Human CYGB(Cytoglobin) ELISA Kit

Human CYGB(Cytoglobin) ELISA Kit

To Order Contact us below: 

    Human Cytoglobin (CYGB) ELISA Kit

    RDR-CYGB-Hu-48Tests 48 Tests
    EUR 544

    Human Cytoglobin (CYGB) ELISA Kit

    RDR-CYGB-Hu-96Tests 96 Tests
    EUR 756

    Human Cytoglobin (CYGB) ELISA Kit

    RD-CYGB-Hu-48Tests 48 Tests
    EUR 521

    Human Cytoglobin (CYGB) ELISA Kit

    RD-CYGB-Hu-96Tests 96 Tests
    EUR 723

    Rat Cytoglobin (CYGB) ELISA Kit

    DLR-CYGB-Ra-48T 48T
    EUR 549
    • Should the Rat Cytoglobin (CYGB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Cytoglobin (CYGB) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Cytoglobin (CYGB) ELISA Kit

    DLR-CYGB-Ra-96T 96T
    EUR 718
    • Should the Rat Cytoglobin (CYGB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Cytoglobin (CYGB) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Cytoglobin (CYGB) ELISA Kit

    RDR-CYGB-Ra-48Tests 48 Tests
    EUR 583

    Rat Cytoglobin (CYGB) ELISA Kit

    RDR-CYGB-Ra-96Tests 96 Tests
    EUR 811

    Rat Cytoglobin (CYGB) ELISA Kit

    RD-CYGB-Ra-48Tests 48 Tests
    EUR 557

    Rat Cytoglobin (CYGB) ELISA Kit

    RD-CYGB-Ra-96Tests 96 Tests
    EUR 775

    Human Cytoglobin (CYGB)ELISA Kit

    201-12-2080 96 tests
    EUR 440
    • This Cytoglobin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Cytoglobin(CYGB) ELISA kit

    E01C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Cytoglobin(CYGB) ELISA kit

    E01C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Cytoglobin(CYGB) ELISA kit

    E01C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Cytoglobin (CYGB) ELISA Kit

    20-abx151248
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Cytoglobin (CYGB) ELISA Kit

    abx571357-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Cytoglobin, CYGB ELISA KIT

    ELI-50647h 96 Tests
    EUR 824

    Human Cytoglobin(CYGB)ELISA Kit

    QY-E00970 96T
    EUR 361

    Human Cytoglobin (CYGB) ELISA Kit

    SEC426Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

    Human Cytoglobin (CYGB) ELISA Kit

    SEC426Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

    Human Cytoglobin (CYGB) ELISA Kit

    SEC426Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

    Human Cytoglobin (CYGB) ELISA Kit

    SEC426Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

    Human Cytoglobin (CYGB) ELISA Kit

    4-SEC426Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Cytoglobin elisa. Alternative names of the recognized antigen: HGB
    • STAP
    • Stellate Cell Activation-Associated Protein
    • Histoglobin
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cytoglobin (CYGB) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Cytoglobin (CYGB)

    1-CSB-EP006376HU
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 37.4 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Cytoglobin(CYGB) expressed in E.coli

    Rat Cytoglobin(CYGB) ELISA kit

    E02C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Cytoglobin(CYGB) ELISA kit

    E02C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Cytoglobin(CYGB) ELISA kit

    E02C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Cytoglobin(CYGB) ELISA kit

    E03C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Cytoglobin(CYGB) ELISA kit

    E03C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Cytoglobin(CYGB) ELISA kit

    E03C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Cytoglobin(CYGB) ELISA kit

    E06C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Cytoglobin(CYGB) ELISA kit

    E06C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Cytoglobin(CYGB) ELISA kit

    E06C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Cytoglobin(CYGB) ELISA kit

    E04C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Cytoglobin(CYGB) ELISA kit

    E04C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Cytoglobin(CYGB) ELISA kit

    E04C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Cytoglobin (CYGB) ELISA Kit

    20-abx155428
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Monkey Cytoglobin(CYGB) ELISA kit

    E09C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Cytoglobin(CYGB) ELISA kit

    E09C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Cytoglobin(CYGB) ELISA kit

    E09C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Cytoglobin(CYGB) ELISA kit

    E08C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Cytoglobin(CYGB) ELISA kit

    E08C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Cytoglobin(CYGB) ELISA kit

    E08C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Cytoglobin(CYGB) ELISA kit

    E07C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Cytoglobin(CYGB) ELISA kit

    E07C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Cytoglobin(CYGB) ELISA kit

    E07C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Cytoglobin, Cygb ELISA KIT

    ELI-27092m 96 Tests
    EUR 865

    Mouse Cytoglobin (CYGB) ELISA Kit

    abx353080-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Rat Cytoglobin (CYGB) ELISA Kit

    abx573570-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Rat Cytoglobin(CYGB)ELISA kit

    QY-E10338 96T
    EUR 361

    Rat Cytoglobin (CYGB) ELISA Kit

    SEC426Ra-10x96wellstestplate 10x96-wells test plate
    EUR 5124.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

    Rat Cytoglobin (CYGB) ELISA Kit

    SEC426Ra-1x48wellstestplate 1x48-wells test plate
    EUR 509.64
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

    Rat Cytoglobin (CYGB) ELISA Kit

    SEC426Ra-1x96wellstestplate 1x96-wells test plate
    EUR 685.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

    Rat Cytoglobin (CYGB) ELISA Kit

    SEC426Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2783.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Cytoglobin (CYGB) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Cytoglobin (CYGB) in Tissue homogenates, cell lysates and other biological fluids.

    Rat Cytoglobin (CYGB) ELISA Kit

    4-SEC426Ra
    • EUR 5175.00
    • EUR 2734.00
    • EUR 686.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Cytoglobin elisa. Alternative names of the recognized antigen: HGB
    • STAP
    • Stellate Cell Activation-Associated Protein
    • Histoglobin
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Cytoglobin (CYGB) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Mouse Cytoglobin(CYGB)ELISA kit

    QY-E20446 96T
    EUR 361

    ELISA kit for Human CYGB (Cytoglobin)

    E-EL-H2471 1 plate of 96 wells
    EUR 534
    • Gentaur's CYGB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CYGB. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human CYGB (Cytoglobin) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Human CYGB (Cytoglobin)

    ELK4053 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cytoglobin (CYGB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cytoglobin (CYGB
    • Show more
    Description: A sandwich ELISA kit for detection of Cytoglobin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Cytoglobin (CYGB)

    KTE62175-48T 48T
    EUR 332
    • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Cytoglobin (CYGB)

    KTE62175-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Cytoglobin (CYGB)

    KTE62175-96T 96T
    EUR 539
    • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Cytoglobin (CYGB) Antibody

    20-abx007980
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Cytoglobin (CYGB) Antibody

    20-abx004975
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Cytoglobin (CYGB) Antibody

    20-abx111941
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Cytoglobin (CYGB) Antibody

    20-abx128188
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Cytoglobin (CYGB) Antibody

    20-abx130086
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Cytoglobin (CYGB) Antibody

    20-abx172034
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Cytoglobin (CYGB) Antibody

    20-abx172035
    • EUR 913.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Cytoglobin (CYGB) Antibody

    20-abx320341
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Cytoglobin (CYGB) Antibody

    20-abx301168
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Cytoglobin (CYGB) Protein

    20-abx262892
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.

    Cytoglobin (CYGB) Antibody

    abx232188-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Cytoglobin (CYGB) Antibody

    abx232189-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Recombinant Cytoglobin (CYGB)

    4-RPC426Hu01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q8WWM9
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 25.1kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Cytoglobin expressed in: E.coli

    Recombinant Cytoglobin (CYGB)

    4-RPC426Ra01
    • EUR 519.33
    • EUR 242.00
    • EUR 1672.48
    • EUR 624.16
    • EUR 1148.32
    • EUR 410.00
    • EUR 4031.20
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q921A4
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 25.2kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Rat Cytoglobin expressed in: E.coli

    Human Cytoglobin (CYGB) CLIA Kit

    20-abx493687
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Cytoglobin (CYGB) Protein

    20-abx168146
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    ELISA kit for Mouse CYGB (Cytoglobin)

    E-EL-M1103 1 plate of 96 wells
    EUR 534
    • Gentaur's CYGB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CYGB. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Mouse CYGB (Cytoglobin) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Rat CYGB (Cytoglobin)

    E-EL-R1113 1 plate of 96 wells
    EUR 534
    • Gentaur's CYGB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CYGB. Standards or samples are added to the micro ELISA plate wells and combined with the
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Rat CYGB (Cytoglobin) in samples from Serum, Plasma, Cell supernatant

    Guinea pig Cytoglobin(CYGB) ELISA kit

    E05C2218-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Cytoglobin(CYGB) ELISA kit

    E05C2218-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Cytoglobin(CYGB) ELISA kit

    E05C2218-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Cytoglobin(CYGB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Rat CYGB (Cytoglobin)

    ELK6582 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cytoglobin (CYGB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cytoglobin (CYGB
    • Show more
    Description: A sandwich ELISA kit for detection of Cytoglobin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Rat Cytoglobin (CYGB)

    KTE100808-48T 48T
    EUR 332
    • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Cytoglobin (CYGB)

    KTE100808-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Cytoglobin (CYGB)

    KTE100808-96T 96T
    EUR 539
    • CYGB encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protecti
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Cytoglobin (CYGB)

    KTE71354-48T 48T
    EUR 332
    • Cytoglobin (CYGB) encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involv
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Cytoglobin (CYGB)

    KTE71354-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Cytoglobin (CYGB) encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involv
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Cytoglobin (CYGB)

    KTE71354-96T 96T
    EUR 539
    • Cytoglobin (CYGB) encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involv
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Cytoglobin (CYGB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Cygb ELISA Kit| Rat Cytoglobin ELISA Kit

    EF018543 96 Tests
    EUR 689

    Cygb ELISA Kit| Mouse Cytoglobin ELISA Kit

    EF014614 96 Tests
    EUR 689

    Rat Cytoglobin (CYGB) CLIA Kit

    20-abx493688
    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Anti-Cytoglobin/CYGB Antibody

    A01197 100ug/vial
    EUR 334

    Rat Cytoglobin (CYGB) Protein

    20-abx168526
    • EUR 718.00
    • EUR 286.00
    • EUR 2249.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Cytoglobin (CYGB) Antibody (HRP)

    20-abx303561
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Cytoglobin (CYGB) Antibody (FITC)

    20-abx303562
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Cytoglobin (CYGB) Antibody (Biotin)

    20-abx303563
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Anti-Cytoglobin/CYGB Antibody

    PA1657 100ug/vial
    EUR 294

    Cytoglobin (CYGB) Polyclonal Antibody (Human)

    4-PAC426Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB)

    CYGB Cytoglobin Human Recombinant Protein

    PROTQ8WWM9 Regular: 10ug
    EUR 317
    Description: CYGB Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 210 amino acids (1-190 a.a.) and having a molecular mass of 23.5kDa. ;The CYGB is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

    Recombinant Human Cytoglobin/CYGB (C-6His)

    C124-10ug 10ug
    EUR 156
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0 .

    Recombinant Human Cytoglobin/CYGB (C-6His)

    C124-1mg 1mg
    EUR 2283
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0 .

    Recombinant Human Cytoglobin/CYGB (C-6His)

    C124-500ug 500ug
    EUR 1613
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0 .

    Recombinant Human Cytoglobin/CYGB (C-6His)

    C124-50ug 50ug
    EUR 369
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0 .

    Cytoglobin (CYGB) Polyclonal Antibody (Human), APC

    4-PAC426Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with APC.

    Cytoglobin (CYGB) Polyclonal Antibody (Human), Biotinylated

    4-PAC426Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with Biotin.

    Cytoglobin (CYGB) Polyclonal Antibody (Human), Cy3

    4-PAC426Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with Cy3.

    Cytoglobin (CYGB) Polyclonal Antibody (Human), FITC

    4-PAC426Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with FITC.

    Cytoglobin (CYGB) Polyclonal Antibody (Human), HRP

    4-PAC426Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with HRP.

    Cytoglobin (CYGB) Polyclonal Antibody (Human), PE

    4-PAC426Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with PE.

    Cytoglobin (CYGB) Polyclonal Antibody (Rat)

    4-PAC426Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB)

    Cytoglobin (CYGB) Polyclonal Antibody (Human), APC-Cy7

    4-PAC426Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Cytoglobin (CYGB). This antibody is labeled with APC-Cy7.

    Cytoglobin (CYGB) Polyclonal Antibody (Rat), APC

    4-PAC426Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with APC.

    Cytoglobin (CYGB) Polyclonal Antibody (Rat), Biotinylated

    4-PAC426Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with Biotin.

    Cytoglobin (CYGB) Polyclonal Antibody (Rat), Cy3

    4-PAC426Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with Cy3.

    Cytoglobin (CYGB) Polyclonal Antibody (Rat), FITC

    4-PAC426Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with FITC.

    Cytoglobin (CYGB) Polyclonal Antibody (Rat), HRP

    4-PAC426Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with HRP.

    Cytoglobin (CYGB) Polyclonal Antibody (Rat), PE

    4-PAC426Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with PE.

    Cytoglobin (CYGB) Polyclonal Antibody (Rat), APC-Cy7

    4-PAC426Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CYGB (Met1~Pro190)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cytoglobin (CYGB). This antibody is labeled with APC-Cy7.

    Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-100ug

    QP5901-ec-100ug 100ug
    EUR 408

    Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-10ug

    QP5901-ec-10ug 10ug
    EUR 200

    Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-1mg

    QP5901-ec-1mg 1mg
    EUR 1632

    Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-200ug

    QP5901-ec-200ug 200ug
    EUR 634

    Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-500ug

    QP5901-ec-500ug 500ug
    EUR 1060

    Recombinant Human Cytoglobin/ CYGB Protein, His-SUMO, E.coli-50ug

    QP5901-ec-50ug 50ug
    EUR 263

    Cygb/ Rat Cygb ELISA Kit

    ELI-08925r 96 Tests
    EUR 886

    CYGB ELISA KIT|Human

    EF004826 96 Tests
    EUR 689

    CYGB ELISA Kit (Human) (OKCD00327)

    OKCD00327 96 Wells
    EUR 831
    Description: Description of target: May have a protective function during conditions of oxidative stress. May be involved in intracellular oxygen storage or transfer. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.064 ng/mL

    CYGB ELISA Kit (Human) (OKDD00220)

    OKDD00220 96 Wells
    EUR 975
    Description: Description of target: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.065 ng/mL

    CYGB ELISA Kit (Human) (OKEH08268)

    OKEH08268 96 Wells
    EUR 896
    Description: Description of target: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062ng/mL

    Recombinant Human Cytoglobin

    7-04954 2µg Ask for price

    Recombinant Human Cytoglobin

    7-04955 10µg Ask for price

    Recombinant Human Cytoglobin

    7-04956 1mg Ask for price

    CYGB ELISA Kit (Rat) (OKCD01247)

    OKCD01247 96 Wells
    EUR 896
    Description: Description of target: May have a protective function during conditions of oxidative stress. May be involved in intracellular oxygen storage or transfer. Plays a role in the development of liver fibrosis. Has a peroxidase activity. ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.33 ng/mL

    CYGB ELISA Kit (Mouse) (OKEI00561)

    OKEI00561 96 Wells
    EUR 767
    Description: Description of target: May have a protective function during conditions of oxidative stress. May be involved in intracellular oxygen storage or transfer. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Recombinant Human CYGB

    P0132 100ug
    EUR 522.36
    • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
    • Reconstitution: Sterile distilled water
    • Purity: Greater than 95% by SDS-PAGE gel analyses
    • Uniprot ID: Q8WWM9
    Description: Recombinant Human protein for CYGB

    Cytoglobin antibody

    70R-14194 100 ug
    EUR 322
    Description: Affinity purified Rabbit polyclonal Cytoglobin antibody

    Cytoglobin Antibody

    DF12928 200ul
    EUR 304
    Description: Cytoglobin Antibody detects endogenous levels of Cytoglobin.

    Cytoglobin antibody

    70R-51160 100 ul
    EUR 244
    Description: Purified Polyclonal Cytoglobin antibody

    anti-Cytoglobin

    YF-PA26814 50 ul
    EUR 334
    Description: Mouse polyclonal to Cytoglobin

    CYGB antibody

    70R-16699 50 ul
    EUR 435
    Description: Rabbit polyclonal CYGB antibody

    CYGB antibody

    38960-100ul 100ul
    EUR 252

    CYGB Antibody

    43504-100ul 100ul
    EUR 252

    CYGB Antibody

    1-CSB-PA006376ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    CYGB Antibody

    1-CSB-PA006376GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    CYGB Antibody

    1-CSB-PA006376LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

    CYGB siRNA

    20-abx901371
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CYGB siRNA

    20-abx913332
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CYGB siRNA

    20-abx913333
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Human CYGB shRNA Plasmid

    20-abx964362
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    CYGB Recombinant Protein (Human)

    RP008575 100 ug Ask for price

    Polyclonal Cytoglobin Antibody

    APR05593G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cytoglobin . This antibody is tested and proven to work in the following applications:

    Cytoglobin Blocking Peptide

    DF12928-BP 1mg
    EUR 195

    Cytoglobin Polyclonal Antibody

    ABP58324-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60
    • Applications tips:
    Description: A polyclonal antibody for detection of Cytoglobin from Human, Mouse, Rat. This Cytoglobin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60

    Cytoglobin Polyclonal Antibody

    ABP58324-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60
    • Applications tips:
    Description: A polyclonal antibody for detection of Cytoglobin from Human, Mouse, Rat. This Cytoglobin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60

    Cytoglobin Polyclonal Antibody

    ABP58324-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60
    • Applications tips:
    Description: A polyclonal antibody for detection of Cytoglobin from Human, Mouse, Rat. This Cytoglobin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Cytoglobin protein at amino acid sequence of 1-60

    Cytoglobin Blocking Peptide

    20-abx064035
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    Cytoglobin Polyclonal Antibody

    ES8780-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Cytoglobin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

    Cytoglobin Polyclonal Antibody

    ES8780-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Cytoglobin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

    anti- Cytoglobin antibody

    FNab02188 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:2000
    • IHC: 1:20-1:200
    • Immunogen: cytoglobin
    • Uniprot ID: Q8WWM9
    • Gene ID: 114757
    • Research Area: Cardiovascular
    Description: Antibody raised against Cytoglobin

    anti- Cytoglobin antibody

    FNab02189 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:2000
    • IHC: 1:20-1:200
    • IF: 1:50-1:500
    • Immunogen: cytoglobin
    • Uniprot ID: Q8WWM9
    • Gene ID: 114757
    • Research Area: Cardiovascular
    Description: Antibody raised against Cytoglobin

    anti-Cytoglobin (1A1)

    LF-MA10404 100 ug
    EUR 363
    Description: Mouse monoclonal to Cytoglobin

    Anti-Cytoglobin antibody

    PAab02188 100 ug
    EUR 355

    Anti-Cytoglobin antibody

    STJ98985 200 µl
    EUR 197
    Description: Rabbit polyclonal to Cytoglobin.

    CYGB Rabbit pAb

    A14155-100ul 100 ul
    EUR 308

    CYGB Rabbit pAb

    A14155-200ul 200 ul
    EUR 459

    CYGB Rabbit pAb

    A14155-20ul 20 ul
    EUR 183

    CYGB Rabbit pAb

    A14155-50ul 50 ul
    EUR 223

    CYGB Conjugated Antibody

    C38960 100ul
    EUR 397

    CYGB cloning plasmid

    CSB-CL006376HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 573
    • Sequence: atggagaaagtgccaggcgagatggagatcgagcgcagggagcggagcgaggagctgtccgaggcggagaggaaggcggtgcaggctatgtgggcccggctctatgccagctgcgaggacgtgggggtggccatcctggtgaggttctttgtgaacttcccctcggccaagcagta
    • Show more
    Description: A cloning plasmid for the CYGB gene.

    CYGB Rabbit pAb

    A6488-100ul 100 ul
    EUR 308

    CYGB Rabbit pAb

    A6488-200ul 200 ul
    EUR 459

    CYGB Rabbit pAb

    A6488-20ul 20 ul
    EUR 183

    CYGB Rabbit pAb

    A6488-50ul 50 ul
    EUR 223

    CYGB Polyclonal Antibody

    A50173 100 µg
    EUR 570.55
    Description: The best epigenetics products

    anti- cygb antibody

    FNab10223 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:2000
    • IHC: 1:50-1:500
    • Immunogen: Cytoglobin
    • Uniprot ID: Q8WWM9
    • Gene ID: 114757
    Description: Antibody raised against cygb

    Anti-CYGB antibody

    STJ28571 100 µl
    EUR 277
    Description: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation.

    Anti-CYGB antibody

    STJ116090 100 µl
    EUR 277
    Description: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation.

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    CYGB ORF Vector (Human) (pORF)

    ORF002859 1.0 ug DNA
    EUR 95

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Anti-Cytoglobin (3A5-2D2)

    YF-MA19730 100 ug
    EUR 363
    Description: Mouse monoclonal to Cytoglobin

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    CYGB Antibody, HRP conjugated

    1-CSB-PA006376LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    CYGB Antibody, FITC conjugated

    1-CSB-PA006376LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    CYGB Antibody, Biotin conjugated

    1-CSB-PA006376LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CYGB. Recognizes CYGB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    CYGB protein (His tag)

    80R-1355 50 ug
    EUR 397
    Description: Purified recombinant Human CYGB protein

    Rat CYGB shRNA Plasmid

    20-abx987580
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse CYGB shRNA Plasmid

    20-abx980189
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    pCMV-SPORT6-CYGB Plasmid

    PVT16460 2 ug
    EUR 325

    CYGB Recombinant Protein (Rat)

    RP197009 100 ug Ask for price

    CYGB Recombinant Protein (Mouse)

    RP127019 100 ug Ask for price

    CYGB sgRNA CRISPR Lentivector set (Human)

    K0548201 3 x 1.0 ug
    EUR 339

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    CYGB sgRNA CRISPR Lentivector (Human) (Target 1)

    K0548202 1.0 ug DNA
    EUR 154

    CYGB sgRNA CRISPR Lentivector (Human) (Target 2)

    K0548203 1.0 ug DNA
    EUR 154

    CYGB sgRNA CRISPR Lentivector (Human) (Target 3)

    K0548204 1.0 ug DNA
    EUR 154

    CYGB Protein Vector (Human) (pPB-C-His)

    PV011433 500 ng
    EUR 329

    CYGB Protein Vector (Human) (pPB-N-His)

    PV011434 500 ng
    EUR 329

    CYGB Protein Vector (Human) (pPM-C-HA)

    PV011435 500 ng
    EUR 329

    CYGB Protein Vector (Human) (pPM-C-His)

    PV011436 500 ng
    EUR 329

    CYGB Polyclonal Antibody, HRP Conjugated

    A50174 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    CYGB Polyclonal Antibody, FITC Conjugated

    A50175 100 µg
    EUR 570.55
    Description: fast delivery possible

    CYGB Polyclonal Antibody, Biotin Conjugated

    A50176 100 µg
    EUR 570.55
    Description: reagents widely cited

    Cygb ORF Vector (Rat) (pORF)

    ORF065671 1.0 ug DNA
    EUR 506

    Cygb ORF Vector (Mouse) (pORF)

    ORF042341 1.0 ug DNA
    EUR 506

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    vWF Acty. Kit

    ABP-ACT-KIT 12 x 8 microwells
    EUR 428

    vWF Ant. Kit

    ABP-TOT-KIT 12 x 8 microwells
    EUR 394

    hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

    CAS620A-KIT 1 kit
    EUR 2152
    • Category: Cas9
    Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    Cygb sgRNA CRISPR Lentivector set (Rat)

    K7004001 3 x 1.0 ug
    EUR 339

    Cygb sgRNA CRISPR Lentivector set (Mouse)

    K4370501 3 x 1.0 ug
    EUR 339

    PrecisionX Multiplex gRNA Cloning Kit

    CAS9-GRNA-KIT 10 rxn
    EUR 445
    • Category: Cas9

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    Monoclonal CYGB Antibody (monoclonal) (M02), Clone: 1A1

    AMM03444G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human CYGB (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1A1. This antibody is applicable in WB, IHC and IF, E

    Cygb sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7004002 1.0 ug DNA
    EUR 154

    Cygb sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7004003 1.0 ug DNA
    EUR 154

    Cygb sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7004004 1.0 ug DNA
    EUR 154

    Cygb sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4370502 1.0 ug DNA
    EUR 154

    Cygb sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4370503 1.0 ug DNA
    EUR 154

    Cygb sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4370504 1.0 ug DNA
    EUR 154

    CYGB Protein Vector (Mouse) (pPB-C-His)

    PV169362 500 ng
    EUR 603

    CYGB Protein Vector (Mouse) (pPB-N-His)

    PV169363 500 ng
    EUR 603

    CYGB Protein Vector (Mouse) (pPM-C-HA)

    PV169364 500 ng
    EUR 603

    CYGB Protein Vector (Mouse) (pPM-C-His)

    PV169365 500 ng
    EUR 603

    CYGB Protein Vector (Rat) (pPB-C-His)

    PV262682 500 ng
    EUR 603

    CYGB Protein Vector (Rat) (pPB-N-His)

    PV262683 500 ng
    EUR 603

    CYGB Protein Vector (Rat) (pPM-C-HA)

    PV262684 500 ng
    EUR 603

    Human CYGB(Cytoglobin) ELISA Kit