Human CPM(Carboxypeptidase M) ELISA Kit

Human CPM(Carboxypeptidase M) ELISA Kit

To Order Contact us below: 

    Human Carboxypeptidase M (CPM) ELISA Kit
    RD-CPM-Hu-48Tests 48 Tests
    EUR 521
    Human Carboxypeptidase M (CPM) ELISA Kit
    RD-CPM-Hu-96Tests 96 Tests
    EUR 723
    Human CPM/ Carboxypeptidase M ELISA Kit
    E0547Hu 1 Kit
    EUR 571
    Human Carboxypeptidase M(CPM) ELISA kit
    E01C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase M(CPM) ELISA kit
    E01C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase M(CPM) ELISA kit
    E01C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase M (CPM) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human CPM(Carboxypeptidase M) ELISA Kit
    EH1622 96T
    EUR 567.6
    • Detection range: 1.56-100 ng/ml
    • Uniprot ID: P14384
    • Alias: CPM/Carboxypeptidase M
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml
    Human Carboxypeptidase M, CPM ELISA KIT
    ELI-04766h 96 Tests
    EUR 824
    Human Carboxypeptidase M (CPM) ELISA Kit
    abx576436-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Carboxypeptidase M(CPM)ELISA Kit
    QY-E01343 96T
    EUR 361
    Human Carboxypeptidase M (CPM) ELISA Kit
    SEC397Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase M (CPM) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase M (CPM) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase M (CPM) ELISA Kit
    SEC397Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase M (CPM) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase M (CPM) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase M (CPM) ELISA Kit
    SEC397Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase M (CPM) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase M (CPM) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase M (CPM) ELISA Kit
    SEC397Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase M (CPM) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase M (CPM) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase M (CPM) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase M elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase M (CPM) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Carboxypeptidase M (CPM) Antibody
    abx026274-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    abx026274-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Carboxypeptidase M (CPM) Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    abx145280-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Carboxypeptidase M (CPM) Antibody
    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    abx330905-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Carboxypeptidase M (CPM) Antibody
    abx231267-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Rat Carboxypeptidase M(CPM) ELISA kit
    E02C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Carboxypeptidase M(CPM) ELISA kit
    E02C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Carboxypeptidase M(CPM) ELISA kit
    E02C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Carboxypeptidase M(CPM) ELISA kit
    E03C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Carboxypeptidase M(CPM) ELISA kit
    E03C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Carboxypeptidase M(CPM) ELISA kit
    E03C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Carboxypeptidase M(CPM) ELISA kit
    E06C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Carboxypeptidase M(CPM) ELISA kit
    E06C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Carboxypeptidase M(CPM) ELISA kit
    E06C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Carboxypeptidase M(CPM) ELISA kit
    E04C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Carboxypeptidase M(CPM) ELISA kit
    E04C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Carboxypeptidase M(CPM) ELISA kit
    E04C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Carboxypeptidase M(CPM) ELISA kit
    E09C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Carboxypeptidase M(CPM) ELISA kit
    E09C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Carboxypeptidase M(CPM) ELISA kit
    E09C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Carboxypeptidase M(CPM) ELISA kit
    E08C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Carboxypeptidase M(CPM) ELISA kit
    E08C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Carboxypeptidase M(CPM) ELISA kit
    E08C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Carboxypeptidase M(CPM) ELISA kit
    E07C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Carboxypeptidase M(CPM) ELISA kit
    E07C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Carboxypeptidase M(CPM) ELISA kit
    E07C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Carboxypeptidase M, Cpm ELISA KIT
    ELI-04767m 96 Tests
    EUR 865
    Mouse Carboxypeptidase M (CPM) ELISA Kit
    abx517012-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Carboxypeptidase M (CPM) Protein
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Human Carboxypeptidase M (CPM) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human CPM (Carboxypeptidase M)
    ELK4051 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase M (CPM). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxype
    • Show more
    Description: A sandwich ELISA kit for detection of Carboxypeptidase M from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Guinea pig Carboxypeptidase M(CPM) ELISA kit
    E05C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Carboxypeptidase M(CPM) ELISA kit
    E05C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Carboxypeptidase M(CPM) ELISA kit
    E05C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Anti-Carboxypeptidase M/CPM Antibody
    A01650 100ug/vial
    EUR 294
    Recombinant Human Carboxypeptidase M/CPM (C-6His)
    CC58-10ug 10ug
    EUR 202
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM ZnCl2,pH7.5.
    Recombinant Human Carboxypeptidase M/CPM (C-6His)
    CC58-1mg 1mg
    EUR 2486
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM ZnCl2,pH7.5.
    Recombinant Human Carboxypeptidase M/CPM (C-6His)
    CC58-500ug 500ug
    EUR 1755
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM ZnCl2,pH7.5.
    Recombinant Human Carboxypeptidase M/CPM (C-6His)
    CC58-50ug 50ug
    EUR 496
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM ZnCl2,pH7.5.
    Recombinant Mouse Carboxypeptidase M/CPM (C-6His)
    C780-10ug 10ug
    EUR 100
    Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.
    Recombinant Mouse Carboxypeptidase M/CPM (C-6His)
    C780-1mg 1mg
    EUR 1115
    Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.
    Recombinant Mouse Carboxypeptidase M/CPM (C-6His)
    C780-500ug 500ug
    EUR 709
    Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.
    Recombinant Mouse Carboxypeptidase M/CPM (C-6His)
    C780-50ug 50ug
    EUR 156
    Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.
    Carboxypeptidase M antibody
    22407-100ul 100ul
    EUR 390
    Carboxypeptidase M antibody
    70R-12966 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal Carboxypeptidase M antibody
    anti-Carboxypeptidase M
    YF-PA11066 50 ug
    EUR 363
    Description: Mouse polyclonal to Carboxypeptidase M
    anti-Carboxypeptidase M
    YF-PA23501 50 ul
    EUR 334
    Description: Mouse polyclonal to Carboxypeptidase M
    Human CPM ELISA Kit
    ELA-E1456h 96 Tests
    EUR 824
    EF005772 96 Tests
    EUR 689
    anti- Carboxypeptidase M antibody
    FNab01267 100µg
    EUR 505.25
    • Immunogen: carboxypeptidase M
    • Uniprot ID: P14384
    • Gene ID: 1368
    • Research Area: Cardiovascular, Metabolism
    Description: Antibody raised against Carboxypeptidase M
    Anti-Carboxypeptidase M antibody
    PAab01267 100 ug
    EUR 355
    CPM ELISA Kit (Human) (OKCD08108)
    OKCD08108 96 Wells
    EUR 975
    Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 28pg/mL
    CPM ELISA Kit (Human) (OKEH04872)
    OKEH04872 96 Wells
    EUR 662
    Description: Description of target: The protein encoded by this gene is a membrane-bound arginine/lysine carboxypeptidase. Its expression is associated with monocyte to macrophage differentiation. This encoded protein contains hydrophobic regions at the amino and carboxy termini and has 6 potential asparagine-linked glycosylation sites. The active site residues of carboxypeptidases A and B are conserved in this protein. Three alternatively spliced transcript variants encoding the same protein have been described for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.67 ng/mL
    CPM ELISA Kit (Mouse) (OKCA02351)
    OKCA02351 96 Wells
    EUR 846
    Description: Description of target: Specifically removes C-terminal basic residues (Arg or Lys) from peptides and proteins. It is believed to play important roles in the control of peptide hormone and growth factor activity at the cell surface, and in the membrane-localized degradation of extracellular proteins.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.1 pg/mL
    CPM ELISA Kit (Mouse) (OKEH05484)
    OKEH05484 96 Wells
    EUR 662
    Description: Description of target: Specifically removes C-terminal basic residues (Arg or Lys) from peptides and proteins. It is believed to play important roles in the control of peptide hormone and growth factor activity at the cell surface, and in the membrane-localized degradation of extracellular proteins.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.802 ng/mL
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    CPM antibody
    70R-16559 50 ul
    EUR 435
    Description: Rabbit polyclonal CPM antibody
    CPM Antibody
    34549-100ul 100ul
    EUR 252
    CPM Antibody
    34549-50ul 50ul
    EUR 187
    CPM Antibody
    43071-100ul 100ul
    EUR 252
    CPM Antibody
    46545-100ul 100ul
    EUR 252
    CPM Antibody
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against CPM. Recognizes CPM from Human. This antibody is Unconjugated. Tested in the following application: ELISA
    CPM Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against CPM. Recognizes CPM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    CPM Antibody
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against CPM. Recognizes CPM from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
    CPM Antibody
    DF3899 200ul
    EUR 304
    Description: CPM Antibody detects endogenous levels of total CPM.
    CPM Antibody
    EUR 335
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against CPM. Recognizes CPM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    CPM Antibody
    CSB-PA156471-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against CPM. Recognizes CPM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    CPM antibody
    70R-36214 100 ug
    EUR 327
    Description: Rabbit polyclonal CPM antibody
    CPM siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CPM siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CPM Antibody
    ABD3899 100 ug
    EUR 438
    Human Carboxypeptidase B1 ELISA kit
    E01C0730-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase B1 ELISA kit
    E01C0730-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase B1 ELISA kit
    E01C0730-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Carboxypeptidase A1 ELISA KIT|Human
    EF008381 96 Tests
    EUR 689
    Carboxypeptidase A2 ELISA KIT|Human
    EF008382 96 Tests
    EUR 689
    Carboxypeptidase A3 ELISA KIT|Human
    EF008383 96 Tests
    EUR 689
    Carboxypeptidase A5 ELISA KIT|Human
    EF008384 96 Tests
    EUR 689
    Carboxypeptidase A6 ELISA KIT|Human
    EF008385 96 Tests
    EUR 689
    Human CPM shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    CPM Recombinant Protein (Human)
    RP007870 100 ug Ask for price
    Human apoprotein M(APO-M)ELISA Kit
    QY-E00317 96T
    EUR 361
    Mouse Monoclonal Anti-Zaire Ebola virus (killed) IgG (mixture of EVZ12-M and EVZ13-M), aff pure
    EVZ14-M 100 ul
    EUR 482
    Human Carboxypeptidase N1 (CPN1)ELISA Kit
    201-12-2436 96 tests
    EUR 440
    • This Carboxypeptidase N1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Carboxypeptidase N2 (CPN2)ELISA Kit
    201-12-2437 96 tests
    EUR 440
    • This Carboxypeptidase N2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    DLR-CPA4-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase A4 (CPA4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase A4 (CPA4) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    DLR-CPA4-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase A4 (CPA4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase A4 (CPA4) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Carboxypeptidase E (CPE) ELISA Kit
    DLR-CPE-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Carboxypeptidase E (CPE) ELISA Kit
    DLR-CPE-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    DLR-CPN1-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    DLR-CPN1-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    DLR-CPZ-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    DLR-CPZ-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
    Human CPA2/ Carboxypeptidase A2 ELISA Kit
    E0543Hu 1 Kit
    EUR 571
    Human CPB2/ Carboxypeptidase B2 ELISA Kit
    E0545Hu 1 Kit
    EUR 571
    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A6(CPA6) ELISA kit
    E01C1994-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A6(CPA6) ELISA kit
    E01C1994-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase A6(CPA6) ELISA kit
    E01C1994-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase D(CPD) ELISA kit
    E01C1996-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase D(CPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase D(CPD) ELISA kit
    E01C1996-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase D(CPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase D(CPD) ELISA kit
    E01C1996-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase D(CPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase E(CPE) ELISA kit
    E01C1997-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase E(CPE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase E(CPE) ELISA kit
    E01C1997-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase E(CPE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase E(CPE) ELISA kit
    E01C1997-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase E(CPE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase O(CPO) ELISA kit
    E01C2019-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase O(CPO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase O(CPO) ELISA kit
    E01C2019-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase O(CPO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase O(CPO) ELISA kit
    E01C2019-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase O(CPO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase Z(CPZ) ELISA kit
    E01C2032-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase Z(CPZ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase Z(CPZ) ELISA kit
    E01C2032-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase Z(CPZ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase Z(CPZ) ELISA kit
    E01C2032-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase Z(CPZ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Probable carboxypeptidase (PM20D1) ELISA kit
    E01P0720-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Probable carboxypeptidase (PM20D1) ELISA kit
    E01P0720-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Probable carboxypeptidase (PM20D1) ELISA kit
    E01P0720-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Carboxypeptidase B2 (CPB2) ELISA Kit
    abx054753-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.
    Human Carboxypeptidase B1 (CPB1) ELISA Kit
    abx055595-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Carboxypeptidase E (CPE) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Carboxypeptidase B2 (CPB2) ELISA Kit
    abx253935-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.
    Human Carboxypeptidase B1 (CPB1) ELISA Kit
    abx257718-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.
    Human Carboxypeptidase B1 (CPB1) ELISA Kit
    abx257754-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.
    Human Carboxypeptidase E (CPE) ELISA Kit
    abx252265-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human CPE(Carboxypeptidase E) ELISA Kit
    EH2877 96T
    EUR 524.1
    • Detection range: 0.625-40 ng/ml
    • Uniprot ID: P16870
    • Alias: CPE/Carboxypeptidase H/Convertase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
    Human CPB1(Carboxypeptidase B1) ELISA Kit
    EH4304 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Alias: Carboxypeptidase B1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    Human CPN2(Carboxypeptidase N2) ELISA Kit
    EH4305 96T
    EUR 567.6
    • Detection range: 78.125-5000 pg/ml
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml
    Human CPB2(Carboxypeptidase B2) ELISA Kit
    EH0980 96T
    EUR 567.6
    • Detection range: 3.12-200 ng/ml
    • Uniprot ID: Q96IY4
    • Alias: CPB2(Carboxypeptidase B2)/CPU/TAFI/carboxypeptidase B2/Carboxypeptidase U/PCPB/Plasma carboxypeptidase B/carboxypeptidase B-like protein/Thrombin-activable fibrinolysis inhibitor
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml
    Human Carboxypeptidase A5, CPA5 ELISA KIT
    ELI-10756h 96 Tests
    EUR 824
    Human Carboxypeptidase O, CPO ELISA KIT
    ELI-10896h 96 Tests
    EUR 824
    Human Carboxypeptidase D, CPD ELISA KIT
    ELI-11233h 96 Tests
    EUR 824
    Human Carboxypeptidase Z, CPZ ELISA KIT
    ELI-11234h 96 Tests
    EUR 824
    Human Carboxypeptidase A1, CPA1 ELISA KIT
    ELI-23863h 96 Tests
    EUR 824
    Human Carboxypeptidase A6, CPA6 ELISA KIT
    ELI-25531h 96 Tests
    EUR 824
    Human Carboxypeptidase B2, CPB2 ELISA KIT
    ELI-02200h 96 Tests
    EUR 824
    Human Mast Cell Carboxypeptidase ELISA Kit
    CSB-E13756h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Mast Cell Carboxypeptidase in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Mast Cell Carboxypeptidase ELISA Kit
    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Mast Cell Carboxypeptidase in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Carboxypeptidase B(CPB1) ELISA kit
    CSB-EL005883HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase B (CPB1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Carboxypeptidase B(CPB1) ELISA kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase B(CPB1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Carboxypeptidase E(CPE) ELISA kit
    CSB-EL005886HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase E (CPE) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Carboxypeptidase E(CPE) ELISA kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase E(CPE) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Carboxypeptidase B2 (CPB2) ELISA Kit
    abx573782-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.
    Human Carboxypeptidase A2 (CPA2) ELISA Kit
    abx512714-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Carboxypeptidase A1 (CPA1) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human Carboxypeptidase A5 (CPA5) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human Carboxypeptidase A6 (CPA6) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human Carboxypeptidase B, CPB1 ELISA KIT
    ELI-33947h 96 Tests
    EUR 824
    Human Carboxypeptidase A4, CPA4 ELISA KIT
    ELI-49172h 96 Tests
    EUR 824
    Human Carboxypeptidase E, CPE ELISA KIT
    ELI-50203h 96 Tests
    EUR 824
    Human Carboxypeptidase Z(CPZ)ELISA Kit
    QY-E01337 96T
    EUR 361
    Human Carboxypeptidase X2(CPX2)ELISA Kit
    QY-E01338 96T
    EUR 361
    Human Carboxypeptidase X1(CPX1)ELISA Kit
    QY-E01339 96T
    EUR 361
    Human Carboxypeptidase O(CPO)ELISA Kit
    QY-E01340 96T
    EUR 361
    Human Carboxypeptidase N2(CPN2)ELISA Kit
    QY-E01341 96T
    EUR 361
    Human Carboxypeptidase N1(CPN1)ELISA Kit
    QY-E01342 96T
    EUR 361
    Human Carboxypeptidase E(CPE)ELISA Kit
    QY-E01344 96T
    EUR 361
    Human Carboxypeptidase D(CPD)ELISA Kit
    QY-E01345 96T
    EUR 361
    Human Carboxypeptidase A6(CPA6)ELISA Kit
    QY-E01346 96T
    EUR 361
    Human Carboxypeptidase A5(CPA5)ELISA Kit
    QY-E01347 96T
    EUR 361
    Human Carboxypeptidase A4(CPA4)ELISA Kit
    QY-E01348 96T
    EUR 361
    Human Carboxypeptidase E ELISA Kit (CPE)
    RK01173 96 Tests
    EUR 521
    Human Carboxypeptidase N1 ELISA Kit (CPN1)
    RK01175 96 Tests
    EUR 521
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RDR-CPA4-Hu-48Tests 48 Tests
    EUR 544
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RDR-CPA4-Hu-96Tests 96 Tests
    EUR 756
    Human Carboxypeptidase E (CPE) ELISA Kit
    RDR-CPE-Hu-48Tests 48 Tests
    EUR 544
    Human Carboxypeptidase E (CPE) ELISA Kit
    RDR-CPE-Hu-96Tests 96 Tests
    EUR 756
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    RDR-CPN1-Hu-48Tests 48 Tests
    EUR 544
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    RDR-CPN1-Hu-96Tests 96 Tests
    EUR 756
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    RDR-CPZ-Hu-48Tests 48 Tests
    EUR 544
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    RDR-CPZ-Hu-96Tests 96 Tests
    EUR 756
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    SEF317Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    SEF317Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    SEF317Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    SEF317Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase A4 (CPA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase A4 (CPA4) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase A4 elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase A4 (CPA4) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human Carboxypeptidase E (CPE) ELISA Kit
    SEF322Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase E (CPE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase E (CPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Human Carboxypeptidase E (CPE) ELISA Kit
    SEF322Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase E (CPE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase E (CPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Human Carboxypeptidase E (CPE) ELISA Kit
    SEF322Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase E (CPE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase E (CPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Human Carboxypeptidase E (CPE) ELISA Kit
    SEF322Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase E (CPE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase E (CPE) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Human Carboxypeptidase E (CPE) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase E elisa. Alternative names of the recognized antigen: CPH
    • Enkephalin Convertase
    • Carboxypeptidase H
    • Prohormone-processing carboxypeptidase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase E (CPE) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    SEF323Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N1 (CPN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N1 (CPN1) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    SEF323Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N1 (CPN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N1 (CPN1) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    SEF323Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N1 (CPN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N1 (CPN1) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    SEF323Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N1 (CPN1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N1 (CPN1) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase N1 elisa. Alternative names of the recognized antigen: CPN
    • SCPN
    • ACBP
    • Anaphylatoxin inactivator
    • Arginine carboxypeptidase
    • Kininase-1
    • Lysine carboxypeptidase
    • Plasma carboxypeptidase B
    • Serum carboxypeptidase N
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase N1 (CPN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.
    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP
    • Carboxypeptidase N 83 kDa chain
    • Carboxypeptidase N large subunit
    • Carboxypeptidase N regulatory subunit
    • Carboxypeptidase N polypeptide 2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    SEF326Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase Z (CPZ) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase Z (CPZ) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    SEF326Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase Z (CPZ) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase Z (CPZ) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    SEF326Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase Z (CPZ) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase Z (CPZ) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    SEF326Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase Z (CPZ) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase Z (CPZ) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase Z elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase Z (CPZ) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RD-CPA4-Hu-48Tests 48 Tests
    EUR 521
    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RD-CPA4-Hu-96Tests 96 Tests
    EUR 723
    Human Carboxypeptidase E (CPE) ELISA Kit
    RD-CPE-Hu-48Tests 48 Tests
    EUR 521
    Human Carboxypeptidase E (CPE) ELISA Kit
    RD-CPE-Hu-96Tests 96 Tests
    EUR 723
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    RD-CPN1-Hu-48Tests 48 Tests
    EUR 521
    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    RD-CPN1-Hu-96Tests 96 Tests
    EUR 723
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    RD-CPZ-Hu-48Tests 48 Tests
    EUR 521
    Human Carboxypeptidase Z (CPZ) ELISA Kit
    RD-CPZ-Hu-96Tests 96 Tests
    EUR 723
    Human Neurofilament protein M (NF-M) ELISA kit
    CSB-E16095h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Neurofilament protein M (NF-M) in samples from serum, cerebrospinalfluid (CSF), urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Neurofilament protein M (NF-M) ELISA kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Neurofilament protein M (NF-M) in samples from serum, cerebrospinalfluid(CSF), urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    CPM Blocking Peptide
    DF3899-BP 1mg
    EUR 195
    CPM Conjugated Antibody
    C43071 100ul
    EUR 397
    CPM Conjugated Antibody
    C34549 100ul
    EUR 397
    CPM Conjugated Antibody
    C46545 100ul
    EUR 397
    CPM cloning plasmid
    CSB-CL005897HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1332
    • Sequence: atggacttcccgtgcctctggctagggctgttgctgcctttggtagctgcgctggatttcaactaccaccgccaggaagggatggaagcgtttttgaagactgttgcccaaaactacagttctgtcactcacttacacagtattgggaaatctgtgaaaggtagaaacctgtggg
    • Show more
    Description: A cloning plasmid for the CPM gene.
    CPM Polyclonal Antibody
    ABP51041-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from the Internal region of human CPM at AA range: 40-120
    • Applications tips:
    Description: A polyclonal antibody for detection of CPM from Human. This CPM antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CPM at AA range: 40-120
    CPM Polyclonal Antibody
    ABP51041-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from the Internal region of human CPM at AA range: 40-120
    • Applications tips:
    Description: A polyclonal antibody for detection of CPM from Human. This CPM antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CPM at AA range: 40-120
    CPM Polyclonal Antibody
    ABP51041-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from the Internal region of human CPM at AA range: 40-120
    • Applications tips:
    Description: A polyclonal antibody for detection of CPM from Human. This CPM antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CPM at AA range: 40-120
    CPM Rabbit pAb
    A6565-100ul 100 ul
    EUR 308
    CPM Rabbit pAb
    A6565-200ul 200 ul
    EUR 459

    Human CPM(Carboxypeptidase M) ELISA Kit