Human TPMT(Thiopurine Methyltransferase) ELISA Kit

Human TPMT(Thiopurine Methyltransferase) ELISA Kit

To Order Contact us below: 

    Human Thiopurine Methyltransferase (TPMT) ELISA Kit

    RD-TPMT-Hu-48Tests 48 Tests
    EUR 521

    Human Thiopurine Methyltransferase (TPMT) ELISA Kit

    RD-TPMT-Hu-96Tests 96 Tests
    EUR 723

    Human Thiopurine Methyltransferase(TPMT)

    QY-E05339 96T
    EUR 374

    Human Thiopurine Methyltransferase (TPMT) ELISA Kit

    SEC821Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

    Human Thiopurine Methyltransferase (TPMT) ELISA Kit

    SEC821Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

    Human Thiopurine Methyltransferase (TPMT) ELISA Kit

    SEC821Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

    Human Thiopurine Methyltransferase (TPMT) ELISA Kit

    SEC821Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

    Human Thiopurine Methyltransferase (TPMT) ELISA Kit

    4-SEC821Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Thiopurine Methyltransferase elisa. Alternative names of the recognized antigen: Thiopurine S Methyltransferase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thiopurine Methyltransferase (TPMT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Thiopurine Methyltransferase ELISA Kit (TPMT)

    RK02435 96 Tests
    EUR 521

    Thiopurine Methyltransferase (TPMT) Antibody

    20-abx128186
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Thiopurine Methyltransferase (TPMT) Antibody

    20-abx174750
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Recombinant Thiopurine Methyltransferase (TPMT)

    4-RPC821Hu01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P51580
    • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 26.9kDa
    • Isoelectric Point: 6.7
    Description: Recombinant Human Thiopurine Methyltransferase expressed in: E.coli

    Human Thiopurine Methyltransferase (TPMT) Protein

    20-abx166738
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Thiopurine S-methyltransferase (TPMT)

    1-CSB-RP005854h
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 54.7 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Thiopurine S-methyltransferase(TPMT),partial expressed in E.coli

    Human Thiopurine Methyltransferase (TPMT) CLIA Kit

    20-abx493913
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

    abx573967-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Human TPMT/ Thiopurine S-methyltransferase ELISA Kit

    E2576Hu 1 Kit
    EUR 605

    Human TPMT(Thiopurine S-methyltransferase) ELISA Kit

    EH1175 96T
    EUR 524.1
    • Detection range: 3.125-200 ng/ml
    • Uniprot ID: P51580
    • Alias: TPMT(Thiopurine S-methyltransferase)/Thiopurine methyltransferase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

    Human Thiopurine S- methyltransferase, TPMT ELISA KIT

    ELI-03368h 96 Tests
    EUR 824

    ELISA kit for Human TPMT (Thiopurine Methyltransferase)

    ELK4063 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thiopurine Methyltransferase (TPMT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
    • Show more
    Description: A sandwich ELISA kit for detection of Thiopurine Methyltransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

    20-abx153363
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

    abx250428-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Human thiopurine S-methyltransferase (TPMT) ELISA kit

    CSB-E17858h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human thiopurine S-methyltransferase (TPMT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human thiopurine S-methyltransferase (TPMT) ELISA kit

    1-CSB-E17858h
    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human thiopurine S-methyltransferase (TPMT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Thiopurine S-Methyltransferase (TPMT) Antibody

    20-abx116062
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Thiopurine S-Methyltransferase (TPMT) Antibody

    20-abx110262
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Thiopurine S-Methyltransferase (TPMT) Antibody

    20-abx000960
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Thiopurine S-Methyltransferase (TPMT) Antibody

    20-abx137256
    • EUR 704.00
    • EUR 328.00
    • EUR 230.00
    • 100 ug
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Thiopurine S-Methyltransferase (TPMT) Antibody

    20-abx141576
    • EUR 370.00
    • EUR 606.00
    • EUR 300.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Thiopurine S-Methyltransferase (TPMT) Antibody

    abx238893-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Cow Thiopurine S-Methyltransferase (TPMT) ELISA Kit

    20-abx514841
    • EUR 7911.00
    • EUR 4215.00
    • EUR 973.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Dog Thiopurine S-Methyltransferase (TPMT) ELISA Kit

    20-abx514842
    • EUR 7504.00
    • EUR 3996.00
    • EUR 926.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Thiopurine S-Methyltransferase (TPMT) ELISA Kit

    abx514844-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Rat Thiopurine S-Methyltransferase (TPMT) ELISA Kit

    abx514845-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Rat Tpmt/ Thiopurine S-methyltransferase ELISA Kit

    E1001Ra 1 Kit
    EUR 646

    Mouse Tpmt/ Thiopurine S-methyltransferase ELISA Kit

    E1521Mo 1 Kit
    EUR 632

    Rat Thiopurine S- methyltransferase, Tpmt ELISA KIT

    ELI-03369r 96 Tests
    EUR 886

    Mouse Thiopurine S- methyltransferase, Tpmt ELISA KIT

    ELI-03370m 96 Tests
    EUR 865

    Bovine Thiopurine S- methyltransferase, TPMT ELISA KIT

    ELI-03371b 96 Tests
    EUR 928

    Canine Thiopurine S-methyltransferase, TPMT ELISA KIT

    ELI-03372d 96 Tests
    EUR 928

    Rabbit Thiopurine S- methyltransferase, TPMT ELISA KIT

    ELI-03373Ra 96 Tests
    EUR 928

    ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

    KTE60148-48T 48T
    EUR 354
    Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

    KTE60148-5platesof96wells 5 plates of 96 wells
    EUR 2252
    Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

    KTE60148-96T 96T
    EUR 572
    Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human TPMT (Thiopurine S-Methyltransferase)  Kit

    E-EL-H5563 1 plate of 96 wells
    EUR 534
    • Gentaur's TPMT ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPMT. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human TPMT (Thiopurine S-Methyltransferase)  Kit in samples from Serum, Plasma, Cell supernatant

    Thiopurine S-Methyltransferase (TPMT) Antibody Pair

    abx117377-1pair5x96wellplates 1 pair (5x96 well plates)
    EUR 1010
    • Shipped within 5-10 working days.

    Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse)

    4-PAC821Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TPMT (Leu26~His227)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT)

    TPMT Thiopurine S-methyltransferase Human Recombinant Protein

    PROTP51580 Regular: 20ug
    EUR 317
    Description: TPMT Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 245 amino acids (1-245) and having a molecular mass of 28 kDa. ;Thiopurine S-methyltransferase is purified by proprietary chromatographic techniques.

    Tpmt ELISA Kit| Rat Thiopurine S-methyltransferase ELISA Kit

    EF019410 96 Tests
    EUR 689

    Tpmt ELISA Kit| Mouse Thiopurine S-methyltransferase ELISA Kit

    EF016373 96 Tests
    EUR 689

    TPMT ELISA Kit| Bovine Thiopurine S-methyltransferase ELISA Kit

    EF011970 96 Tests
    EUR 689

    Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), APC

    4-PAC821Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TPMT (Leu26~His227)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with APC.

    Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), Biotinylated

    4-PAC821Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TPMT (Leu26~His227)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with Biotin.

    Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), Cy3

    4-PAC821Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TPMT (Leu26~His227)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with Cy3.

    Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), FITC

    4-PAC821Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TPMT (Leu26~His227)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with FITC.

    Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), HRP

    4-PAC821Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TPMT (Leu26~His227)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with HRP.

    Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), PE

    4-PAC821Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TPMT (Leu26~His227)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with PE.

    Monoclonal Anti-Human Thiopurine S-methyltransferase (TPMT) protein IgG

    AB-22123 5 ug
    EUR 164

    Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), APC-Cy7

    4-PAC821Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TPMT (Leu26~His227)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with APC-Cy7.

    Recombinant (E.Coli) Human Thiopurine S-methyltransferase (TPMT, 1-245 aa) protein

    RP-712 5 ug
    EUR 164

    ELISA kit for Human Thiopurine S-methyltransferase

    EK2628 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Thiopurine S-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Recombinant Human Thiopurine S-methyltransferase

    7-04195 5µg Ask for price

    Recombinant Human Thiopurine S-methyltransferase

    7-04196 20µg Ask for price

    Recombinant Human Thiopurine S-methyltransferase

    7-04197 1mg Ask for price

    Thiopurine S-methyltransferase Protein (Recombinant)

    20-abx073594
    • EUR 4490.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Thiopurine S-methyltransferase Antibody (HRP)

    20-abx108807
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Thiopurine S-methyltransferase Antibody (Biotin)

    20-abx105972
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Thiopurine S-methyltransferase Antibody (FITC)

    20-abx107387
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Thiopurine S-methyltransferase Polyclonal Antibody

    42134-100ul 100ul
    EUR 333

    Thiopurine S-methyltransferase Polyclonal Conjugated Antibody

    C42134 100ul
    EUR 397

    TPMT ELISA KIT|Human

    EF002391 96 Tests
    EUR 689

    Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-100ug

    QP8325-ec-100ug 100ug
    EUR 408

    Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-10ug

    QP8325-ec-10ug 10ug
    EUR 200

    Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-1mg

    QP8325-ec-1mg 1mg
    EUR 1632

    Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-200ug

    QP8325-ec-200ug 200ug
    EUR 634

    Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-500ug

    QP8325-ec-500ug 500ug
    EUR 1060

    Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-50ug

    QP8325-ec-50ug 50ug
    EUR 263

    TPMT ELISA Kit (Human) (OKAN05537)

    OKAN05537 96 Wells
    EUR 792
    Description: Description of target: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.127 ng/mL

    TPMT ELISA Kit (Human) (OKCD08261)

    OKCD08261 96 Wells
    EUR 975
    Description: Description of target: Recombinant Human Thiopurine S-methyltransferase;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

    TPMT ELISA Kit (Bovine) (OKEH07597)

    OKEH07597 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    TPMT ELISA Kit (Dog) (OKEH07598)

    OKEH07598 96 Wells
    EUR 1184
    Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    Human TPMT Antibody

    32795-05111 150 ug
    EUR 261

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    TPMT ELISA Kit (Human) : 96 Wells (OKEH02086)

    OKEH02086 96 Wells
    EUR 662
    Description: Description of target: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.33 ng/mL

    TPMT siRNA

    20-abx905752
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TPMT siRNA

    20-abx937849
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TPMT siRNA

    20-abx937850
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TPMT antibody

    70R-20939 50 ul
    EUR 435
    Description: Rabbit polyclonal TPMT antibody

    TPMT Antibody

    ABD6183 100 ug
    EUR 438

    TPMT antibody

    10R-6122 100 ul
    EUR 691
    Description: Mouse monoclonal TPMT antibody

    TPMT antibody

    10R-6123 100 ul
    EUR 691
    Description: Mouse monoclonal TPMT antibody

    TPMT antibody

    10R-6124 100 ul
    EUR 726
    Description: Mouse monoclonal TPMT antibody

    TPMT antibody

    10R-6125 100 ul
    EUR 691
    Description: Mouse monoclonal TPMT antibody

    TPMT protein

    30R-1110 100 ug
    EUR 397
    Description: Purified recombinant Human TPMT protein

    TPMT Antibody

    32120-100ul 100ul
    EUR 252

    TPMT antibody

    10R-3130 100 ul
    EUR 322
    Description: Mouse monoclonal NANS antibody

    TPMT antibody

    70R-15216 100 ug
    EUR 327
    Description: Rabbit polyclonal TPMT antibody

    TPMT Antibody

    DF6183 200ul
    EUR 304
    Description: TPMT Antibody detects endogenous levels of total TPMT.

    TPMT Antibody

    1-CSB-PA00585A0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

    TPMT Antibody

    1-CSB-PA024110GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    anti-TPMT

    YF-PA24886 50 ul
    EUR 334
    Description: Mouse polyclonal to TPMT

    Human TPMT shRNA Plasmid

    20-abx954923
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    TPMT Recombinant Protein (Human)

    RP032677 100 ug Ask for price

    TPMT Recombinant Protein (Human)

    RP032680 100 ug Ask for price

    Polyclonal TPMT Antibody

    APR10523G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPMT . This antibody is tested and proven to work in the following applications:

    TPMT Conjugated Antibody

    C32120 100ul
    EUR 397

    TPMT cloning plasmid

    CSB-CL024110HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 738
    • Sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaagg
    • Show more
    Description: A cloning plasmid for the TPMT gene.

    TPMT cloning plasmid

    CSB-CL024110HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 738
    • Sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaagg
    • Show more
    Description: A cloning plasmid for the TPMT gene.

    anti- TPMT antibody

    FNab08893 100µg
    EUR 548.75
    • Immunogen: thiopurine S-methyltransferase
    • Uniprot ID: P51580
    • Gene ID: 7172
    • Research Area: Metabolism
    Description: Antibody raised against TPMT

    Anti-TPMT Antibody

    A00671-1 100ug/vial
    EUR 294

    TPMT Rabbit pAb

    A1017-100ul 100 ul
    EUR 308

    TPMT Rabbit pAb

    A1017-200ul 200 ul
    EUR 459

    TPMT Rabbit pAb

    A1017-20ul 20 ul
    EUR 183

    TPMT Rabbit pAb

    A1017-50ul 50 ul
    EUR 223

    TPMT Polyclonal Antibody

    A51617 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    TPMT Rabbit pAb

    A14067-100ul 100 ul
    EUR 308

    TPMT Rabbit pAb

    A14067-200ul 200 ul
    EUR 459

    TPMT Rabbit pAb

    A14067-20ul 20 ul
    EUR 183

    TPMT Rabbit pAb

    A14067-50ul 50 ul
    EUR 223

    TPMT antibody (HRP)

    60R-1492 100 ug
    EUR 327
    Description: Rabbit polyclonal TPMT antibody (HRP)

    TPMT antibody (FITC)

    60R-1493 100 ug
    EUR 327
    Description: Rabbit polyclonal TPMT antibody (FITC)

    TPMT antibody (biotin)

    60R-1494 100 ug
    EUR 327
    Description: Rabbit polyclonal TPMT antibody (biotin)

    TPMT Blocking Peptide

    DF6183-BP 1mg
    EUR 195

    Anti-TPMT antibody

    PAab08893 100 ug
    EUR 386

    Anti-TPMT antibody

    STJ25944 100 µl
    EUR 277
    Description: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.

    Anti-TPMT antibody

    STJ116002 100 µl
    EUR 277
    Description: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.

    Anti-TPMT (1D4)

    YF-MA15930 100 ug
    EUR 363
    Description: Mouse monoclonal to TPMT

    Anti-TPMT (2H3)

    YF-MA15931 100 ug
    EUR 363
    Description: Mouse monoclonal to TPMT

    Anti-TPMT (1B5)

    YF-MA10964 100 ug
    EUR 363
    Description: Mouse monoclonal to TPMT

    Human TPMT Antibody (Biotin Conjugate)

    32795-05121 150 ug
    EUR 369

    TPMT ORF Vector (Human) (pORF)

    ORF010893 1.0 ug DNA
    EUR 95

    TPMT ORF Vector (Human) (pORF)

    ORF010894 1.0 ug DNA
    EUR 95

    Human DNA Methyltransferase 1 ELISA kit

    E01D0320-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human DNA Methyltransferase 1 ELISA kit

    E01D0320-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human DNA Methyltransferase 1 ELISA kit

    E01D0320-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human DNA Methyltransferase 3A ELISA kit

    E01D0321-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human DNA Methyltransferase 3A ELISA kit

    E01D0321-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human DNA Methyltransferase 3A ELISA kit

    E01D0321-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human DNA Methyltransferase 3beta ELISA kit

    E01D0322-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human DNA Methyltransferase 3beta ELISA kit

    E01D0322-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human DNA Methyltransferase 3beta ELISA kit

    E01D0322-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human echol O-methyltransferase ELISA kit

    E01E0200-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human echol O-methyltransferase ELISA kit

    E01E0200-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human echol O-methyltransferase ELISA kit

    E01E0200-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Arsenite methyltransferase(AS3MT) ELISA kit

    E01A1694-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Arsenite methyltransferase(AS3MT) ELISA kit

    E01A1694-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Arsenite methyltransferase(AS3MT) ELISA kit

    E01A1694-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human indolethylamine N- methyltransferase ELISA Kit

    ELA-E2223h 96 Tests
    EUR 824

    Human DNA methyltransferase(DNAM)ELISA Kit

    GA-E1991HM-48T 48T
    EUR 289

    Human DNA methyltransferase(DNAM)ELISA Kit

    GA-E1991HM-96T 96T
    EUR 466

    Human Arsenite methyltransferase, AS3MT ELISA KIT

    ELI-34764h 96 Tests
    EUR 824

    Human DNA methyltransferase,DNAM ELISA Kit

    201-12-1975 96 tests
    EUR 440
    • This DNA methyltransferase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human RNA Methyltransferase(RNMT)ELISA Kit

    QY-E04643 96T
    EUR 394

    Human DNA methyltransferase(DNAM)ELISA Kit

    QY-E04972 96T
    EUR 361

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Mouse TPMT shRNA Plasmid

    20-abx973197
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat TPMT shRNA Plasmid

    20-abx991194
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    TPMT Antibody, HRP conjugated

    1-CSB-PA00585B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    TPMT Antibody, FITC conjugated

    1-CSB-PA00585C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    TPMT Antibody, Biotin conjugated

    1-CSB-PA00585D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    TPMT Recombinant Protein (Rat)

    RP234419 100 ug Ask for price

    TPMT Recombinant Protein (Mouse)

    RP180734 100 ug Ask for price

    Human Indolethylamine N-Methyltransferase (INMT) ELISA Kit

    abx519772-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Betaine Homocysteine Methyltransferase (BHMT) ELISA Kit

    abx556316-96tests 96 tests
    EUR 668
    • Shipped within 1-3 weeks.

    Human tRNA Methyltransferase 61A (TRMT61A) ELISA Kit

    20-abx585356
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human Catechol O-Methyltransferase (COMT) ELISA Kit

    abx570775-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Human Acetylserotonin O-Methyltransferase (ASMT) ELISA Kit

    abx571370-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

    abx571713-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

    abx571840-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

    abx572824-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human ASMT/ Acetylserotonin O-methyltransferase ELISA Kit

    E0212Hu 1 Kit
    EUR 605

    Human Nicotinamide N methyltransferase(NNMT) ELISA kit

    E01N0553-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Nicotinamide N methyltransferase(NNMT) ELISA kit

    E01N0553-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Nicotinamide N methyltransferase(NNMT) ELISA kit

    E01N0553-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human COMT/ Catechol O-methyltransferase ELISA Kit

    E0534Hu 1 Kit
    EUR 605

    Human Glycine N methyltransferase(GNMT) ELISA kit

    E01G0435-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Glycine N methyltransferase(GNMT) ELISA kit

    E01G0435-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Glycine N methyltransferase(GNMT) ELISA kit

    E01G0435-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit

    E01P0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit

    E01P0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit

    E01P0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Human Glycine N-methyltransferase

    EK3139 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Glycine N-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Nicotinamide N-methyltransferase

    EK3603 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Nicotinamide N-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Hydroxyindole O-methyltransferase

    EK3690 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Hydroxyindole O-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Catechol O-methyltransferase

    EK4941 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Catechol O-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human HNMT(Histamine N-methyltransferase) ELISA Kit

    EH4167 96T
    EUR 524.1
    • Detection range: 31.25-2000 pg/ml
    • Uniprot ID: P50135
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

    Human GNMT/ Glycine N-methyltransferase ELISA Kit

    E1029Hu 1 Kit
    EUR 605

    Human HNMT/ Histamine N-methyltransferase ELISA Kit

    E1151Hu 1 Kit
    EUR 605

    Human NNMT/ Nicotinamide N-methyltransferase ELISA Kit

    E1758Hu 1 Kit
    EUR 605

    Human GNMT(Glycine N-methyltransferase) ELISA Kit

    EH1463 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: Q14749
    • Alias: GNMT/Glycine N-methyltransferase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human NNMT(Nicotinamide N-methyltransferase) ELISA Kit

    EH1737 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P40261
    • Alias: INHBB/Inhibin beta B chain/Activin beta-B chain/Inhibin, Beta B/Inhibin, Beta-2/inhibin, beta B
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human COMT(Catechol O-methyltransferase) ELISA Kit

    EH2462 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P21964
    • Alias: COMT/catechol O-methyltransferase/catechol-O-methyltransferase/EC 2.1.1.6/
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Phenylethanolamine N- methyltransferase, PNMT ELISA KIT

    ELI-12577h 96 Tests
    EUR 824

    Human Nicotinamide N- methyltransferase, NNMT ELISA KIT

    ELI-21228h 96 Tests
    EUR 824

    Human Putative methyltransferase NSUN5, NSUN5 ELISA KIT

    ELI-21343h 96 Tests
    EUR 824

    Human Putative methyltransferase NSUN4, NSUN4 ELISA KIT

    ELI-22412h 96 Tests
    EUR 824

    Human Putative methyltransferase NSUN7, NSUN7 ELISA KIT

    ELI-22413h 96 Tests
    EUR 824

    Human Probable methyltransferase TARBP1, TARBP1 ELISA KIT

    ELI-23756h 96 Tests
    EUR 824

    Human Guanidinoacetate N- methyltransferase, GAMT ELISA KIT

    ELI-26600h 96 Tests
    EUR 824

    Human Indolethylamine N- methyltransferase, INMT ELISA KIT

    ELI-07112h 96 Tests
    EUR 824

    Human Transmembrane O- methyltransferase, LRTOMT ELISA KIT

    ELI-16942h 96 Tests
    EUR 824

    Human Probable methyltransferase BCDIN3D, BCDIN3D ELISA KIT

    ELI-33367h 96 Tests
    EUR 824

    Human Putative methyltransferase NSUN3, NSUN3 ELISA KIT

    ELI-44215h 96 Tests
    EUR 824

    Human Putative methyltransferase NSUN5C, NSUN5P2 ELISA KIT

    ELI-44450h 96 Tests
    EUR 824

    Human Glycine N- methyltransferase, GNMT ELISA KIT

    ELI-47245h 96 Tests
    EUR 824

    Human Catechol O- methyltransferase, COMT ELISA KIT

    ELI-32354h 96 Tests
    EUR 824

    Human Putative methyltransferase NSUN6, NSUN6 ELISA KIT

    ELI-39764h 96 Tests
    EUR 824

    Human Histamine N- methyltransferase, HNMT ELISA KIT

    ELI-42704h 96 Tests
    EUR 824

    Human Putative methyltransferase KIAA1456, KIAA1456 ELISA KIT

    ELI-47823h 96 Tests
    EUR 824

    Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

    20-abx150754
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Betaine Homocysteine Methyltransferase (BHMT) ELISA Kit

    20-abx150807
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Catechol-O-Methyltransferase (COMT) ELISA Kit

    20-abx151145
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

    20-abx151332
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

    20-abx151333
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

    20-abx151334
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

    20-abx151700
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

    20-abx152532
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

    abx352271-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human DNA Methyltransferase 2 (DNMT2) ELISA Kit

    abx352272-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Methyltransferase Like 16 (METT10D) ELISA Kit

    abx381416-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Methyltransferase Like 1 (METTL1) ELISA Kit

    abx381417-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Lysine Methyltransferase 2E (KMT2E) ELISA Kit

    abx381467-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Phenylethanolamine N-methyltransferase (PNMT) ELISA Kit

    abx382327-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Lysine Methyltransferase 5A (SETD8) ELISA Kit

    abx383128-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human tRNA Methyltransferase 6 (TRMT6) ELISA Kit

    abx383953-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human tRNA Methyltransferase 61B (TRMT61B) ELISA Kit

    abx383954-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Coenzyme Q3, Methyltransferase (COQ3) ELISA Kit

    abx385005-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Phosphatidylethanolamine N-methyltransferase (PEMT) ELISA Kit

    abx385271-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Coenzyme Q5, Methyltransferase (COQ5) ELISA Kit

    abx386637-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Histamine N-Methyltransferase (HNMT) ELISA Kit

    abx257686-96tests 96 tests
    EUR 739
    • Shipped within 1-3 weeks.

    Human Nicotinamide N-methyltransferase (NNMT) ELISA Kit

    abx251040-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Human Catechol O-Methyltransferase (COMT) ELISA Kit

    abx251828-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Human Guanidinoacetate N-Methyltransferase (GAMT) ELISA Kit

    abx387492-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human DNA methyltransferase 1,DNAM1 ELISA Kit

    201-12-2171 96 tests
    EUR 440
    • This DNA methyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

    DLR-ASMT-Hu-48T 48T
    EUR 517
    • Should the Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

    DLR-ASMT-Hu-96T 96T
    EUR 673
    • Should the Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

    DLR-NNMT-Hu-48T 48T
    EUR 517
    • Should the Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide-N-Methyltransferase (NNMT) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

    DLR-NNMT-Hu-96T 96T
    EUR 673
    • Should the Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide-N-Methyltransferase (NNMT) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Catechol-O-Methyltransferase (COMT) ELISA Kit

    DLR-COMT-Hu-48T 48T
    EUR 517
    • Should the Human Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Catechol-O-Methyltransferase (COMT) ELISA Kit

    DLR-COMT-Hu-96T 96T
    EUR 673
    • Should the Human Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

    DLR-DNMT1-Hu-48T 48T
    EUR 517
    • Should the Human DNA Methyltransferase 1 (DNMT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 1 (DNMT1) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

    DLR-DNMT1-Hu-96T 96T
    EUR 673
    • Should the Human DNA Methyltransferase 1 (DNMT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 1 (DNMT1) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

    DLR-DNMT3A-Hu-48T 48T
    EUR 517
    • Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

    DLR-DNMT3A-Hu-96T 96T
    EUR 673
    • Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

    DLR-DNMT3B-Hu-48T 48T
    EUR 517
    • Should the Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3B (DNMT3B) in samples from tissue homogenates or other biological fluids.

    Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

    DLR-DNMT3B-Hu-96T 96T
    EUR 673
    • Should the Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3B (DNMT3B) in samples from tissue homogenates or other biological fluids.

    Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

    DLR-GNMT-Hu-48T 48T
    EUR 517
    • Should the Human Glycine-N-Methyltransferase (GNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Glycine-N-Methyltransferase (GNMT) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

    DLR-GNMT-Hu-96T 96T
    EUR 673
    • Should the Human Glycine-N-Methyltransferase (GNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Glycine-N-Methyltransferase (GNMT) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

    DLR-TRMT61B-Hu-48T 48T
    EUR 517
    • Should the Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human TRNA Methyltransferase 61B (TRMT61B) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

    DLR-TRMT61B-Hu-96T 96T
    EUR 673
    • Should the Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human TRNA Methyltransferase 61B (TRMT61B) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

    RDR-TRMT61B-Hu-48Tests 48 Tests
    EUR 544

    Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

    RDR-TRMT61B-Hu-96Tests 96 Tests
    EUR 756

    Human DNA Methyltransferase 1 ELISA Kit (DNMT1)

    RK01276 96 Tests
    EUR 521

    Human DNA Methyltransferase 3A ELISA Kit (DNMT3A)

    RK01277 96 Tests
    EUR 521

    Human Glycine-N-Methyltransferase ELISA Kit (GNMT)

    RK01483 96 Tests
    EUR 521

    Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

    RD-ASMT-Hu-48Tests 48 Tests
    EUR 521

    Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

    RD-ASMT-Hu-96Tests 96 Tests
    EUR 723

    Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

    RD-NNMT-Hu-48Tests 48 Tests
    EUR 521

    Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

    RD-NNMT-Hu-96Tests 96 Tests
    EUR 723

    Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

    RD-GNMT-Hu-48Tests 48 Tests
    EUR 521

    Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

    RD-GNMT-Hu-96Tests 96 Tests
    EUR 723

    Human Catechol-O-Methyltransferase (COMT) ELISA Kit

    RDR-COMT-Hu-48Tests 48 Tests
    EUR 544

    Human Catechol-O-Methyltransferase (COMT) ELISA Kit

    RDR-COMT-Hu-96Tests 96 Tests
    EUR 756

    Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

    RDR-DNMT1-Hu-48Tests 48 Tests
    EUR 544

    Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

    RDR-DNMT1-Hu-96Tests 96 Tests
    EUR 756

    Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

    RDR-DNMT3A-Hu-48Tests 48 Tests
    EUR 544

    Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

    RDR-DNMT3A-Hu-96Tests 96 Tests
    EUR 756

    Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

    RDR-DNMT3B-Hu-48Tests 48 Tests
    EUR 544

    Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

    RDR-DNMT3B-Hu-96Tests 96 Tests
    EUR 756

    Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

    RDR-GNMT-Hu-48Tests 48 Tests
    EUR 544

    Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

    RDR-GNMT-Hu-96Tests 96 Tests
    EUR 756

    Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

    RDR-NNMT-Hu-48Tests 48 Tests
    EUR 544

    Human TPMT(Thiopurine Methyltransferase) ELISA Kit