu-96Tests 96 Tests
EUR 723

Rat Cytoglobin (CYGB) ELISA Kit

DLR-CYGB-Ra-48T 48T
EUR 549
  • Should the Rat Cytoglobin (CYGB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cytoglobin (CYGB) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Cytoglobin (CYGB) ELISA Kit

DLR-CYGB-Ra-96T 96T
EUR 718
  • Should the Rat Cytoglobin (CYGB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cytoglobin (CYGB) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Cytoglobin (CYGB) ELISA Kit

RDR-CYGB-Ra-48Tests 48 Tests
EUR 583

Rat Cytoglobin (CYGB) ELISA Kit

RDR-CYGB-Ra-96Tests 96 Tests
EUR 811

Rat Cytoglobin (CYGB) ELISA Kit

RD-CYGB-Ra-48Tests 48 Tests
EUR 557

Rat Cytoglobin (CYGB) ELISA Kit

RD-CYGB-Ra-96Tests 96 Tests
EUR 775

Human Cytoglobin (CYGB)ELISA Kit

201-12-2080 96 tests
EUR 440
  • This Cytoglobin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cytoglobin(CYGB) ELISA kit

E01C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytoglobin(CYGB) ELISA kit

E01C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytoglobin(CYGB) ELISA kit

E01C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytoglobin (CYGB) ELISA Kit

20-abx151248
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cytoglobin (CYGB) ELISA Kit

abx571357-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Cytoglobin, CYGB ELISA KIT

ELI-50647h 96 Tests
EUR 824

Human Cytoglobin(CYGB)ELISA Kit

QY-E00970 96T
EUR 361

Human Cytoglobin (CYGB) ELISA Kit

SEC426Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

Human Cytoglobin (CYGB) ELISA Kit

SEC426Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

Human Cytoglobin (CYGB) ELISA Kit

SEC426Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

Human Cytoglobin (CYGB) ELISA Kit

SEC426Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

Human Cytoglobin (CYGB) ELISA Kit

4-SEC426Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cytoglobin elisa. Alternative names of the recognized antigen: HGB
  • STAP
  • Stellate Cell Activation-Associated Protein
  • Histoglobin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cytoglobin (CYGB) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Cytoglobin (CYGB)

1-CSB-EP006376HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cytoglobin(CYGB) expressed in E.coli

Rat Cytoglobin(CYGB) ELISA kit

E02C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytoglobin(CYGB) ELISA kit

E02C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytoglobin(CYGB) ELISA kit

E02C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytoglobin(CYGB) ELISA kit

E03C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytoglobin(CYGB) ELISA kit

E03C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytoglobin(CYGB) ELISA kit

E03C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytoglobin(CYGB) ELISA kit

E06C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytoglobin(CYGB) ELISA kit

E06C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytoglobin(CYGB) ELISA kit

E06C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytoglobin(CYGB) ELISA kit

E04C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytoglobin(CYGB) ELISA kit

E04C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytoglobin(CYGB) ELISA kit

E04C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytoglobin (CYGB) ELISA Kit

20-abx155428
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Monkey Cytoglobin(CYGB) ELISA kit

E09C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytoglobin(CYGB) ELISA kit

E09C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytoglobin(CYGB) ELISA kit

E09C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytoglobin(CYGB) ELISA kit

E08C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytoglobin(CYGB) ELISA kit

E08C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cytoglobin(CYGB) ELISA kit

E08C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytoglobin(CYGB) ELISA kit

E07C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytoglobin(CYGB) ELISA kit

E07C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cytoglobin(CYGB) ELISA kit

E07C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytoglobin, Cygb ELISA KIT

ELI-27092m 96 Tests
EUR 865

Mouse Cytoglobin (CYGB) ELISA Kit

abx353080-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Cytoglobin (CYGB) ELISA Kit

abx573570-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Cytoglobin(CYGB)ELISA kit

QY-E10338 96T
EUR 361

Rat Cytoglobin (CYGB) ELISA Kit

SEC426Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

Rat Cytoglobin (CYGB) ELISA Kit

SEC426Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

Rat Cytoglobin (CYGB) ELISA Kit

SEC426Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

Rat Cytoglobin (CYGB) ELISA Kit

SEC426Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

Rat Cytoglobin (CYGB) ELISA Kit

4-SEC426Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cytoglobin elisa. Alternative names of the recognized antigen: HGB
  • STAP
  • Stellate Cell Activation-Associated Protein
  • Histoglobin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Cytoglobin (CYGB) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Cytoglobin(CYGB)ELISA kit

QY-E20446 96T
EUR 361

ELISA kit for Human CYGB (Cytoglobin)

E-EL-H2471 1 plate of 96 wells
EUR 534
  • Gentaur's CYGB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CYGB. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CYGB (Cytoglobin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human CYGB (Cytoglobin)

ELK4053 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cytoglobin (CYGB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cytoglobin (CYGB
  • Show more
Description: A sandwich ELISA kit for detection of Cytoglobin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Cytoglobin (CYGB)

KTE62175-48T 48T
EUR 332
  • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Cytoglobin (CYGB)

KTE62175-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Cytoglobin (CYGB)

KTE62175-96T 96T
EUR 539
  • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cytoglobin (CYGB) Antibody

20-abx007980
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cytoglobin (CYGB) Antibody

20-abx004975
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytoglobin (CYGB) Antibody

20-abx111941
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytoglobin (CYGB) Antibody

20-abx128188
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cytoglobin (CYGB) Antibody

20-abx130086
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cytoglobin (CYGB) Antibody

20-abx172034
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cytoglobin (CYGB) Antibody

20-abx172035
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cytoglobin (CYGB) Antibody

20-abx320341
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytoglobin (CYGB) Antibody

20-abx301168
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytoglobin (CYGB) Protein

20-abx262892
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Cytoglobin (CYGB) Antibody

abx232188-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cytoglobin (CYGB) Antibody

abx232189-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Cytoglobin (CYGB)

4-RPC426Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WWM9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cytoglobin expressed in: E.coli

Recombinant Cytoglobin (CYGB)

4-RPC426Ra01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q921A4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Cytoglobin expressed in: E.coli

Human Cytoglobin (CYGB) CLIA Kit

20-abx493687
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Cytoglobin (CYGB) Protein

20-abx168146
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse CYGB (Cytoglobin)

E-EL-M1103 1 plate of 96 wells
EUR 534
  • Gentaur's CYGB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CYGB. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CYGB (Cytoglobin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat CYGB (Cytoglobin)

E-EL-R1113 1 plate of 96 wells
EUR 534
  • Gentaur's CYGB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CYGB. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CYGB (Cytoglobin) in samples from Serum, Plasma, Cell supernatant

Guinea pig Cytoglobin(CYGB) ELISA kit

E05C2218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cytoglobin(CYGB) ELISA kit

E05C2218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cytoglobin(CYGB) ELISA kit

E05C2218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat CYGB (Cytoglobin)

ELK6582 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cytoglobin (CYGB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cytoglobin (CYGB
  • Show more
Description: A sandwich ELISA kit for detection of Cytoglobin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Cytoglobin (CYGB)

KTE100808-48T 48T
EUR 332
  • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Cytoglobin (CYGB)

KTE100808-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Cytoglobin (CYGB)

KTE100808-96T 96T
EUR 539
  • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Cytoglobin (CYGB)

KTE71354-48T 48T
EUR 332
  • Cytoglobin (CYGB) encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Cytoglobin (CYGB)

KTE71354-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Cytoglobin (CYGB) encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Cytoglobin (CYGB)

KTE71354-96T 96T
EUR 539
  • Cytoglobin (CYGB) encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involv
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cygb ELISA Kit| Rat Cytoglobin ELISA Kit

EF018543 96 Tests
EUR 689

Cygb ELISA Kit| Mouse Cytoglobin ELISA Kit

EF014614 96 Tests
EUR 689

Rat Cytoglobin (CYGB) CLIA Kit

20-abx493688
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Anti-Cytoglobin/CYGB Antibody

A01197 100ug/vial
EUR 334

Rat Cytoglobin (CYGB) Protein

20-abx168526
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cytoglobin (CYGB) Antibody (HRP)

20-abx303561
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytoglobin (CYGB) Antibody (FITC)

20-abx303562
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytoglobin (CYGB) Antibody (Biotin)

20-abx303563
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Cytoglobin/CYGB Antibody

PA1657 100ug/vial
EUR 294

Cytoglobin (CYGB) Polyclonal Antibody (Human)

4-PAC426Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB)

CYGB Cytoglobin Human Recombinant Protein

PROTQ8WWM9 Regular: 10ug
EUR 317
Description: CYGB Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 210 amino acids (1-190 a.a.) and having a molecular mass of 23.5kDa. ;The CYGB is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Cytoglobin (CYGB) Polyclonal Antibody (Rat)

4-PAC426Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB)

Recombinant Human Cytoglobin/CYGB (C-6His)

C124-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0 .

Recombinant Human Cytoglobin/CYGB (C-6His)

C124-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0 .

Recombinant Human Cytoglobin/CYGB (C-6His)

C124-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0 .

Recombinant Human Cytoglobin/CYGB (C-6His)

C124-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0 .

Cytoglobin (CYGB) Polyclonal Antibody (Human), APC

4-PAC426Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with APC.

Cytoglobin (CYGB) Polyclonal Antibody (Human), Biotinylated

4-PAC426Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with Biotin.

Cytoglobin (CYGB) Polyclonal Antibody (Human), Cy3

4-PAC426Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with Cy3.

Cytoglobin (CYGB) Polyclonal Antibody (Human), FITC

4-PAC426Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with FITC.

Cytoglobin (CYGB) Polyclonal Antibody (Human), HRP

4-PAC426Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with HRP.

Cytoglobin (CYGB) Polyclonal Antibody (Human), PE

4-PAC426Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with PE.

Cytoglobin (CYGB) Polyclonal Antibody (Human), APC-Cy7

4-PAC426Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with APC-Cy7.

Cytoglobin (CYGB) Polyclonal Antibody (Rat), APC

4-PAC426Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with APC.

Cytoglobin (CYGB) Polyclonal Antibody (Rat), Biotinylated

4-PAC426Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with Biotin.

Cytoglobin (CYGB) Polyclonal Antibody (Rat), Cy3

4-PAC426Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with Cy3.

Cytoglobin (CYGB) Polyclonal Antibody (Rat), FITC

4-PAC426Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with FITC.

Cytoglobin (CYGB) Polyclonal Antibody (Rat), HRP

4-PAC426Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with HRP.

Cytoglobin (CYGB) Polyclonal Antibody (Rat), PE

4-PAC426Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with PE.

Cytoglobin (CYGB) Polyclonal Antibody (Rat), APC-Cy7

4-PAC426Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYGB (Met1~Pro190)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with APC-Cy7.

Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-100ug

QP5901-ec-100ug 100ug
EUR 408

Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-10ug

QP5901-ec-10ug 10ug
EUR 200

Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-1mg

QP5901-ec-1mg 1mg
EUR 1632

Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-200ug

QP5901-ec-200ug 200ug
EUR 634

Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-500ug

QP5901-ec-500ug 500ug
EUR 1060

Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-50ug

QP5901-ec-50ug 50ug
EUR 263

Cygb/ Rat Cygb ELISA Kit

ELI-08925r 96 Tests
EUR 886

CYGB ELISA KIT|Human

EF004826 96 Tests
EUR 689

CYGB ELISA Kit (Human) (OKCD00327)

OKCD00327 96 Wells
EUR 831
Description: Description of target: May have a protective function during conditions of oxidative stress. May be involved in intracellular oxygen storage or transfer. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.064 ng/mL

CYGB ELISA Kit (Human) (OKDD00220)

OKDD00220 96 Wells
EUR 975
Description: Description of target: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.065 ng/mL

CYGB ELISA Kit (Human) (OKEH08268)

OKEH08268 96 Wells
EUR 896
Description: Description of target: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062ng/mL

Recombinant Human Cytoglobin

7-04954 2µg Ask for price

Recombinant Human Cytoglobin

7-04955 10µg Ask for price

Recombinant Human Cytoglobin

7-04956 1mg Ask for price

CYGB ELISA Kit (Rat) (OKCD01247)

OKCD01247 96 Wells
EUR 896
Description: Description of target: May have a protective function during conditions of oxidative stress. May be involved in intracellular oxygen storage or transfer. Plays a role in the development of liver fibrosis. Has a peroxidase activity. ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.33 ng/mL

CYGB ELISA Kit (Mouse) (OKEI00561)

OKEI00561 96 Wells
EUR 767
Description: Description of target: May have a protective function during conditions of oxidative stress. May be involved in intracellular oxygen storage or transfer. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Recombinant Human CYGB

P0132 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: Q8WWM9
Description: Recombinant Human protein for CYGB

Cytoglobin antibody

70R-14194 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Cytoglobin antibody

Cytoglobin Antibody

DF12928 200ul
EUR 304
Description: Cytoglobin Antibody detects endogenous levels of Cytoglobin.

Cytoglobin antibody

70R-51160 100 ul
EUR 244
Description: Purified Polyclonal Cytoglobin antibody

anti-Cytoglobin

YF-PA26814 50 ul
EUR 334
Description: Mouse polyclonal to Cytoglobin

CYGB antibody

70R-16699 50 ul
EUR 435
Description: Rabbit polyclonal CYGB antibody

CYGB antibody

38960-100ul 100ul
EUR 252

CYGB Antibody

43504-100ul 100ul
EUR 252

CYGB Antibody

1-CSB-PA006376ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CYGB Antibody

1-CSB-PA006376GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CYGB Antibody

1-CSB-PA006376LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

CYGB siRNA

20-abx901371
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CYGB siRNA

20-abx913332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CYGB siRNA

20-abx913333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human CYGB shRNA Plasmid

20-abx964362
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CYGB Recombinant Protein (Human)

RP008575 100 ug Ask for price

Polyclonal Cytoglobin Antibody

APR05593G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cytoglobin . This antibody is tested and proven to work in the following applications:

Cytoglobin Blocking Peptide

DF12928-BP 1mg
EUR 195

Cytoglobin Polyclonal Antibody

ABP58324-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60
  • Applications tips:
Description: A polyclonal antibody for detection of Cytoglobin from Human, Mouse, Rat. This Cytoglobin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60

Cytoglobin Polyclonal Antibody

ABP58324-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60
  • Applications tips:
Description: A polyclonal antibody for detection of Cytoglobin from Human, Mouse, Rat. This Cytoglobin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60

Cytoglobin Polyclonal Antibody

ABP58324-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60
  • Applications tips:
Description: A polyclonal antibody for detection of Cytoglobin from Human, Mouse, Rat. This Cytoglobin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60

Cytoglobin Blocking Peptide

20-abx064035
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Cytoglobin Polyclonal Antibody

ES8780-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cytoglobin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Cytoglobin Polyclonal Antibody

ES8780-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cytoglobin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

anti- Cytoglobin antibody

FNab02188 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: cytoglobin
  • Uniprot ID: Q8WWM9
  • Gene ID: 114757
  • Research Area: Cardiovascular
Description: Antibody raised against Cytoglobin

anti- Cytoglobin antibody

FNab02189 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: cytoglobin
  • Uniprot ID: Q8WWM9
  • Gene ID: 114757
  • Research Area: Cardiovascular
Description: Antibody raised against Cytoglobin

anti-Cytoglobin (1A1)

LF-MA10404 100 ug
EUR 363
Description: Mouse monoclonal to Cytoglobin

Anti-Cytoglobin antibody

PAab02188 100 ug
EUR 355

Anti-Cytoglobin antibody

STJ98985 200 µl
EUR 197
Description: Rabbit polyclonal to Cytoglobin.

CYGB Rabbit pAb

A14155-100ul 100 ul
EUR 308

CYGB Rabbit pAb

A14155-200ul 200 ul
EUR 459

CYGB Rabbit pAb

A14155-20ul 20 ul
EUR 183

CYGB Rabbit pAb

A14155-50ul 50 ul
EUR 223

CYGB Conjugated Antibody

C38960 100ul
EUR 397

CYGB cloning plasmid

CSB-CL006376HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 573
  • Sequence: atggagaaagtgccaggcgagatggagatcgagcgcagggagcggagcgaggagctgtccgaggcggagaggaaggcggtgcaggctatgtgggcccggctctatgccagctgcgaggacgtgggggtggccatcctggtgaggttctttgtgaacttcccctcggccaagcagta
  • Show more
Description: A cloning plasmid for the CYGB gene.

CYGB Rabbit pAb

A6488-100ul 100 ul
EUR 308

CYGB Rabbit pAb

A6488-200ul 200 ul
EUR 459

CYGB Rabbit pAb

A6488-20ul 20 ul
EUR 183

CYGB Rabbit pAb

A6488-50ul 50 ul
EUR 223

CYGB Polyclonal Antibody

A50173 100 µg
EUR 570.55
Description: The best epigenetics products

anti- cygb antibody

FNab10223 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: Cytoglobin
  • Uniprot ID: Q8WWM9
  • Gene ID: 114757
Description: Antibody raised against cygb

Anti-CYGB antibody

STJ28571 100 µl
EUR 277
Description: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation.

Anti-CYGB antibody

STJ116090 100 µl
EUR 277
Description: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

CYGB ORF Vector (Human) (pORF)

ORF002859 1.0 ug DNA
EUR 95

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Anti-Cytoglobin (3A5-2D2)

YF-MA19730 100 ug
EUR 363
Description: Mouse monoclonal to Cytoglobin

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CYGB Antibody, HRP conjugated

1-CSB-PA006376LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CYGB Antibody, FITC conjugated

1-CSB-PA006376LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CYGB Antibody, Biotin conjugated

1-CSB-PA006376LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CYGB protein (His tag)

80R-1355 50 ug
EUR 397
Description: Purified recombinant Human CYGB protein

Rat CYGB shRNA Plasmid

20-abx987580
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CYGB shRNA Plasmid

20-abx980189
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-CYGB Plasmid

PVT16460 2 ug
EUR 325

CYGB Recombinant Protein (Rat)

RP197009 100 ug Ask for price

CYGB Recombinant Protein (Mouse)

RP127019 100 ug Ask for price

CYGB sgRNA CRISPR Lentivector set (Human)

K0548201 3 x 1.0 ug
EUR 339

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

CYGB sgRNA CRISPR Lentivector (Human) (Target 1)

K0548202 1.0 ug DNA
EUR 154

CYGB sgRNA CRISPR Lentivector (Human) (Target 2)

K0548203 1.0 ug DNA
EUR 154

CYGB sgRNA CRISPR Lentivector (Human) (Target 3)

K0548204 1.0 ug DNA
EUR 154

CYGB Protein Vector (Human) (pPB-C-His)

PV011433 500 ng
EUR 329

CYGB Protein Vector (Human) (pPB-N-His)

PV011434 500 ng
EUR 329

CYGB Protein Vector (Human) (pPM-C-HA)

PV011435 500 ng
EUR 329

CYGB Protein Vector (Human) (pPM-C-His)

PV011436 500 ng
EUR 329

CYGB Polyclonal Antibody, HRP Conjugated

A50174 100 µg
EUR 570.55
Description: kits suitable for this type of research

CYGB Polyclonal Antibody, FITC Conjugated

A50175 100 µg
EUR 570.55
Description: fast delivery possible

CYGB Polyclonal Antibody, Biotin Conjugated

A50176 100 µg
EUR 570.55
Description: reagents widely cited

Cygb ORF Vector (Rat) (pORF)

ORF065671 1.0 ug DNA
EUR 506

Cygb ORF Vector (Mouse) (pORF)

ORF042341 1.0 ug DNA
EUR 506

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Cygb sgRNA CRISPR Lentivector set (Rat)

K7004001 3 x 1.0 ug
EUR 339

Cygb sgRNA CRISPR Lentivector set (Mouse)

K4370501 3 x 1.0 ug
EUR 339

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Monoclonal CYGB Antibody (monoclonal) (M02), Clone: 1A1

AMM03444G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CYGB (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1A1. This antibody is applicable in WB, IHC and IF, E

Cygb sgRNA CRISPR Lentivector (Rat) (Target 1)

K7004002 1.0 ug DNA
EUR 154

Cygb sgRNA CRISPR Lentivector (Rat) (Target 2)

K7004003 1.0 ug DNA
EUR 154

Cygb sgRNA CRISPR Lentivector (Rat) (Target 3)

K7004004 1.0 ug DNA
EUR 154

Cygb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4370502 1.0 ug DNA
EUR 154

Cygb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4370503 1.0 ug DNA
EUR 154

Cygb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4370504 1.0 ug DNA
EUR 154

CYGB Protein Vector (Mouse) (pPB-C-His)

PV169362 500 ng
EUR 603

CYGB Protein Vector (Mouse) (pPB-N-His)

PV169363 500 ng
EUR 603

CYGB Protein Vector (Mouse) (pPM-C-HA)

PV169364 500 ng
EUR 603

CYGB Protein Vector (Mouse) (pPM-C-His)

PV169365 500 ng
EUR 603

CYGB Protein Vector (Rat) (pPB-C-His)

PV262682 500 ng
EUR 603

CYGB Protein Vector (Rat) (pPB-N-His)

PV262683 500 ng
EUR 603

CYGB Protein Vector (Rat) (pPM-C-HA)

PV262684 500 ng
EUR 603

Human CYGB(Cytoglobin) ELISA Kit