Human REPIN1(Replication Initiator 1) ELISA Kit

Human REPIN1(Replication Initiator 1) ELISA Kit

To Order Contact us below: 

Human Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Hu-48Tests 48 Tests
EUR 521
Human Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Hu-96Tests 96 Tests
EUR 723
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
EUR 527
  • Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
EUR 688
  • Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Mu-48Tests 48 Tests
EUR 557
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Mu-96Tests 96 Tests
EUR 774
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Mu-48Tests 48 Tests
EUR 533
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Mu-96Tests 96 Tests
EUR 740
Human Replication Initiator 1 (REPIN1)ELISA Kit
201-12-2402 96 tests
EUR 440
  • This Replication Initiator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Replication Initiator 1 (REPIN1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Replication Initiator 1 (REPIN1) ELISA Kit
abx253102-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human REPIN1(Replication Initiator 1) ELISA Kit
EH3712 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9BWE0
  • Alias: REPIN1/Zinc finger protein 464/DHFR oribeta-binding protein RIP60/ATT-binding protein/60 kDa origin-specific DNA-binding protein/60 kDa replication initiation region protein/RIP60/ZNF464
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Replication initiator 1, REPIN1 ELISA KIT
ELI-14616h 96 Tests
EUR 824
Human Replication Initiator 1(REPIN1)ELISA Kit
QY-E03529 96T
EUR 361
Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
Human Replication Initiator 1 (REPIN1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
  • RIP60
  • ZNF464
  • Zfp464
  • Replication Initiation Region Protein(60kD)
  • Zinc Finger Protein 464
  • 60 kDa origin-specific DNA-binding protein
  • ATT-binding protei
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Replication Initiator 1 (REPIN1) Antibody
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Replication Initiator 1 (REPIN1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Replication Initiator 1 (REPIN1) Antibody
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Replication Initiator 1 (REPIN1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Replication Initiator 1 (REPIN1)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BWE0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Replication Initiator 1 expressed in: E.coli
Recombinant Replication Initiator 1 (REPIN1)
  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5U4E2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Replication Initiator 1 expressed in: E.coli
Human Replication Initiator 1 (REPIN1) Protein
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Bovine Replication initiator 1, REPIN1 ELISA KIT
ELI-52607b 96 Tests
EUR 928
Mouse Replication initiator 1, Repin1 ELISA KIT
ELI-44355m 96 Tests
EUR 865
Rat Replication Initiator 1 (REPIN1) ELISA Kit
abx391903-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Replication Initiator 1(REPIN1)ELISA Kit
QY-E10499 96T
EUR 361
Mouse Replication Initiator 1(REPIN1)ELISA Kit
QY-E21317 96T
EUR 361
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
Mouse Replication Initiator 1 (REPIN1) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
  • RIP60
  • ZNF464
  • Zfp464
  • Replication Initiation Region Protein(60kD)
  • Zinc Finger Protein 464
  • 60 kDa origin-specific DNA-binding protein
  • ATT-binding protei
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Replication Initiator 1 (REPIN1) CLIA Kit
abx195148-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Replication Initiator 1 (REPIN1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human REPIN1 (Replication Initiator 1)
E-EL-H1760 1 plate of 96 wells
EUR 534
  • Gentaur's REPIN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human REPIN1 (Replication Initiator 1)
ELK3776 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
  • Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-48T 48T
EUR 332
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-96T 96T
EUR 539
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Replication Initiator 1 (REPIN1) Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Replication Initiator 1 (REPIN1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Mouse REPIN1 (Replication Initiator 1)
ELK6478 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
  • Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-48T 48T
EUR 332
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-96T 96T
EUR 539
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1)
CLIA kit for Human REPIN1 (Replication Initiator 1)
E-CL-H1102 1 plate of 96 wells
EUR 584
  • Gentaur's REPIN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1 . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant
Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit
EF019263 96 Tests
EUR 689
Repin1 ELISA Kit| Mouse Replication initiator 1 ELISA Kit
EF016079 96 Tests
EUR 689
REPIN1 ELISA Kit| Bovine Replication initiator 1 ELISA Kit
EF011851 96 Tests
EUR 689
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1)
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with PE.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with PE.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.
Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.
Recombinant human Replication initiator 1
P2526 100ug Ask for price
  • Uniprot ID: Q9BWE0
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Replication initiator 1
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Repin1/ Rat Repin1 ELISA Kit
ELI-19261r 96 Tests
EUR 886
EF007143 96 Tests
EUR 689
REPIN1 ELISA Kit (Human) (OKCD01920)
OKCD01920 96 Wells
EUR 831
Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL
REPIN1 ELISA Kit (Mouse) (OKCD01001)
OKCD01001 96 Wells
EUR 857
Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.135 ng/mL
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PVT18357 2 ug
EUR 231
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Human Replication Factor C Subunit 1 (RFC1) ELISA Kit
abx257525-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.
Human Replication factor C subunit 1, RFC1 ELISA KIT
ELI-21926h 96 Tests
EUR 824
Human REPIN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
REPIN1 Recombinant Protein (Human)
RP026188 100 ug Ask for price
REPIN1 Recombinant Protein (Human)
RP026191 100 ug Ask for price
Human Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Hu-48T 48T
EUR 517
  • Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.
Human Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Hu-96T 96T
EUR 673
  • Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.
Human Replication Protein A1 (RPA1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Replication Protein A2 (RPA2) ELISA Kit
abx382883-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Replication Protein A3 (RPA3) ELISA Kit
abx382884-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Replication Protein A1 (RPA1) ELISA Kit
abx573009-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Human Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Hu-48Tests 48 Tests
EUR 544
Human Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Hu-96Tests 96 Tests
EUR 756
Human Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Hu-48Tests 48 Tests
EUR 521
Human Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Hu-96Tests 96 Tests
EUR 723
Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.
Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.
Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.
Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.
Human Replication Protein A1 (RPA1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
  • REPA1
  • RF-A
  • RP-A
  • RPA70
  • Replication protein A 70 kDa DNA-binding subunit
  • Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Protein A1 (RPA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
REPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1809002 1.0 ug DNA
EUR 154
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Replication Protein A2 (RPA2) ELISA Kit
abx595526-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
REPIN1 cloning plasmid
CSB-CL019564HU1-10ug 10ug
EUR 587
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
  • Show more
Description: A cloning plasmid for the REPIN1 gene.
REPIN1 cloning plasmid
CSB-CL019564HU2-10ug 10ug
EUR 587
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
  • Show more
Description: A cloning plasmid for the REPIN1 gene.
REPIN1 Rabbit pAb
A18451-100ul 100 ul
EUR 308
REPIN1 Rabbit pAb
A18451-200ul 200 ul
EUR 459
REPIN1 Rabbit pAb
A18451-20ul 20 ul
EUR 183
REPIN1 Rabbit pAb
A18451-50ul 50 ul
EUR 223
PVT18946 2 ug
EUR 231
Anti-REPIN1 antibody
STJ11100405 100 µl
EUR 277
Mouse Replication factor C subunit 1, Rfc1 ELISA KIT
ELI-14393m 96 Tests
EUR 865
Human replication protein A,RPA-70 ELISA Kit
201-12-1914 96 tests
EUR 440
  • This replication protein A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
ELISA kit for Human RPA1 (Replication protein A1)
E-EL-H1282 1 plate of 96 wells
EUR 534
  • Gentaur's RPA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RPA1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RPA1 (Replication protein A1) in samples from Serum, Plasma, Cell supernatant
Human CDT1/ DNA replication factor Cdt1 ELISA Kit
E0465Hu 1 Kit
EUR 605
Human DNA replication licensing factor MCM3 ELISA kit
E01D0531-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DNA replication licensing factor MCM3 ELISA kit
E01D0531-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DNA replication licensing factor MCM3 ELISA kit
E01D0531-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DNA Replication Factor CDT1 (CDT1) ELISA Kit
abx250847-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
ELISA kit for Human DNA replication factor Cdt1
EK3329 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human DNA replication factor Cdt1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human CDT1(DNA replication factor Cdt1) ELISA Kit
EH1559 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q9H211
  • Alias: CDT1/DNA replication factor Cdt1/Double parked homolog/DUP/RIS2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 pg/ml
ELISA kit for Human RPA1 (Replication Protein A1)
ELK4413 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Protein A1 (RPA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Repl
  • Show more
Description: A sandwich ELISA kit for detection of Replication Protein A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human replication protein A,RPA-70 ELISA Kit
CN-04330H1 96T
EUR 449
Human replication protein A,RPA-70 ELISA Kit
CN-04330H2 48T
EUR 299
Human replication protein A(RPA-70)ELISA Kit
GA-E1930HM-48T 48T
EUR 289
Human replication protein A(RPA-70)ELISA Kit
GA-E1930HM-96T 96T
EUR 466
Human DNA replication factor Cdt1, CDT1 ELISA KIT
ELI-49924h 96 Tests
EUR 824
Human replication protein A(RPA-70)ELISA Kit
QY-E03530 96T
EUR 361
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
REPIN1 ORF Vector (Human) (pORF)
ORF008730 1.0 ug DNA
EUR 95
REPIN1 ORF Vector (Human) (pORF)
ORF008731 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1 96 Well Plate
EUR 477
Human Complexin-1 AssayMax ELISA Kit
EC3505-1 96 Well Plate
EUR 417
Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1 96 Well Plate
EUR 417
Human SPO11, Initiator Of Meiotic Double Stranded Breaks (SPO11) ELISA Kit
abx383424-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Human Replication factor C subunit 1 (RFC1)
  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Replication factor C subunit 1(RFC1),partial expressed in E.coli
Human Replication factor C subunit 1 (RFC1)
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Replication factor C subunit 1(RFC1),partial expressed in Yeast
Human Replication factor C subunit 1 (RFC1)
  • EUR 761.00
  • EUR 306.00
  • EUR 1951.00
  • EUR 1026.00
  • EUR 1422.00
  • EUR 431.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 13.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Replication factor C subunit 1(RFC1), partial expressed in Baculovirus
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Rat Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Ra-48T 48T
EUR 549
  • Should the Rat Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Replication Protein A1 (RPA1) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Ra-96T 96T
EUR 718
  • Should the Rat Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Replication Protein A1 (RPA1) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Replication Protein A1 (RPA1) ELISA Kit
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Pig Replication Protein A1 (RPA1) ELISA Kit
abx360874-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Replication Protein A1 (RPA1) ELISA Kit
abx358961-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Replication Protein A1 (RPA1) ELISA Kit
abx355854-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Replication Protein A1 (RPA1) ELISA Kit
abx363576-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Ra-48Tests 48 Tests
EUR 583
Rat Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Ra-96Tests 96 Tests
EUR 811
Rat Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Ra-48Tests 48 Tests
EUR 557
Rat Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Ra-96Tests 96 Tests
EUR 775
Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.
Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.
Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.
Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.
Rat Replication Protein A1 (RPA1) ELISA Kit
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
  • REPA1
  • RF-A
  • RP-A
  • RPA70
  • Replication protein A 70 kDa DNA-binding subunit
  • Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Replication Protein A1 (RPA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Human DNA replication licensing factor MCM6(MCM6) ELISA kit
CSB-EL013596HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human DNA replication licensing factor MCM6 (MCM6) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human DNA replication licensing factor MCM6(MCM6) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human DNA replication licensing factor MCM6(MCM6) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human DNA replication licensing factor MCM7(MCM7) ELISA kit
CSB-EL013597HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human DNA replication licensing factor MCM7 (MCM7) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human DNA replication licensing factor MCM7(MCM7) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human DNA replication licensing factor MCM7(MCM7) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Replication factor C subunit 2(RFC2) ELISA kit
E01R0404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Replication factor C subunit 2(RFC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Replication factor C subunit 2(RFC2) ELISA kit
E01R0404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Replication factor C subunit 2(RFC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Replication factor C subunit 2(RFC2) ELISA kit
E01R0404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Replication factor C subunit 2(RFC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human MCM2/ DNA replication licensing factor MCM2 ELISA Kit
E2801Hu 1 Kit
EUR 571
Human MCM2(DNA replication licensing factor MCM2) ELISA Kit
EH1922 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P49736
  • Alias: MCM2/DNA replication licensing factor MCM2/BM28/CCNL1/cdc19/CDCL1/Mitotin/CCNL 1/CDCL1mitotin/MCM2 minichromosome maintenance deficient 2, mitotin/minichromosome maintenance complex component 2
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human Replication factor C subunit 4, RFC4 ELISA KIT
ELI-14394h 96 Tests
EUR 824
Human Replication factor C subunit 3, RFC3 ELISA KIT
ELI-14556h 96 Tests
EUR 824
Human DNA replication licensing factor MCM7, MCM7 ELISA KIT
ELI-15741h 96 Tests
EUR 824
Human DNA replication licensing factor MCM9, MCM9 ELISA KIT
ELI-16345h 96 Tests
EUR 824
Human DNA replication licensing factor MCM4, MCM4 ELISA KIT
ELI-19580h 96 Tests
EUR 824
Human DNA replication licensing factor MCM3, MCM3 ELISA KIT
ELI-20538h 96 Tests
EUR 824
Human DNA replication licensing factor MCM8, MCM8 ELISA KIT
ELI-20539h 96 Tests
EUR 824
Human DNA replication licensing factor MCM2, MCM2 ELISA KIT
ELI-05736h 96 Tests
EUR 824
Human Replication factor C subunit 2, RFC2 ELISA KIT
ELI-52643h 96 Tests
EUR 824
Human Replication factor C subunit 5, RFC5 ELISA KIT
ELI-44328h 96 Tests
EUR 824
Human Replication Factor C Subunit 2 (RFC2) ELISA Kit
abx382774-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Replication Factor C Subunit 3 (RFC3) ELISA Kit
abx382775-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Replication Factor C Subunit 4 (RFC4) ELISA Kit
abx382776-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Replication Factor C Subunit 5 (RFC5) ELISA Kit
abx382777-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human DNA replication licensing factor MCM6, MCM6 ELISA KIT
ELI-48196h 96 Tests
EUR 824
Human DNA replication licensing factor MCM5, MCM5 ELISA KIT
ELI-37315h 96 Tests
EUR 824
Human TOPBP1 Interacting Replication Stimulating Protein(Treslin)ELISA Kit
QY-E04524 96T
EUR 394
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit
EL3502-1 96 Well Plate
EUR 477
Human TGF-beta-1 AssayMax ELISA Kit
ET3102-1 96 Well Plate
EUR 477
Human PAI-1/tPA AssayMax ELISA Kit
EP1105-1 96 Well Plate
EUR 417
Rat REPIN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse REPIN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
REPIN1 Recombinant Protein (Mouse)
RP167606 100 ug Ask for price
REPIN1 Recombinant Protein (Mouse)
RP167609 100 ug Ask for price
REPIN1 Recombinant Protein (Mouse)
RP167612 100 ug Ask for price
REPIN1 Recombinant Protein (Mouse)
RP167615 100 ug Ask for price
REPIN1 Recombinant Protein (Mouse)
RP167618 100 ug Ask for price
REPIN1 Recombinant Protein (Mouse)
RP167621 100 ug Ask for price
REPIN1 Recombinant Protein (Rat)
RP224087 100 ug Ask for price
Repin1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6690502 1.0 ug DNA
EUR 154
Repin1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3922202 1.0 ug DNA
EUR 154
REPIN1 sgRNA CRISPR Lentivector set (Human)
K1809001 3 x 1.0 ug
EUR 339
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Human Replication Protein A1 (RPA1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1 96 Well Plate
EUR 477
Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EI2200-1 96 Well Plate
EUR 477
Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit
EI2301-1 96 Well Plate
EUR 477
Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit
EP1100-1 96 Well Plate
EUR 417
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit
EC5752-1 96 Well Plate
EUR 477
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5001-1 96 Well Plate
EUR 417
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5101-1 96 Well Plate
EUR 417
Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit
EA5501-1 96 Well Plate
EUR 417
Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit
EE2702-1 96 Well Plate
EUR 477
Human Glutathione Transferase zeta 1 AssayMax ELISA Kit
EG2350-1 96 Well Plate
EUR 477
Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit
EG3928-1 96 Well Plate
EUR 477
Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit
EM5110-1 96 Well Plate
EUR 396
Cdt1 ELISA Kit| Mouse DNA replication factor Cdt1 ELISA Kit
EF014493 96 Tests
EUR 689
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human REPIN1(Replication Initiator 1) ELISA Kit