Human FUS(Fusion) ELISA Kit

Human FUS(Fusion) ELISA Kit

To Order Contact us below: 

    Human Fusion (FUS) ELISA Kit

    RDR-FUS-Hu-48Tests 48 Tests
    EUR 544

    Human Fusion (FUS) ELISA Kit

    RDR-FUS-Hu-96Tests 96 Tests
    EUR 756

    Mouse Fusion (FUS) ELISA Kit

    DLR-FUS-Mu-48T 48T
    EUR 527
    • Should the Mouse Fusion (FUS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fusion (FUS) in samples from tissue homogenates or other biological fluids.

    Mouse Fusion (FUS) ELISA Kit

    DLR-FUS-Mu-96T 96T
    EUR 688
    • Should the Mouse Fusion (FUS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fusion (FUS) in samples from tissue homogenates or other biological fluids.

    Mouse Fusion (FUS) ELISA Kit

    RD-FUS-Mu-48Tests 48 Tests
    EUR 533

    Mouse Fusion (FUS) ELISA Kit

    RD-FUS-Mu-96Tests 96 Tests
    EUR 740

    Mouse Fusion (FUS) ELISA Kit

    RDR-FUS-Mu-48Tests 48 Tests
    EUR 557

    Mouse Fusion (FUS) ELISA Kit

    RDR-FUS-Mu-96Tests 96 Tests
    EUR 774

    Human Fusion (FUS) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Fusion (FUS) ELISA Kit

    SEC260Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

    Human Fusion (FUS) ELISA Kit

    SEC260Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

    Human Fusion (FUS) ELISA Kit

    SEC260Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

    Human Fusion (FUS) ELISA Kit

    SEC260Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

    Human Fusion (FUS) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Fusion elisa. Alternative names of the recognized antigen: CHOP
    • ALS6
    • TLS
    • hnRNP-P2
    • Amyotrophic Lateral Sclerosis 6
    • Heterogeneous Nuclear Ribonucleoprotein P2
    • 75 kDa DNA-pairing protein
    • Translocated in liposarcoma protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fusion (FUS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Fusion ELISA Kit (FUS)

    RK01425 96 Tests
    EUR 521

    Human Fusion(FUS)ELISA Kit

    QY-E01737 96T
    EUR 361

    Mouse Fusion (FUS) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Fusion (FUS) ELISA Kit

    SEC260Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4862.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

    Mouse Fusion (FUS) ELISA Kit

    SEC260Mu-1x48wellstestplate 1x48-wells test plate
    EUR 488.08
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

    Mouse Fusion (FUS) ELISA Kit

    SEC260Mu-1x96wellstestplate 1x96-wells test plate
    EUR 654.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

    Mouse Fusion (FUS) ELISA Kit

    SEC260Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2644.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

    Mouse Fusion (FUS) ELISA Kit

    • EUR 4913.00
    • EUR 2595.00
    • EUR 655.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Fusion elisa. Alternative names of the recognized antigen: CHOP
    • ALS6
    • TLS
    • hnRNP-P2
    • Amyotrophic Lateral Sclerosis 6
    • Heterogeneous Nuclear Ribonucleoprotein P2
    • 75 kDa DNA-pairing protein
    • Translocated in liposarcoma protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Fusion (FUS) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    ELISA kit for Human FUS (Fusion)

    ELK4043 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fusion (FUS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fusion (FUS). Next, A
    • Show more
    Description: A sandwich ELISA kit for detection of Fusion from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Fusion (FUS) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Fusion (FUS) Antibody

    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Fusion (FUS) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fusion (FUS) Antibody

    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Fusion (FUS) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Fusion (FUS) Antibody

    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Fusion (FUS) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Fusion (FUS) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Recombinant Fusion (FUS)

    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P35637
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 29.2kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Fusion expressed in: E.coli

    Recombinant Fusion (FUS)

    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P56959
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 53.3kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Mouse Fusion expressed in: E.coli

    Human Fusion (FUS) Protein

    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    ELISA kit for Mouse FUS (Fusion)

    ELK6109 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fusion (FUS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fusion (FUS). Next, A
    • Show more
    Description: A sandwich ELISA kit for detection of Fusion from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Mouse Fusion (FUS) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Mouse Fusion (FUS) Protein

    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Fusion (FUS) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fusion (FUS) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fusion (FUS) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fusion (FUS) Antibody (FITC)

    • EUR 495.00
    • EUR 258.00
    • EUR 1455.00
    • EUR 676.00
    • EUR 398.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Fusion (FUS) Antibody (Biotin)

    • EUR 467.00
    • EUR 244.00
    • EUR 1344.00
    • EUR 634.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Fusion (FUS) Polyclonal Antibody (Human)

    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Gly193~Cys444)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fusion (FUS)

    Fusion (FUS) Polyclonal Antibody (Human), APC

    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Gly193~Cys444)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with APC.

    Fusion (FUS) Polyclonal Antibody (Human), Biotinylated

    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Gly193~Cys444)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with Biotin.

    Fusion (FUS) Polyclonal Antibody (Human), Cy3

    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Gly193~Cys444)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with Cy3.

    Fusion (FUS) Polyclonal Antibody (Human), FITC

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Gly193~Cys444)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with FITC.

    Fusion (FUS) Polyclonal Antibody (Human), HRP

    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Gly193~Cys444)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with HRP.

    Fusion (FUS) Polyclonal Antibody (Human), PE

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Gly193~Cys444)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with PE.

    Fusion (FUS) Polyclonal Antibody (Mouse)

    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Ser3~Arg267)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS)

    Fusion (FUS) Polyclonal Antibody (Human), APC-Cy7

    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Gly193~Cys444)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with APC-Cy7.

    Fusion (FUS) Polyclonal Antibody (Mouse), APC

    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Ser3~Arg267)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with APC.

    Fusion (FUS) Polyclonal Antibody (Mouse), Biotinylated

    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Ser3~Arg267)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with Biotin.

    Fusion (FUS) Polyclonal Antibody (Mouse), Cy3

    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Ser3~Arg267)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with Cy3.

    Fusion (FUS) Polyclonal Antibody (Mouse), FITC

    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Ser3~Arg267)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with FITC.

    Fusion (FUS) Polyclonal Antibody (Mouse), HRP

    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Ser3~Arg267)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with HRP.

    Fusion (FUS) Polyclonal Antibody (Mouse), PE

    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Ser3~Arg267)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with PE.

    Fusion (FUS) Polyclonal Antibody (Mouse), APC-Cy7

    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FUS (Ser3~Arg267)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with APC-Cy7.


    EF006746 96 Tests
    EUR 689

    Human RNA-Binding Protein FUS (FUS) ELISA Kit

    abx571353-96tests 96 tests
    EUR 739
    • Shipped within 1-3 weeks.

    Human FUS/ RNA-binding protein FUS ELISA Kit

    E0955Hu 1 Kit
    EUR 605

    Human FUS(RNA-binding protein FUS) ELISA Kit

    EH14546 96T
    EUR 567.6
    • Detection range: 78.125-5000 pg/ml
    • Uniprot ID: P35637
    • Alias: 75 kDa DNA-pairing protein/Oncogene FUS/Oncogene TLS/POMp75/Translocated in liposarcoma protein/TLS
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

    Human RNA- binding protein FUS, FUS ELISA KIT

    ELI-20697h 96 Tests
    EUR 824

    Human RNA-binding protein FUS (FUS/TLS) ELISA kit

    CSB-E17376h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human RNA-binding protein FUS (FUS/TLS) in samples from serum, plasma, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human RNA-binding protein FUS (FUS/TLS) ELISA kit

    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human RNA-binding protein FUS (FUS/TLS) in samples from serum, plasma, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    FUS ELISA Kit (Human) (OKCD00318)

    OKCD00318 96 Wells
    EUR 831
    Description: Description of target: Binds both single-stranded and double-stranded DNA and promotes ATP-independent annealing of complementary single-stranded DNAs and D-loop formation in superhelical double-stranded DNA. May play a role in maintenance of genomic integrity. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

    FUS ELISA Kit (Human) (OKAN06133)

    OKAN06133 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

    FUS ELISA Kit (Human) (OKDD00275)

    OKDD00275 96 Wells
    EUR 975
    Description: Description of target: This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL

    FUS ELISA Kit (Human) (OKEH07134)

    OKEH07134 96 Wells
    EUR 662
    Description: Description of target: Binds both single-stranded and double-stranded DNA and promotes ATP-independent annealing of complementary single-stranded DNAs and D-loop formation in superhelical double-stranded DNA. May play a role in maintenance of genomic integrity. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL

    Fus ELISA Kit| Mouse RNA-binding protein FUS ELISA Kit

    EF014989 96 Tests
    EUR 689

    FUS ELISA Kit| Bovine RNA-binding protein FUS ELISA Kit

    EF011406 96 Tests
    EUR 689

    Cow RNA-Binding Protein FUS (FUS) ELISA Kit

    abx555793-96tests 96 tests
    EUR 911
    • Shipped within 1-3 weeks.

    Mouse RNA-Binding Protein FUS (FUS) ELISA Kit

    abx570765-96tests 96 tests
    EUR 668
    • Shipped within 1-3 weeks.

    Bovine RNA- binding protein FUS, FUS ELISA KIT

    ELI-30802b 96 Tests
    EUR 928

    Mouse RNA- binding protein FUS, Fus ELISA KIT

    ELI-48335m 96 Tests
    EUR 865

    FUS ELISA Kit (Mouse) (OKCD00319)

    OKCD00319 96 Wells
    EUR 857
    Description: Description of target: Binds both single-stranded and double-stranded DNA and promotes ATP-independent annealing of complementary single-stranded DNAs and D-loop formation in superhelical double-stranded DNA. May play a role in maintenance of genomic integrity (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    RNA-Binding Protein FUS (FUS) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    RNA-Binding Protein FUS (FUS) Antibody

    abx037843-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    RNA-Binding Protein FUS (FUS) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    FUS siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FUS siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FUS antibody

    70R-4766 50 ug
    EUR 467
    Description: Rabbit polyclonal FUS antibody raised against the N terminal of FUS

    FUS Antibody

    ABD8391 100 ug
    EUR 438

    FUS Antibody

    ABD8420 100 ug
    EUR 438

    FUS Antibody

    EUR 316

    Fus Antibody

    39335-100ul 100ul
    EUR 390

    FUS Antibody

    42783-100ul 100ul
    EUR 252

    FUS Antibody

    40153-100ul 100ul
    EUR 252

    FUS antibody

    70R-17367 50 ul
    EUR 435
    Description: Rabbit polyclonal FUS antibody

    FUS antibody

    70R-12072 100 ul
    EUR 403
    Description: Rabbit polyclonal FUS antibody

    FUS antibody

    70R-15452 100 ug
    EUR 327
    Description: Rabbit polyclonal FUS antibody

    FUS Antibody

    DF8391 200ul
    EUR 304
    Description: FUS Antibody detects endogenous levels of total FUS.

    FUS Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

    FUS Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

    FUS Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    FUS Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200


    PVT18731 2 ug
    EUR 231

    ELISA kit for Human RNA-binding protein FUS

    EK3746 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human RNA-binding protein FUS in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human FUS shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    FUS Recombinant Protein (Human)

    RP012655 100 ug Ask for price

    RNA-Binding Protein FUS (FUS) Antibody Pair

    abx117338-1pair5x96wellplates 1 pair (5x96 well plates)
    EUR 1010
    • Shipped within 5-10 working days.

    Human TCF3 fusion partner, TFPT ELISA KIT

    ELI-37062h 96 Tests
    EUR 824

    Human TCF3 Fusion Partner (TFPT) ELISA Kit

    abx383724-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Polyclonal FUS Antibody

    APR00190G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FUS . This antibody is tested and proven to work in the following applications:

    FUS Conjugated Antibody

    C40153 100ul
    EUR 397

    FUS cloning plasmid

    CSB-CL009069HU-10ug 10ug
    EUR 552
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1581
    • Sequence: atggcctcaaacgattatacccaacaagcaacccaaagctatggggcctaccccacccagcccgggcagggctattcccagcagagcagtcagccctacggacagcagagttacagtggttatagccagtccacggacacttcaggctatggccagagcagctattcttcttatg
    • Show more
    Description: A cloning plasmid for the FUS gene.

    FUS / TLS Antibody

    abx233242-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    FUS / TLS Antibody

    abx233243-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    FUS Polyclonal Antibody

    A51449 100 µg
    EUR 570.55
    Description: fast delivery possible

    FUS Blocking Peptide

    33R-5753 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FUS antibody, catalog no. 70R-4766

    FUS/TLS Antibody

    49300-100ul 100ul
    EUR 333

    FUS/TLS Antibody

    49300-50ul 50ul
    EUR 239

    FUS antibody (HRP)

    60R-2170 100 ug
    EUR 327
    Description: Rabbit polyclonal FUS antibody (HRP)

    FUS antibody (FITC)

    60R-2171 100 ug
    EUR 327
    Description: Rabbit polyclonal FUS antibody (FITC)

    FUS antibody (biotin)

    60R-2172 100 ug
    EUR 327
    Description: Rabbit polyclonal FUS antibody (biotin)

    FUS Blocking Peptide

    DF8391-BP 1mg
    EUR 195

    pASK- IBA5plus++FUS

    PVT10149 2 ug
    EUR 266

    Anti-FUS antibody

    STJ27717 100 µl
    EUR 413
    Description: This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6.

    FUS ORF Vector (Human) (pORF)

    ORF004219 1.0 ug DNA
    EUR 95

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E01C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E01C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E01C1702-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Izumo Sperm Egg Fusion 1 ELISA Kit

    ELA-E3966h 96 Tests
    EUR 824

    Human CHRNA7- FAM7A fusion protein, CHRFAM7A ELISA KIT

    ELI-26298h 96 Tests
    EUR 824

    Human Lipoma HMGIC fusion partner, LHFP ELISA KIT

    ELI-43189h 96 Tests
    EUR 824

    Human CHRNA7-FAM7A Fusion Protein (CHRFAM7A) ELISA Kit

    abx386514-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    FUS/TLS Conjugated Antibody

    C49300 100ul
    EUR 397

    FUS Polyclonal Conjugated Antibody

    C30674 100ul
    EUR 397

    anti- FUS/TLS antibody

    FNab03242 100µg
    EUR 505.25
    • Immunogen: fusion(involved in t(12
    • 16) in malignant liposarcoma)
    • Uniprot ID: P35637
    • Research Area: Neuroscience, Cancer
    Description: Antibody raised against FUS/TLS

    anti- FUS/TLS antibody

    FNab03243 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:2000
    • IP: 1:5000-1:50000
    • IHC: 1:500-1:2500
    • IF: 1:20-1:200
    • Immunogen: fusion(involved in t(12
    • 16) in malignant liposarcoma)
    • Uniprot ID: P35637
    • Research Area: Neuroscience, Cancer
    Description: Antibody raised against FUS/TLS

    Anti-TLS/FUS Antibody

    A00771-1 100ug/vial
    EUR 294

    Mouse FUS shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    FUS Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    FUS Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    FUS Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Anti-FUS/TLS antibody

    PAab03242 100 ug
    EUR 355

    FUS Recombinant Protein (Rat)

    RP201878 100 ug Ask for price

    FUS Recombinant Protein (Mouse)

    RP135407 100 ug Ask for price

    Human Leukemia NUP98 fusion partner 1, LNP1 ELISA KIT

    ELI-12622h 96 Tests
    EUR 824

    Human POM121 and ZP3 fusion protein, POMZP3 ELISA KIT

    ELI-36182h 96 Tests
    EUR 824

    Human Vacuolar fusion protein CCZ1 homolog, CCZ1 ELISA KIT

    ELI-50245h 96 Tests
    EUR 824

    Human Vacuolar Fusion Protein CCZ1 Homolog (CCZ1) ELISA Kit

    abx386379-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Izumo Sperm-Egg Fusion 1 (IZUMO1) ELISA Kit

    abx251123-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    FUS sgRNA CRISPR Lentivector set (Human)

    K0821801 3 x 1.0 ug
    EUR 339

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E06C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E06C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E06C1702-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E02C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E02C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E02C1702-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E03C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E03C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E03C1702-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E04C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E04C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E04C1702-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E07C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E07C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E07C1702-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E08C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E08C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E08C1702-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E09C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E09C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E09C1702-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Bovine TCF3 fusion partner homolog, TFPT ELISA KIT

    ELI-18981b 96 Tests
    EUR 928

    Mouse Lipoma HMGIC fusion partner, Lhfp ELISA KIT

    ELI-38811m 96 Tests
    EUR 865

    Mouse TCF3 fusion partner homolog, Tfpt ELISA KIT

    ELI-41794m 96 Tests
    EUR 865

    Human Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit

    E01V0065-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit

    E01V0065-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit

    E01V0065-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human IZUMO1/ Izumo sperm-egg fusion protein 1 ELISA Kit

    E1357Hu 1 Kit
    EUR 571

    Human IZUMO1(Izumo sperm-egg fusion protein 1) ELISA Kit

    EH1813 96T
    EUR 567.6
    • Detection range: 15.6-1000 pg/ml
    • Uniprot ID: Q8IYV9
    • Alias: IZUMO1(Izumo sperm-egg fusion protein 1)/OBF/Oocyte binding/fusion factor/Sperm-specific protein izumo
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

    Human Izumo sperm- egg fusion protein 1, IZUMO1 ELISA KIT

    ELI-05121h 96 Tests
    EUR 824

    Human Vacuolar fusion protein MON1 homolog B, MON1B ELISA KIT

    ELI-15777h 96 Tests
    EUR 824

    Human Vacuolar fusion protein MON1 homolog A, MON1A ELISA KIT

    ELI-42809h 96 Tests
    EUR 824

    Human Izumo sperm- egg fusion protein 2, IZUMO2 ELISA KIT

    ELI-44098h 96 Tests
    EUR 824

    Human Izumo sperm- egg fusion protein 3, IZUMO3 ELISA KIT

    ELI-42259h 96 Tests
    EUR 824

    Human Izumo sperm- egg fusion protein 4, IZUMO4 ELISA KIT

    ELI-37891h 96 Tests
    EUR 824

    Human Ubiquitin fusion-degradation 1-like protein (UFD1L) ELISA Kit

    abx384111-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Ubiquitin fusion degradation protein 1 homolog(UFD1L) ELISA kit

    CSB-EL025559HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ubiquitin fusion degradation protein 1 homolog (UFD1L) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Ubiquitin fusion degradation protein 1 homolog(UFD1L) ELISA kit

    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ubiquitin fusion degradation protein 1 homolog(UFD1L) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    FUS sgRNA CRISPR Lentivector (Human) (Target 1)

    K0821802 1.0 ug DNA
    EUR 154

    FUS sgRNA CRISPR Lentivector (Human) (Target 2)

    K0821803 1.0 ug DNA
    EUR 154

    FUS sgRNA CRISPR Lentivector (Human) (Target 3)

    K0821804 1.0 ug DNA
    EUR 154

    FUS Protein Vector (Human) (pPB-C-His)

    PV016873 500 ng
    EUR 329

    FUS Protein Vector (Human) (pPB-N-His)

    PV016874 500 ng
    EUR 329

    FUS Protein Vector (Human) (pPM-C-HA)

    PV016875 500 ng
    EUR 329

    FUS Protein Vector (Human) (pPM-C-His)

    PV016876 500 ng
    EUR 329

    [KO Validated] FUS Rabbit pAb

    A5921-100ul 100 ul
    EUR 410

    [KO Validated] FUS Rabbit pAb

    A5921-200ul 200 ul
    EUR 571

    [KO Validated] FUS Rabbit pAb

    A5921-20ul 20 ul
    EUR 221

    [KO Validated] FUS Rabbit pAb

    A5921-50ul 50 ul
    EUR 287

    FUS/TLS recombinant monoclonal antibody

    A5383 100ul X 3
    EUR 595
    • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
    • Show more
    Description: A recombinant monoclonal antibody from rabbit against human FUS/TLS for WB,ELISA

    FUS Polyclonal Antibody, HRP Conjugated

    A51450 100 µg
    EUR 570.55
    Description: reagents widely cited

    FUS Polyclonal Antibody, FITC Conjugated

    A51451 100 µg
    EUR 570.55
    Description: Ask the seller for details

    FUS Polyclonal Antibody, Biotin Conjugated

    A51452 100 µg
    EUR 570.55
    Description: The best epigenetics products

    [KO Validated] FUS Polyclonal Antibody

    30674-100ul 100ul
    EUR 252

    [KO Validated] FUS Polyclonal Antibody

    30674-50ul 50ul
    EUR 187

    Fus ORF Vector (Rat) (pORF)

    ORF067294 1.0 ug DNA
    EUR 506

    Fus ORF Vector (Mouse) (pORF)

    ORF045137 1.0 ug DNA
    EUR 506

    ig-Fusion Cloning Kit - 10 Reactions

    4111 1/EA
    EUR 263

    ig-Fusion Cloning Kit - 50 Reactions

    4115 1/EA
    EUR 846

    ig-Fusion Cloning Kit - 100 Reactions

    4117 1/EA
    EUR 1334

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    Mouse Izumo Sperm-Egg Fusion 1 (IZUMO1) ELISA Kit

    abx517781-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Izumo Sperm-Egg Fusion 1 (IZUMO1) ELISA Kit

    abx517782-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E05C1702-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

    E05C1702-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human FUS(Fusion) ELISA Kit