Human FUS(Fusion) ELISA Kit

Human FUS(Fusion) ELISA Kit

To Order Contact us below: 

Human Fusion (FUS) ELISA Kit
RD-FUS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Fusion (FUS) ELISA Kit
RD-FUS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Fusion (FUS) ELISA Kit
DLR-FUS-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Fusion (FUS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fusion (FUS) in samples from tissue homogenates or other biological fluids.

Mouse Fusion (FUS) ELISA Kit
DLR-FUS-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Fusion (FUS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fusion (FUS) in samples from tissue homogenates or other biological fluids.

Mouse Fusion (FUS) ELISA Kit
RDR-FUS-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Fusion (FUS) ELISA Kit
RDR-FUS-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Fusion (FUS) ELISA Kit
RD-FUS-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Fusion (FUS) ELISA Kit
RD-FUS-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Fusion (FUS) ELISA Kit
20-abx151603	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Fusion(FUS)ELISA Kit
QY-E01737	Qayee Biotechnology	96T	EUR 361

Human Fusion ELISA Kit (FUS)
RK01425	Abclonal	96 Tests	EUR 521

Human Fusion (FUS) ELISA Kit
SEC260Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

Human Fusion (FUS) ELISA Kit
SEC260Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

Human Fusion (FUS) ELISA Kit
SEC260Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

Human Fusion (FUS) ELISA Kit
SEC260Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

Human Fusion (FUS) ELISA Kit
4-SEC260Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fusion elisa. Alternative names of the recognized antigen: CHOP ALS6 TLS hnRNP-P2 Amyotrophic Lateral Sclerosis 6 Heterogeneous Nuclear Ribonucleoprotein P2 75 kDa DNA-pairing protein Translocated in liposarcoma protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fusion (FUS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Fusion (FUS) ELISA Kit
20-abx154044	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Fusion (FUS) ELISA Kit
SEC260Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

Mouse Fusion (FUS) ELISA Kit
SEC260Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

Mouse Fusion (FUS) ELISA Kit
SEC260Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

Mouse Fusion (FUS) ELISA Kit
SEC260Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

Mouse Fusion (FUS) ELISA Kit
4-SEC260Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fusion elisa. Alternative names of the recognized antigen: CHOP ALS6 TLS hnRNP-P2 Amyotrophic Lateral Sclerosis 6 Heterogeneous Nuclear Ribonucleoprotein P2 75 kDa DNA-pairing protein Translocated in liposarcoma protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Fusion (FUS) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human FUS (Fusion)
ELK4043	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fusion (FUS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fusion (FUS). Next, A Show more
Description: A sandwich ELISA kit for detection of Fusion from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Fusion (FUS) CLIA Kit
20-abx493573	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Fusion (FUS) Antibody
20-abx176518	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Fusion (FUS) Antibody
20-abx212423	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fusion (FUS) Antibody
20-abx212424	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fusion (FUS) Antibody
20-abx100040	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fusion (FUS) Antibody
20-abx110192	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fusion (FUS) Antibody
20-abx129140	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fusion (FUS) Antibody
20-abx172487	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Fusion (FUS)
4-RPC260Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P35637 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Fusion expressed in: E.coli

Recombinant Fusion (FUS)
4-RPC260Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P56959 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 53.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Fusion expressed in: E.coli

Human Fusion (FUS) Protein
20-abx168102	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse FUS (Fusion)
ELK6109	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fusion (FUS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fusion (FUS). Next, A Show more
Description: A sandwich ELISA kit for detection of Fusion from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Fusion (FUS) CLIA Kit
20-abx493574	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Fusion (FUS) Antibody (Biotin)
20-abx105013	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fusion (FUS) Antibody (FITC)
20-abx106427	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fusion (FUS) Antibody (HRP)
20-abx107842	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Fusion (FUS) Protein
20-abx066708	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fusion (FUS) Antibody (FITC)
20-abx271237	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fusion (FUS) Antibody (Biotin)
20-abx271503	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Fusion (FUS) Polyclonal Antibody (Human)
4-PAC260Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Gly193~Cys444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS)

Fusion (FUS) Polyclonal Antibody (Human), APC
4-PAC260Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Gly193~Cys444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with APC.

Fusion (FUS) Polyclonal Antibody (Human), Biotinylated
4-PAC260Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Gly193~Cys444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with Biotin.

Fusion (FUS) Polyclonal Antibody (Human), Cy3
4-PAC260Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Gly193~Cys444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with Cy3.

Fusion (FUS) Polyclonal Antibody (Human), FITC
4-PAC260Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Gly193~Cys444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with FITC.

Fusion (FUS) Polyclonal Antibody (Human), HRP
4-PAC260Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Gly193~Cys444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with HRP.

Fusion (FUS) Polyclonal Antibody (Human), PE
4-PAC260Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Gly193~Cys444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with PE.

Fusion (FUS) Polyclonal Antibody (Mouse)
4-PAC260Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Ser3~Arg267) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS)

Fusion (FUS) Polyclonal Antibody (Human), APC-Cy7
4-PAC260Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Gly193~Cys444) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with APC-Cy7.

Fusion (FUS) Polyclonal Antibody (Mouse), APC
4-PAC260Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Ser3~Arg267) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with APC.

Fusion (FUS) Polyclonal Antibody (Mouse), Biotinylated
4-PAC260Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Ser3~Arg267) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with Biotin.

Fusion (FUS) Polyclonal Antibody (Mouse), Cy3
4-PAC260Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Ser3~Arg267) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with Cy3.

Fusion (FUS) Polyclonal Antibody (Mouse), FITC
4-PAC260Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Ser3~Arg267) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with FITC.

Fusion (FUS) Polyclonal Antibody (Mouse), HRP
4-PAC260Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Ser3~Arg267) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with HRP.

Fusion (FUS) Polyclonal Antibody (Mouse), PE
4-PAC260Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Ser3~Arg267) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with PE.

Fusion (FUS) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC260Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FUS (Ser3~Arg267) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with APC-Cy7.

FUS ELISA KIT|Human
EF006746	Lifescience Market	96 Tests	EUR 689

Human FUS/ RNA-binding protein FUS ELISA Kit
E0955Hu	Sunlong	1 Kit	EUR 605

Human FUS(RNA-binding protein FUS) ELISA Kit
EH14546	FN Test	96T	EUR 567.6
Detection range: 78.125-5000 pg/ml Uniprot ID: P35637 Alias: 75 kDa DNA-pairing protein/Oncogene FUS/Oncogene TLS/POMp75/Translocated in liposarcoma protein/TLS
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human RNA- binding protein FUS, FUS ELISA KIT
ELI-20697h	Lifescience Market	96 Tests	EUR 824

Human RNA-Binding Protein FUS (FUS) ELISA Kit
abx571353-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Human RNA-binding protein FUS (FUS/TLS) ELISA kit
CSB-E17376h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human RNA-binding protein FUS (FUS/TLS) in samples from serum, plasma, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human RNA-binding protein FUS (FUS/TLS) ELISA kit
1-CSB-E17376h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human RNA-binding protein FUS (FUS/TLS) in samples from serum, plasma, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

FUS ELISA Kit (Human) (OKAN06133)
OKAN06133	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

FUS ELISA Kit (Human) (OKCD00318)
OKCD00318	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Binds both single-stranded and double-stranded DNA and promotes ATP-independent annealing of complementary single-stranded DNAs and D-loop formation in superhelical double-stranded DNA. May play a role in maintenance of genomic integrity. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

FUS ELISA Kit (Human) (OKDD00275)
OKDD00275	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL

FUS ELISA Kit (Human) (OKEH07134)
OKEH07134	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Binds both single-stranded and double-stranded DNA and promotes ATP-independent annealing of complementary single-stranded DNAs and D-loop formation in superhelical double-stranded DNA. May play a role in maintenance of genomic integrity. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL

Fus ELISA Kit| Mouse RNA-binding protein FUS ELISA Kit
EF014989	Lifescience Market	96 Tests	EUR 689

FUS ELISA Kit| Bovine RNA-binding protein FUS ELISA Kit
EF011406	Lifescience Market	96 Tests	EUR 689

Bovine RNA- binding protein FUS, FUS ELISA KIT
ELI-30802b	Lifescience Market	96 Tests	EUR 928

Cow RNA-Binding Protein FUS (FUS) ELISA Kit
abx555793-96tests	Abbexa	96 tests	EUR 911
Shipped within 1-3 weeks.

Mouse RNA-Binding Protein FUS (FUS) ELISA Kit
abx570765-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse RNA- binding protein FUS, Fus ELISA KIT
ELI-48335m	Lifescience Market	96 Tests	EUR 865

FUS ELISA Kit (Mouse) (OKCD00319)
OKCD00319	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Binds both single-stranded and double-stranded DNA and promotes ATP-independent annealing of complementary single-stranded DNAs and D-loop formation in superhelical double-stranded DNA. May play a role in maintenance of genomic integrity (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

RNA-Binding Protein FUS (FUS) Antibody
20-abx004538	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

RNA-Binding Protein FUS (FUS) Antibody
20-abx112608	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RNA-Binding Protein FUS (FUS) Antibody
abx037843-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

FUS antibody
70R-17367	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FUS antibody

FUS antibody
70R-12072	Fitzgerald	100 ul	EUR 403
Description: Rabbit polyclonal FUS antibody

FUS antibody
70R-15452	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FUS antibody

FUS Antibody
3771-100	Biovision		EUR 316

Fus Antibody
39335-100ul	SAB	100ul	EUR 390

FUS Antibody
42783-100ul	SAB	100ul	EUR 252

FUS Antibody
40153-100ul	SAB	100ul	EUR 252

FUS Antibody
1-CSB-PA815873	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

FUS Antibody
DF8391	Affbiotech	200ul	EUR 304
Description: FUS Antibody detects endogenous levels of total FUS.

FUS Antibody
1-CSB-PA02704A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

FUS Antibody
1-CSB-PA229936	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

FUS antibody
70R-4766	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FUS antibody raised against the N terminal of FUS

FUS Antibody
1-CSB-PA009069GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

FUS siRNA
20-abx917305	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FUS siRNA
20-abx917306	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FUS Antibody
ABD8391	Lifescience Market	100 ug	EUR 438

FUS Antibody
ABD8420	Lifescience Market	100 ug	EUR 438

pOTB7-FUS
PVT18731	Lifescience Market	2 ug	EUR 231

ELISA kit for Human RNA-binding protein FUS
EK3746	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human RNA-binding protein FUS in samples from serum, plasma, tissue homogenates and other biological fluids.

Human FUS shRNA Plasmid
20-abx951667	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FUS Recombinant Protein (Human)
RP012655	ABM	100 ug	Ask for price

RNA-Binding Protein FUS (FUS) Antibody Pair
abx117338-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

Human TCF3 Fusion Partner (TFPT) ELISA Kit
abx383724-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human TCF3 fusion partner, TFPT ELISA KIT
ELI-37062h	Lifescience Market	96 Tests	EUR 824

FUS Blocking Peptide
33R-5753	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FUS antibody, catalog no. 70R-4766

FUS antibody (HRP)
60R-2170	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FUS antibody (HRP)

FUS antibody (FITC)
60R-2171	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FUS antibody (FITC)

FUS antibody (biotin)
60R-2172	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FUS antibody (biotin)

FUS/TLS Antibody
49300-100ul	SAB	100ul	EUR 333

FUS/TLS Antibody
49300-50ul	SAB	50ul	EUR 239

Polyclonal FUS Antibody
APR00190G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FUS . This antibody is tested and proven to work in the following applications:

FUS Blocking Peptide
DF8391-BP	Affbiotech	1mg	EUR 195

FUS Conjugated Antibody
C40153	SAB	100ul	EUR 397

FUS / TLS Antibody
abx233242-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

FUS / TLS Antibody
abx233243-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

FUS cloning plasmid
CSB-CL009069HU-10ug	Cusabio	10ug	EUR 552
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1581 Sequence: atggcctcaaacgattatacccaacaagcaacccaaagctatggggcctaccccacccagcccgggcagggctattcccagcagagcagtcagccctacggacagcagagttacagtggttatagccagtccacggacacttcaggctatggccagagcagctattcttcttatg Show more
Description: A cloning plasmid for the FUS gene.

FUS Polyclonal Antibody
A51449	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

pASK- IBA5plus++FUS
PVT10149	Lifescience Market	2 ug	EUR 266

Anti-FUS antibody
STJ27717	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

FUS ORF Vector (Human) (pORF)
ORF004219	ABM	1.0 ug DNA	EUR 95

Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E01C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E01C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E01C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Izumo Sperm Egg Fusion 1 ELISA Kit
ELA-E3966h	Lifescience Market	96 Tests	EUR 824

Human CHRNA7- FAM7A fusion protein, CHRFAM7A ELISA KIT
ELI-26298h	Lifescience Market	96 Tests	EUR 824

Human Lipoma HMGIC fusion partner, LHFP ELISA KIT
ELI-43189h	Lifescience Market	96 Tests	EUR 824

Human CHRNA7-FAM7A Fusion Protein (CHRFAM7A) ELISA Kit
abx386514-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

FUS Antibody, HRP conjugated
1-CSB-PA02704B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FUS Antibody, FITC conjugated
1-CSB-PA02704C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FUS Antibody, Biotin conjugated
1-CSB-PA02704D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TLS/FUS Antibody
A00771-1	BosterBio	100ug/vial	EUR 294

FUS/TLS Conjugated Antibody
C49300	SAB	100ul	EUR 397

FUS Polyclonal Conjugated Antibody
C30674	SAB	100ul	EUR 397

Mouse FUS shRNA Plasmid
20-abx982098	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti- FUS/TLS antibody
FNab03242	FN Test	100µg	EUR 505.25
Immunogen: fusion(involved in t(12 16) in malignant liposarcoma) Uniprot ID: P35637 Research Area: Neuroscience, Cancer
Description: Antibody raised against FUS/TLS

anti- FUS/TLS antibody
FNab03243	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IP: 1:5000-1:50000 IHC: 1:500-1:2500 IF: 1:20-1:200 Immunogen: fusion(involved in t(12 16) in malignant liposarcoma) Uniprot ID: P35637 Research Area: Neuroscience, Cancer
Description: Antibody raised against FUS/TLS

Anti-FUS/TLS antibody
PAab03242	Lifescience Market	100 ug	EUR 355

FUS Recombinant Protein (Rat)
RP201878	ABM	100 ug	Ask for price

FUS Recombinant Protein (Mouse)
RP135407	ABM	100 ug	Ask for price

Human Izumo Sperm-Egg Fusion 1 (IZUMO1) ELISA Kit
abx251123-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Leukemia NUP98 fusion partner 1, LNP1 ELISA KIT
ELI-12622h	Lifescience Market	96 Tests	EUR 824

Human Vacuolar Fusion Protein CCZ1 Homolog (CCZ1) ELISA Kit
abx386379-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human POM121 and ZP3 fusion protein, POMZP3 ELISA KIT
ELI-36182h	Lifescience Market	96 Tests	EUR 824

Human Vacuolar fusion protein CCZ1 homolog, CCZ1 ELISA KIT
ELI-50245h	Lifescience Market	96 Tests	EUR 824

FUS sgRNA CRISPR Lentivector set (Human)
K0821801	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E02C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E02C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E02C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E03C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E03C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E03C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E06C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E06C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E06C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E04C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E04C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E04C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E07C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E07C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E07C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E09C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E09C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E09C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E08C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E08C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E08C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine TCF3 fusion partner homolog, TFPT ELISA KIT
ELI-18981b	Lifescience Market	96 Tests	EUR 928

Mouse Lipoma HMGIC fusion partner, Lhfp ELISA KIT
ELI-38811m	Lifescience Market	96 Tests	EUR 865

Mouse TCF3 fusion partner homolog, Tfpt ELISA KIT
ELI-41794m	Lifescience Market	96 Tests	EUR 865

Human Ubiquitin fusion degradation protein 1 homolog(UFD1L) ELISA kit
CSB-EL025559HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ubiquitin fusion degradation protein 1 homolog (UFD1L) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Ubiquitin fusion degradation protein 1 homolog(UFD1L) ELISA kit
1-CSB-EL025559HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Ubiquitin fusion degradation protein 1 homolog(UFD1L) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit
E01V0065-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit
E01V0065-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit
E01V0065-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human IZUMO1/ Izumo sperm-egg fusion protein 1 ELISA Kit
E1357Hu	Sunlong	1 Kit	EUR 571

Human IZUMO1(Izumo sperm-egg fusion protein 1) ELISA Kit
EH1813	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: Q8IYV9 Alias: IZUMO1(Izumo sperm-egg fusion protein 1)/OBF/Oocyte binding/fusion factor/Sperm-specific protein izumo
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Vacuolar fusion protein MON1 homolog B, MON1B ELISA KIT
ELI-15777h	Lifescience Market	96 Tests	EUR 824

Human Izumo sperm- egg fusion protein 1, IZUMO1 ELISA KIT
ELI-05121h	Lifescience Market	96 Tests	EUR 824

Human Izumo sperm- egg fusion protein 3, IZUMO3 ELISA KIT
ELI-42259h	Lifescience Market	96 Tests	EUR 824

Human Vacuolar fusion protein MON1 homolog A, MON1A ELISA KIT
ELI-42809h	Lifescience Market	96 Tests	EUR 824

Human Izumo sperm- egg fusion protein 2, IZUMO2 ELISA KIT
ELI-44098h	Lifescience Market	96 Tests	EUR 824

Human Ubiquitin fusion-degradation 1-like protein (UFD1L) ELISA Kit
abx384111-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Izumo sperm- egg fusion protein 4, IZUMO4 ELISA KIT
ELI-37891h	Lifescience Market	96 Tests	EUR 824

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

FUS sgRNA CRISPR Lentivector (Human) (Target 1)
K0821802	ABM	1.0 ug DNA	EUR 154

FUS sgRNA CRISPR Lentivector (Human) (Target 2)
K0821803	ABM	1.0 ug DNA	EUR 154

FUS sgRNA CRISPR Lentivector (Human) (Target 3)
K0821804	ABM	1.0 ug DNA	EUR 154

FUS Protein Vector (Human) (pPB-C-His)
PV016873	ABM	500 ng	EUR 329

FUS Protein Vector (Human) (pPB-N-His)
PV016874	ABM	500 ng	EUR 329

FUS Protein Vector (Human) (pPM-C-HA)
PV016875	ABM	500 ng	EUR 329

FUS Protein Vector (Human) (pPM-C-His)
PV016876	ABM	500 ng	EUR 329

[KO Validated] FUS Polyclonal Antibody
30674-100ul	SAB	100ul	EUR 252

[KO Validated] FUS Polyclonal Antibody
30674-50ul	SAB	50ul	EUR 187

[KO Validated] FUS Rabbit pAb
A5921-100ul	Abclonal	100 ul	EUR 410

[KO Validated] FUS Rabbit pAb
A5921-200ul	Abclonal	200 ul	EUR 571

[KO Validated] FUS Rabbit pAb
A5921-20ul	Abclonal	20 ul	EUR 221

[KO Validated] FUS Rabbit pAb
A5921-50ul	Abclonal	50 ul	EUR 287

FUS Polyclonal Antibody, HRP Conjugated
A51450	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

FUS Polyclonal Antibody, FITC Conjugated
A51451	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

FUS Polyclonal Antibody, Biotin Conjugated
A51452	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

FUS/TLS recombinant monoclonal antibody
A5383	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human FUS/TLS for WB,ELISA

Fus ORF Vector (Rat) (pORF)
ORF067294	ABM	1.0 ug DNA	EUR 506

Fus ORF Vector (Mouse) (pORF)
ORF045137	ABM	1.0 ug DNA	EUR 506

ig-Fusion Cloning Kit - 10 Reactions
4111	Intact Genomics	1/EA	EUR 263

ig-Fusion Cloning Kit - 50 Reactions
4115	Intact Genomics	1/EA	EUR 846

ig-Fusion Cloning Kit - 100 Reactions
4117	Intact Genomics	1/EA	EUR 1334

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E05C1702-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E05C1702-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit
E05C1702-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Vacuolar fusion protein CCZ1 homolog, CCZ1 ELISA KIT
ELI-10446b	Lifescience Market	96 Tests	EUR 928

Human FUS(Fusion) ELISA Kit