Human REPIN1(Replication Initiator 1) ELISA Kit

Human REPIN1(Replication Initiator 1) ELISA Kit

To Order Contact us below: 

Human Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
DLR-REPIN1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
DLR-REPIN1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Replication Initiator 1 (REPIN1)ELISA Kit
201-12-2402	SunredBio	96 tests	EUR 440
This Replication Initiator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
20-abx152951	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Replication Initiator 1 (REPIN1) ELISA Kit
abx253102-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human REPIN1(Replication Initiator 1) ELISA Kit
EH3712	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q9BWE0 Alias: REPIN1/Zinc finger protein 464/DHFR oribeta-binding protein RIP60/ATT-binding protein/60 kDa origin-specific DNA-binding protein/60 kDa replication initiation region protein/RIP60/ZNF464
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Replication initiator 1, REPIN1 ELISA KIT
ELI-14616h	Lifescience Market	96 Tests	EUR 824

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
4-SEG516Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4 RIP60 ZNF464 Zfp464 Replication Initiation Region Protein(60kD) Zinc Finger Protein 464 60 kDa origin-specific DNA-binding protein ATT-binding protei Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Replication Initiator 1(REPIN1)ELISA Kit
QY-E03529	Qayee Biotechnology	96T	EUR 361

Replication Initiator 1 (REPIN1) Antibody
20-abx178249	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Replication Initiator 1 (REPIN1) Antibody
20-abx129189	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Antibody
20-abx129904	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Antibody
20-abx174377	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Replication Initiator 1 (REPIN1)
4-RPG516Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9BWE0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Replication Initiator 1 expressed in: E.coli

Recombinant Replication Initiator 1 (REPIN1)
4-RPG516Mu01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5U4E2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.6kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Replication Initiator 1 expressed in: E.coli

Human Replication Initiator 1 (REPIN1) Protein
20-abx168192	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
20-abx154614	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Bovine Replication initiator 1, REPIN1 ELISA KIT
ELI-52607b	Lifescience Market	96 Tests	EUR 928

Mouse Replication initiator 1, Repin1 ELISA KIT
ELI-44355m	Lifescience Market	96 Tests	EUR 865

Rat Replication Initiator 1 (REPIN1) ELISA Kit
abx391903-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
4-SEG516Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4 RIP60 ZNF464 Zfp464 Replication Initiation Region Protein(60kD) Zinc Finger Protein 464 60 kDa origin-specific DNA-binding protein ATT-binding protei Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Replication Initiator 1(REPIN1)ELISA Kit
QY-E10499	Qayee Biotechnology	96T	EUR 361

Mouse Replication Initiator 1(REPIN1)ELISA Kit
QY-E21317	Qayee Biotechnology	96T	EUR 361

Human Replication Initiator 1 (REPIN1) CLIA Kit
abx195148-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Replication Initiator 1 (REPIN1) CLIA Kit
20-abx495229	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human REPIN1 (Replication Initiator 1)
E-EL-H1760	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's REPIN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human REPIN1 (Replication Initiator 1)
ELK3776	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-48T	Abbkine	48T	EUR 332
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-96T	Abbkine	96T	EUR 539
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) Protein
20-abx168411	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Replication Initiator 1 (REPIN1) CLIA Kit
20-abx495230	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human)
4-PAG516Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1)

ELISA kit for Mouse REPIN1 (Replication Initiator 1)
ELK6478	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-48T	Abbkine	48T	EUR 332
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-96T	Abbkine	96T	EUR 539
Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human REPIN1 (Replication Initiator 1)
E-CL-H1102	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's REPIN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1 . Standards or samples are added to the micro CLIA plate wells and combined with Show more
Description: A sandwich CLIA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant

Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit
EF019263	Lifescience Market	96 Tests	EUR 689

Repin1 ELISA Kit| Mouse Replication initiator 1 ELISA Kit
EF016079	Lifescience Market	96 Tests	EUR 689

REPIN1 ELISA Kit| Bovine Replication initiator 1 ELISA Kit
EF011851	Lifescience Market	96 Tests	EUR 689

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse)
4-PAG516Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1)

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC
4-PAG516Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Biotinylated
4-PAG516Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Cy3
4-PAG516Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), FITC
4-PAG516Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), HRP
4-PAG516Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), PE
4-PAG516Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with PE.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC
4-PAG516Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Biotinylated
4-PAG516Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Cy3
4-PAG516Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), FITC
4-PAG516Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), HRP
4-PAG516Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), PE
4-PAG516Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with PE.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC-Cy7
4-PAG516Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (His57~His314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG516Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: REPIN1 (Pro30~Pro298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.

Recombinant human Replication initiator 1
P2526	FN Test	100ug	Ask for price
Uniprot ID: Q9BWE0 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Replication initiator 1

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Repin1/ Rat Repin1 ELISA Kit
ELI-19261r	Lifescience Market	96 Tests	EUR 886

REPIN1 ELISA KIT|Human
EF007143	Lifescience Market	96 Tests	EUR 689

REPIN1 ELISA Kit (Human) (OKCD01920)
OKCD01920	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL

REPIN1 ELISA Kit (Mouse) (OKCD01001)
OKCD01001	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.135 ng/mL

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

REPIN1 siRNA
20-abx904532	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

REPIN1 siRNA
20-abx931266	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

REPIN1 siRNA
20-abx931267	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-REPIN1
PVT18357	Lifescience Market	2 ug	EUR 231

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human REPIN1 shRNA Plasmid
20-abx959235	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

REPIN1 Recombinant Protein (Human)
RP026188	ABM	100 ug	Ask for price

REPIN1 Recombinant Protein (Human)
RP026191	ABM	100 ug	Ask for price

Human Replication Factor C Subunit 1 (RFC1) ELISA Kit
abx257525-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Replication factor C subunit 1, RFC1 ELISA KIT
ELI-21926h	Lifescience Market	96 Tests	EUR 824

REPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1809002	ABM	1.0 ug DNA	EUR 154

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

REPIN1 cloning plasmid
CSB-CL019564HU1-10ug	Cusabio	10ug	EUR 587
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1704 Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct Show more
Description: A cloning plasmid for the REPIN1 gene.

Human REPIN1(Replication Initiator 1) ELISA Kit