Human REPIN1(Replication Initiator 1) ELISA Kit

Human REPIN1(Replication Initiator 1) ELISA Kit

To Order Contact us below: 

    Human Replication Initiator 1 (REPIN1) ELISA Kit
    RD-REPIN1-Hu-48Tests 48 Tests
    EUR 521
    Human Replication Initiator 1 (REPIN1) ELISA Kit
    RD-REPIN1-Hu-96Tests 96 Tests
    EUR 723
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    DLR-REPIN1-Mu-48T 48T
    EUR 527
    • Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    DLR-REPIN1-Mu-96T 96T
    EUR 688
    • Should the Mouse Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Replication Initiator 1 (REPIN1) in samples from tissue homogenates or other biological fluids.
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    RDR-REPIN1-Mu-48Tests 48 Tests
    EUR 557
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    RDR-REPIN1-Mu-96Tests 96 Tests
    EUR 774
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    RD-REPIN1-Mu-48Tests 48 Tests
    EUR 533
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    RD-REPIN1-Mu-96Tests 96 Tests
    EUR 740
    Human Replication Initiator 1 (REPIN1)ELISA Kit
    201-12-2402 96 tests
    EUR 440
    • This Replication Initiator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Replication Initiator 1 (REPIN1) ELISA Kit
    20-abx152951
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Replication Initiator 1 (REPIN1) ELISA Kit
    abx253102-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human REPIN1(Replication Initiator 1) ELISA Kit
    EH3712 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q9BWE0
    • Alias: REPIN1/Zinc finger protein 464/DHFR oribeta-binding protein RIP60/ATT-binding protein/60 kDa origin-specific DNA-binding protein/60 kDa replication initiation region protein/RIP60/ZNF464
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
    Human Replication initiator 1, REPIN1 ELISA KIT
    ELI-14616h 96 Tests
    EUR 824
    Human Replication Initiator 1 (REPIN1) ELISA Kit
    SEG516Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
    Human Replication Initiator 1 (REPIN1) ELISA Kit
    SEG516Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
    Human Replication Initiator 1 (REPIN1) ELISA Kit
    SEG516Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
    Human Replication Initiator 1 (REPIN1) ELISA Kit
    SEG516Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
    Human Replication Initiator 1 (REPIN1) ELISA Kit
    4-SEG516Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
    • RIP60
    • ZNF464
    • Zfp464
    • Replication Initiation Region Protein(60kD)
    • Zinc Finger Protein 464
    • 60 kDa origin-specific DNA-binding protein
    • ATT-binding protei
    • Show more
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human Replication Initiator 1(REPIN1)ELISA Kit
    QY-E03529 96T
    EUR 361
    Replication Initiator 1 (REPIN1) Antibody
    20-abx178249
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Replication Initiator 1 (REPIN1) Antibody
    20-abx129189
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Replication Initiator 1 (REPIN1) Antibody
    20-abx129904
    • EUR 314.00
    • EUR 133.00
    • EUR 829.00
    • EUR 439.00
    • EUR 272.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Replication Initiator 1 (REPIN1) Antibody
    20-abx174377
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Recombinant Replication Initiator 1 (REPIN1)
    4-RPG516Hu01
    • EUR 485.28
    • EUR 233.00
    • EUR 1544.80
    • EUR 581.60
    • EUR 1063.20
    • EUR 388.00
    • EUR 3712.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9BWE0
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 33.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Replication Initiator 1 expressed in: E.coli
    Recombinant Replication Initiator 1 (REPIN1)
    4-RPG516Mu01
    • EUR 501.41
    • EUR 237.00
    • EUR 1605.28
    • EUR 601.76
    • EUR 1103.52
    • EUR 398.00
    • EUR 3863.20
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q5U4E2
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 34.6kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Mouse Replication Initiator 1 expressed in: E.coli
    Human Replication Initiator 1 (REPIN1) Protein
    20-abx168192
    • EUR 676.00
    • EUR 286.00
    • EUR 2082.00
    • EUR 801.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    20-abx154614
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Bovine Replication initiator 1, REPIN1 ELISA KIT
    ELI-52607b 96 Tests
    EUR 928
    Mouse Replication initiator 1, Repin1 ELISA KIT
    ELI-44355m 96 Tests
    EUR 865
    Rat Replication Initiator 1 (REPIN1) ELISA Kit
    abx391903-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    SEG516Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4862.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    SEG516Mu-1x48wellstestplate 1x48-wells test plate
    EUR 488.08
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    SEG516Mu-1x96wellstestplate 1x96-wells test plate
    EUR 654.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    SEG516Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2644.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.
    Mouse Replication Initiator 1 (REPIN1) ELISA Kit
    4-SEG516Mu
    • EUR 4913.00
    • EUR 2595.00
    • EUR 655.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
    • RIP60
    • ZNF464
    • Zfp464
    • Replication Initiation Region Protein(60kD)
    • Zinc Finger Protein 464
    • 60 kDa origin-specific DNA-binding protein
    • ATT-binding protei
    • Show more
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Rat Replication Initiator 1(REPIN1)ELISA Kit
    QY-E10499 96T
    EUR 361
    Mouse Replication Initiator 1(REPIN1)ELISA Kit
    QY-E21317 96T
    EUR 361
    Human Replication Initiator 1 (REPIN1) CLIA Kit
    abx195148-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Human Replication Initiator 1 (REPIN1) CLIA Kit
    20-abx495229
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human REPIN1 (Replication Initiator 1)
    E-EL-H1760 1 plate of 96 wells
    EUR 534
    • Gentaur's REPIN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1. Standards or samples are added to the micro ELISA plate wells and combined wit
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant
    ELISA kit for Human REPIN1 (Replication Initiator 1)
    ELK3776 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
    • Show more
    Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Replication initiator 1 (REPIN1)
    KTE60806-48T 48T
    EUR 332
    • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Replication initiator 1 (REPIN1)
    KTE60806-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Replication initiator 1 (REPIN1)
    KTE60806-96T 96T
    EUR 539
    • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Mouse Replication Initiator 1 (REPIN1) Protein
    20-abx168411
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Mouse Replication Initiator 1 (REPIN1) CLIA Kit
    20-abx495230
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human)
    4-PAG516Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (His57~His314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1)
    ELISA kit for Mouse REPIN1 (Replication Initiator 1)
    ELK6478 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
    • Show more
    Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Mouse Replication initiator 1 (REPIN1)
    KTE70507-48T 48T
    EUR 332
    • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Replication initiator 1 (REPIN1)
    KTE70507-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Replication initiator 1 (REPIN1)
    KTE70507-96T 96T
    EUR 539
    • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    CLIA kit for Human REPIN1 (Replication Initiator 1)
    E-CL-H1102 1 plate of 96 wells
    EUR 584
    • Gentaur's REPIN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1 . Standards or samples are added to the micro CLIA plate wells and combined with
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant
    Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit
    EF019263 96 Tests
    EUR 689
    Repin1 ELISA Kit| Mouse Replication initiator 1 ELISA Kit
    EF016079 96 Tests
    EUR 689
    REPIN1 ELISA Kit| Bovine Replication initiator 1 ELISA Kit
    EF011851 96 Tests
    EUR 689
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse)
    4-PAG516Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1)
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC
    4-PAG516Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (His57~His314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Biotinylated
    4-PAG516Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (His57~His314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Cy3
    4-PAG516Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (His57~His314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), FITC
    4-PAG516Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (His57~His314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), HRP
    4-PAG516Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (His57~His314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), PE
    4-PAG516Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (His57~His314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with PE.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC
    4-PAG516Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Biotinylated
    4-PAG516Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Cy3
    4-PAG516Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), FITC
    4-PAG516Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), HRP
    4-PAG516Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), PE
    4-PAG516Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with PE.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC-Cy7
    4-PAG516Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (His57~His314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.
    Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC-Cy7
    4-PAG516Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.
    Recombinant human Replication initiator 1
    P2526 100ug Ask for price
    • Uniprot ID: Q9BWE0
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human Replication initiator 1
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Repin1/ Rat Repin1 ELISA Kit
    ELI-19261r 96 Tests
    EUR 886
    REPIN1 ELISA KIT|Human
    EF007143 96 Tests
    EUR 689
    REPIN1 ELISA Kit (Human) (OKCD01920)
    OKCD01920 96 Wells
    EUR 831
    Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL
    REPIN1 ELISA Kit (Mouse) (OKCD01001)
    OKCD01001 96 Wells
    EUR 857
    Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.135 ng/mL
    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes
    mRNAExpress mRNA Synthesis kit (5 reactions)
    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products
    REPIN1 siRNA
    20-abx904532
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    REPIN1 siRNA
    20-abx931266
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    REPIN1 siRNA
    20-abx931267
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    pOTB7-REPIN1
    PVT18357 2 ug
    EUR 231
    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    Human REPIN1 shRNA Plasmid
    20-abx959235
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    REPIN1 Recombinant Protein (Human)
    RP026188 100 ug Ask for price
    REPIN1 Recombinant Protein (Human)
    RP026191 100 ug Ask for price
    Human Replication Factor C Subunit 1 (RFC1) ELISA Kit
    abx257525-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.
    Human Replication factor C subunit 1, RFC1 ELISA KIT
    ELI-21926h 96 Tests
    EUR 824
    REPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1809002 1.0 ug DNA
    EUR 154
    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    REPIN1 cloning plasmid
    CSB-CL019564HU1-10ug 10ug
    EUR 587
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1704
    • Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
    • Show more
    Description: A cloning plasmid for the REPIN1 gene.

    Human REPIN1(Replication Initiator 1) ELISA Kit