Human TPMT(Thiopurine Methyltransferase) ELISA Kit

Human TPMT(Thiopurine Methyltransferase) ELISA Kit

To Order Contact us below: 

Human Thiopurine Methyltransferase (TPMT) ELISA Kit
RD-TPMT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Thiopurine Methyltransferase (TPMT) ELISA Kit
RD-TPMT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Thiopurine Methyltransferase(TPMT)
QY-E05339	Qayee Biotechnology	96T	EUR 374

Human Thiopurine Methyltransferase ELISA Kit (TPMT)
RK02435	Abclonal	96 Tests	EUR 521

Human Thiopurine Methyltransferase (TPMT) ELISA Kit
SEC821Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit
SEC821Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit
SEC821Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit
SEC821Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit
4-SEC821Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Thiopurine Methyltransferase elisa. Alternative names of the recognized antigen: Thiopurine S Methyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thiopurine Methyltransferase (TPMT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Thiopurine Methyltransferase (TPMT) Antibody
20-abx128186	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thiopurine Methyltransferase (TPMT) Antibody
20-abx174750	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Thiopurine Methyltransferase (TPMT)
4-RPC821Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51580 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.9kDa Isoelectric Point: 6.7
Description: Recombinant Human Thiopurine Methyltransferase expressed in: E.coli

Human Thiopurine S-methyltransferase (TPMT)
1-CSB-RP005854h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Thiopurine S-methyltransferase(TPMT),partial expressed in E.coli

Human Thiopurine Methyltransferase (TPMT) Protein
20-abx166738	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Thiopurine Methyltransferase (TPMT) CLIA Kit
20-abx493913	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit
20-abx153363	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit
abx250428-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human TPMT/ Thiopurine S-methyltransferase ELISA Kit
E2576Hu	Sunlong	1 Kit	EUR 605

Human TPMT(Thiopurine S-methyltransferase) ELISA Kit
EH1175	FN Test	96T	EUR 524.1
Detection range: 3.125-200 ng/ml Uniprot ID: P51580 Alias: TPMT(Thiopurine S-methyltransferase)/Thiopurine methyltransferase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Thiopurine S- methyltransferase, TPMT ELISA KIT
ELI-03368h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human TPMT (Thiopurine Methyltransferase)
ELK4063	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thiopurine Methyltransferase (TPMT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t Show more
Description: A sandwich ELISA kit for detection of Thiopurine Methyltransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human thiopurine S-methyltransferase (TPMT) ELISA kit
CSB-E17858h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human thiopurine S-methyltransferase (TPMT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human thiopurine S-methyltransferase (TPMT) ELISA kit
1-CSB-E17858h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human thiopurine S-methyltransferase (TPMT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit
abx573967-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody
20-abx110262	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody
20-abx116062	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody
20-abx137256	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody
20-abx141576	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody
abx238893-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody
20-abx000960	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Rat Tpmt/ Thiopurine S-methyltransferase ELISA Kit
E1001Ra	Sunlong	1 Kit	EUR 646

Mouse Tpmt/ Thiopurine S-methyltransferase ELISA Kit
E1521Mo	Sunlong	1 Kit	EUR 632

Rat Thiopurine S- methyltransferase, Tpmt ELISA KIT
ELI-03369r	Lifescience Market	96 Tests	EUR 886

Mouse Thiopurine S- methyltransferase, Tpmt ELISA KIT
ELI-03370m	Lifescience Market	96 Tests	EUR 865

Bovine Thiopurine S- methyltransferase, TPMT ELISA KIT
ELI-03371b	Lifescience Market	96 Tests	EUR 928

Canine Thiopurine S-methyltransferase, TPMT ELISA KIT
ELI-03372d	Lifescience Market	96 Tests	EUR 928

Rabbit Thiopurine S- methyltransferase, TPMT ELISA KIT
ELI-03373Ra	Lifescience Market	96 Tests	EUR 928

Cow Thiopurine S-Methyltransferase (TPMT) ELISA Kit
20-abx514841	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Dog Thiopurine S-Methyltransferase (TPMT) ELISA Kit
20-abx514842	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Thiopurine S-Methyltransferase (TPMT) ELISA Kit
abx514844-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Thiopurine S-Methyltransferase (TPMT) ELISA Kit
abx514845-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)
KTE60148-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)
KTE60148-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)
KTE60148-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TPMT (Thiopurine S-Methyltransferase)  Kit
E-EL-H5563	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TPMT ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPMT. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPMT (Thiopurine S-Methyltransferase)  Kit in samples from Serum, Plasma, Cell supernatant

Thiopurine S-Methyltransferase (TPMT) Antibody Pair
abx117377-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

Tpmt ELISA Kit| Rat Thiopurine S-methyltransferase ELISA Kit
EF019410	Lifescience Market	96 Tests	EUR 689

Tpmt ELISA Kit| Mouse Thiopurine S-methyltransferase ELISA Kit
EF016373	Lifescience Market	96 Tests	EUR 689

TPMT ELISA Kit| Bovine Thiopurine S-methyltransferase ELISA Kit
EF011970	Lifescience Market	96 Tests	EUR 689

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse)
4-PAC821Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPMT (Leu26~His227) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT)

TPMT Thiopurine S-methyltransferase Human Recombinant Protein
PROTP51580	BosterBio	Regular: 20ug	EUR 317
Description: TPMT Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 245 amino acids (1-245) and having a molecular mass of 28 kDa. ;Thiopurine S-methyltransferase is purified by proprietary chromatographic techniques.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), APC
4-PAC821Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPMT (Leu26~His227) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with APC.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC821Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPMT (Leu26~His227) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with Biotin.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC821Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPMT (Leu26~His227) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with Cy3.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), FITC
4-PAC821Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPMT (Leu26~His227) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with FITC.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), HRP
4-PAC821Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPMT (Leu26~His227) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with HRP.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), PE
4-PAC821Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPMT (Leu26~His227) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with PE.

Monoclonal Anti-Human Thiopurine S-methyltransferase (TPMT) protein IgG
AB-22123	Alpha Diagnostics	5 ug	EUR 164

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC821Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPMT (Leu26~His227) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with APC-Cy7.

Recombinant (E.Coli) Human Thiopurine S-methyltransferase (TPMT, 1-245 aa) protein
RP-712	Alpha Diagnostics	5 ug	EUR 164

ELISA kit for Human Thiopurine S-methyltransferase
EK2628	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Thiopurine S-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Thiopurine S-methyltransferase
7-04195	CHI Scientific	5µg	Ask for price

Recombinant Human Thiopurine S-methyltransferase
7-04196	CHI Scientific	20µg	Ask for price

Recombinant Human Thiopurine S-methyltransferase
7-04197	CHI Scientific	1mg	Ask for price

Thiopurine S-methyltransferase Polyclonal Antibody
42134-100ul	SAB	100ul	EUR 333

Thiopurine S-methyltransferase Antibody (Biotin)
20-abx105972	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thiopurine S-methyltransferase Antibody (FITC)
20-abx107387	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thiopurine S-methyltransferase Antibody (HRP)
20-abx108807	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thiopurine S-methyltransferase Protein (Recombinant)
20-abx073594	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Thiopurine S-methyltransferase Polyclonal Conjugated Antibody
C42134	SAB	100ul	EUR 397

TPMT ELISA KIT|Human
EF002391	Lifescience Market	96 Tests	EUR 689

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-100ug
QP8325-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-10ug
QP8325-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-1mg
QP8325-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-200ug
QP8325-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-500ug
QP8325-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-50ug
QP8325-ec-50ug	EnQuireBio	50ug	EUR 263

Human TPMT Antibody
32795-05111	AssayPro	150 ug	EUR 261

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TPMT protein
30R-1110	Fitzgerald	100 ug	EUR 397
Description: Purified recombinant Human TPMT protein

TPMT antibody
70R-20939	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TPMT antibody

TPMT antibody
70R-15216	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal TPMT antibody

TPMT Antibody
32120-100ul	SAB	100ul	EUR 252

TPMT antibody
10R-3130	Fitzgerald	100 ul	EUR 322
Description: Mouse monoclonal NANS antibody

TPMT antibody
10R-6122	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT antibody
10R-6123	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT antibody
10R-6124	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal TPMT antibody

TPMT antibody
10R-6125	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT Antibody
1-CSB-PA00585A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

TPMT Antibody
DF6183	Affbiotech	200ul	EUR 304
Description: TPMT Antibody detects endogenous levels of total TPMT.

TPMT Antibody
1-CSB-PA024110GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPMT siRNA
20-abx905752	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPMT siRNA
20-abx937849	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPMT siRNA
20-abx937850	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPMT Antibody
ABD6183	Lifescience Market	100 ug	EUR 438

anti-TPMT
YF-PA24886	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TPMT

Human TPMT shRNA Plasmid
20-abx954923	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TPMT Recombinant Protein (Human)
RP032677	ABM	100 ug	Ask for price

TPMT Recombinant Protein (Human)
RP032680	ABM	100 ug	Ask for price

TPMT Rabbit pAb
A1017-100ul	Abclonal	100 ul	EUR 308

TPMT Rabbit pAb
A1017-200ul	Abclonal	200 ul	EUR 459

TPMT Rabbit pAb
A1017-20ul	Abclonal	20 ul	EUR 183

TPMT Rabbit pAb
A1017-50ul	Abclonal	50 ul	EUR 223

TPMT Rabbit pAb
A14067-100ul	Abclonal	100 ul	EUR 308

TPMT Rabbit pAb
A14067-200ul	Abclonal	200 ul	EUR 459

TPMT Rabbit pAb
A14067-20ul	Abclonal	20 ul	EUR 183

TPMT Rabbit pAb
A14067-50ul	Abclonal	50 ul	EUR 223

TPMT antibody (HRP)
60R-1492	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal TPMT antibody (HRP)

TPMT antibody (FITC)
60R-1493	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal TPMT antibody (FITC)

TPMT antibody (biotin)
60R-1494	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal TPMT antibody (biotin)

Polyclonal TPMT Antibody
APR10523G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPMT . This antibody is tested and proven to work in the following applications:

TPMT Blocking Peptide
DF6183-BP	Affbiotech	1mg	EUR 195

Anti-TPMT Antibody
A00671-1	BosterBio	100ug/vial	EUR 294

TPMT Conjugated Antibody
C32120	SAB	100ul	EUR 397

TPMT cloning plasmid
CSB-CL024110HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 738 Sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaagg Show more
Description: A cloning plasmid for the TPMT gene.

TPMT cloning plasmid
CSB-CL024110HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 738 Sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaagg Show more
Description: A cloning plasmid for the TPMT gene.

TPMT Polyclonal Antibody
A51617	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

anti- TPMT antibody
FNab08893	FN Test	100µg	EUR 548.75
Immunogen: thiopurine S-methyltransferase Uniprot ID: P51580 Gene ID: 7172 Research Area: Metabolism
Description: Antibody raised against TPMT

Anti-TPMT antibody
PAab08893	Lifescience Market	100 ug	EUR 386

Anti-TPMT antibody
STJ25944	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.

Anti-TPMT antibody
STJ116002	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.

Anti-TPMT (1B5)
YF-MA10964	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TPMT

Anti-TPMT (1D4)
YF-MA15930	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TPMT

Anti-TPMT (2H3)
YF-MA15931	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TPMT

Human DNA methyltransferase,DNAM ELISA Kit
201-12-1975	SunredBio	96 tests	EUR 440
This DNA methyltransferase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Arsenite methyltransferase(AS3MT) ELISA kit
E01A1694-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arsenite methyltransferase(AS3MT) ELISA kit
E01A1694-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arsenite methyltransferase(AS3MT) ELISA kit
E01A1694-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 1 ELISA kit
E01D0320-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 1 ELISA kit
E01D0320-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 1 ELISA kit
E01D0320-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3A ELISA kit
E01D0321-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3A ELISA kit
E01D0321-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3A ELISA kit
E01D0321-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3beta ELISA kit
E01D0322-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3beta ELISA kit
E01D0322-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3beta ELISA kit
E01D0322-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human echol O-methyltransferase ELISA kit
E01E0200-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human echol O-methyltransferase ELISA kit
E01E0200-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human echol O-methyltransferase ELISA kit
E01E0200-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human indolethylamine N- methyltransferase ELISA Kit
ELA-E2223h	Lifescience Market	96 Tests	EUR 824

Human DNA methyltransferase(DNAM)ELISA Kit
GA-E1991HM-48T	GenAsia Biotech	48T	EUR 289

Human DNA methyltransferase(DNAM)ELISA Kit
GA-E1991HM-96T	GenAsia Biotech	96T	EUR 466

Human Arsenite methyltransferase, AS3MT ELISA KIT
ELI-34764h	Lifescience Market	96 Tests	EUR 824

Human RNA Methyltransferase(RNMT)ELISA Kit
QY-E04643	Qayee Biotechnology	96T	EUR 394

Human DNA methyltransferase(DNAM)ELISA Kit
QY-E04972	Qayee Biotechnology	96T	EUR 361

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human TPMT Antibody (Biotin Conjugate)
32795-05121	AssayPro	150 ug	EUR 369

TPMT ORF Vector (Human) (pORF)
ORF010893	ABM	1.0 ug DNA	EUR 95

TPMT ORF Vector (Human) (pORF)
ORF010894	ABM	1.0 ug DNA	EUR 95

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human DNA methyltransferase 1,DNAM1 ELISA Kit
201-12-2171	SunredBio	96 tests	EUR 440
This DNA methyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
DLR-ASMT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
DLR-ASMT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Catechol-O-Methyltransferase (COMT) ELISA Kit
DLR-COMT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Catechol-O-Methyltransferase (COMT) ELISA Kit
DLR-COMT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit
DLR-TRMT61B-Hu-48T	DL Develop	48T	EUR 517
Should the Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TRNA Methyltransferase 61B (TRMT61B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit
DLR-TRMT61B-Hu-96T	DL Develop	96T	EUR 673
Should the Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TRNA Methyltransferase 61B (TRMT61B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit
DLR-NNMT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide-N-Methyltransferase (NNMT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit
DLR-NNMT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide-N-Methyltransferase (NNMT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit
DLR-DNMT1-Hu-48T	DL Develop	48T	EUR 517
Should the Human DNA Methyltransferase 1 (DNMT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 1 (DNMT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit
DLR-DNMT1-Hu-96T	DL Develop	96T	EUR 673
Should the Human DNA Methyltransferase 1 (DNMT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 1 (DNMT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
DLR-DNMT3A-Hu-48T	DL Develop	48T	EUR 517
Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
DLR-DNMT3A-Hu-96T	DL Develop	96T	EUR 673
Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit
DLR-DNMT3B-Hu-48T	DL Develop	48T	EUR 517
Should the Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3B (DNMT3B) in samples from tissue homogenates or other biological fluids.

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit
DLR-DNMT3B-Hu-96T	DL Develop	96T	EUR 673
Should the Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3B (DNMT3B) in samples from tissue homogenates or other biological fluids.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit
DLR-GNMT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Glycine-N-Methyltransferase (GNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycine-N-Methyltransferase (GNMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit
DLR-GNMT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Glycine-N-Methyltransferase (GNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycine-N-Methyltransferase (GNMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nicotinamide N methyltransferase(NNMT) ELISA kit
E01N0553-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide N methyltransferase(NNMT) ELISA kit
E01N0553-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide N methyltransferase(NNMT) ELISA kit
E01N0553-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human COMT/ Catechol O-methyltransferase ELISA Kit
E0534Hu	Sunlong	1 Kit	EUR 605

Human Glycine N methyltransferase(GNMT) ELISA kit
E01G0435-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycine N methyltransferase(GNMT) ELISA kit
E01G0435-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycine N methyltransferase(GNMT) ELISA kit
E01G0435-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ASMT/ Acetylserotonin O-methyltransferase ELISA Kit
E0212Hu	Sunlong	1 Kit	EUR 605

Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit
E01P0854-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit
E01P0854-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit
E01P0854-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
20-abx150754	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Betaine Homocysteine Methyltransferase (BHMT) ELISA Kit
20-abx150807	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Catechol-O-Methyltransferase (COMT) ELISA Kit
20-abx151145	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit
20-abx151332	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
20-abx151333	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit
20-abx151334	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit
20-abx151700	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit
20-abx152532	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Histamine N-Methyltransferase (HNMT) ELISA Kit
abx257686-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Human Nicotinamide N-methyltransferase (NNMT) ELISA Kit
abx251040-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Catechol O-Methyltransferase (COMT) ELISA Kit
abx251828-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

ELISA kit for Human Catechol O-methyltransferase
EK4941	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Catechol O-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human COMT(Catechol O-methyltransferase) ELISA Kit
EH2462	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P21964 Alias: COMT/catechol O-methyltransferase/catechol-O-methyltransferase/EC 2.1.1.6/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human HNMT(Histamine N-methyltransferase) ELISA Kit
EH4167	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: P50135
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

ELISA kit for Human Glycine N-methyltransferase
EK3139	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Glycine N-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Nicotinamide N-methyltransferase
EK3603	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Nicotinamide N-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Hydroxyindole O-methyltransferase
EK3690	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Hydroxyindole O-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GNMT/ Glycine N-methyltransferase ELISA Kit
E1029Hu	Sunlong	1 Kit	EUR 605

Human HNMT/ Histamine N-methyltransferase ELISA Kit
E1151Hu	Sunlong	1 Kit	EUR 605

Human NNMT/ Nicotinamide N-methyltransferase ELISA Kit
E1758Hu	Sunlong	1 Kit	EUR 605

Human GNMT(Glycine N-methyltransferase) ELISA Kit
EH1463	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q14749 Alias: GNMT/Glycine N-methyltransferase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human NNMT(Nicotinamide N-methyltransferase) ELISA Kit
EH1737	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P40261 Alias: INHBB/Inhibin beta B chain/Activin beta-B chain/Inhibin, Beta B/Inhibin, Beta-2/inhibin, beta B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transmembrane O- methyltransferase, LRTOMT ELISA KIT
ELI-16942h	Lifescience Market	96 Tests	EUR 824

Human Phenylethanolamine N- methyltransferase, PNMT ELISA KIT
ELI-12577h	Lifescience Market	96 Tests	EUR 824

Human Nicotinamide N- methyltransferase, NNMT ELISA KIT
ELI-21228h	Lifescience Market	96 Tests	EUR 824

Human Putative methyltransferase NSUN5, NSUN5 ELISA KIT
ELI-21343h	Lifescience Market	96 Tests	EUR 824

Human Putative methyltransferase NSUN4, NSUN4 ELISA KIT
ELI-22412h	Lifescience Market	96 Tests	EUR 824

Human Putative methyltransferase NSUN7, NSUN7 ELISA KIT
ELI-22413h	Lifescience Market	96 Tests	EUR 824

Human Probable methyltransferase TARBP1, TARBP1 ELISA KIT
ELI-23756h	Lifescience Market	96 Tests	EUR 824

Human Indolethylamine N- methyltransferase, INMT ELISA KIT
ELI-07112h	Lifescience Market	96 Tests	EUR 824

Human Guanidinoacetate N- methyltransferase, GAMT ELISA KIT
ELI-26600h	Lifescience Market	96 Tests	EUR 824

Human Histamine N- methyltransferase, HNMT ELISA KIT
ELI-42704h	Lifescience Market	96 Tests	EUR 824

Human Putative methyltransferase NSUN3, NSUN3 ELISA KIT
ELI-44215h	Lifescience Market	96 Tests	EUR 824

Human Putative methyltransferase NSUN5C, NSUN5P2 ELISA KIT
ELI-44450h	Lifescience Market	96 Tests	EUR 824

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit
abx352271-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human DNA Methyltransferase 2 (DNMT2) ELISA Kit
abx352272-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human tRNA Methyltransferase 6 (TRMT6) ELISA Kit
abx383953-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human tRNA Methyltransferase 61B (TRMT61B) ELISA Kit
abx383954-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Coenzyme Q3, Methyltransferase (COQ3) ELISA Kit
abx385005-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Phosphatidylethanolamine N-methyltransferase (PEMT) ELISA Kit
abx385271-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Methyltransferase Like 16 (METT10D) ELISA Kit
abx381416-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Methyltransferase Like 1 (METTL1) ELISA Kit
abx381417-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Lysine Methyltransferase 2E (KMT2E) ELISA Kit
abx381467-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Phenylethanolamine N-methyltransferase (PNMT) ELISA Kit
abx382327-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Lysine Methyltransferase 5A (SETD8) ELISA Kit
abx383128-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Betaine Homocysteine Methyltransferase (BHMT) ELISA Kit
abx556316-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Catechol O-Methyltransferase (COMT) ELISA Kit
abx570775-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Acetylserotonin O-Methyltransferase (ASMT) ELISA Kit
abx571370-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
abx571713-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit
abx571840-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit
abx572824-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human tRNA Methyltransferase 61A (TRMT61A) ELISA Kit
20-abx585356	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Indolethylamine N-Methyltransferase (INMT) ELISA Kit
abx519772-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Coenzyme Q5, Methyltransferase (COQ5) ELISA Kit
abx386637-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Guanidinoacetate N-Methyltransferase (GAMT) ELISA Kit
abx387492-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Catechol O- methyltransferase, COMT ELISA KIT
ELI-32354h	Lifescience Market	96 Tests	EUR 824

Human Probable methyltransferase BCDIN3D, BCDIN3D ELISA KIT
ELI-33367h	Lifescience Market	96 Tests	EUR 824

Human Putative methyltransferase NSUN6, NSUN6 ELISA KIT
ELI-39764h	Lifescience Market	96 Tests	EUR 824

Human Putative methyltransferase KIAA1456, KIAA1456 ELISA KIT
ELI-47823h	Lifescience Market	96 Tests	EUR 824

Human Glycine N- methyltransferase, GNMT ELISA KIT
ELI-47245h	Lifescience Market	96 Tests	EUR 824

Human Indolethylamine-N-Methyltransferase(INMT)ELISA Kit
QY-E00419	Qayee Biotechnology	96T	EUR 361

Human Phosphatidylethanolamine-N-Methyltransferase(PEMT)ELISA Kit
QY-E02269	Qayee Biotechnology	96T	EUR 361

Human Phenylethanolamine-N-Methyltransferase(PNMT)ELISA Kit
QY-E04148	Qayee Biotechnology	96T	EUR 361

Human DNA methyltransferase 1(DNAM1)ELISA Kit
QY-E04971	Qayee Biotechnology	96T	EUR 361

Human Histamine N-methyltransferase(HNMT) ELISA Kit
QY-E05419	Qayee Biotechnology	96T	EUR 361

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit
RDR-TRMT61B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit
RDR-TRMT61B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human DNA Methyltransferase 1 ELISA Kit (DNMT1)
RK01276	Abclonal	96 Tests	EUR 521

Human DNA Methyltransferase 3A ELISA Kit (DNMT3A)
RK01277	Abclonal	96 Tests	EUR 521

Human Glycine-N-Methyltransferase ELISA Kit (GNMT)
RK01483	Abclonal	96 Tests	EUR 521

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
RDR-ASMT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
RDR-ASMT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Catechol-O-Methyltransferase (COMT) ELISA Kit
RDR-COMT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Catechol-O-Methyltransferase (COMT) ELISA Kit
RDR-COMT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit
RDR-DNMT1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit
RDR-DNMT1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RDR-DNMT3A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RDR-DNMT3A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit
RDR-DNMT3B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit
RDR-DNMT3B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit
RD-TRMT61B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit
RD-TRMT61B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
SED496Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acetylserotonin-O-Methyltransferase (ASMT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in tissue homogenates, cell lysates and other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
SED496Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acetylserotonin-O-Methyltransferase (ASMT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in tissue homogenates, cell lysates and other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
SED496Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acetylserotonin-O-Methyltransferase (ASMT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in tissue homogenates, cell lysates and other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
SED496Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acetylserotonin-O-Methyltransferase (ASMT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in tissue homogenates, cell lysates and other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
4-SED496Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Acetylserotonin-O-Methyltransferase elisa. Alternative names of the recognized antigen: HIOMT ASMTY HIOMTY Hydroxyindole O-methyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit
RDR-GNMT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit
RDR-GNMT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit
RDR-NNMT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit
RDR-NNMT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
RD-ASMT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit
RD-ASMT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Catechol-O-Methyltransferase (COMT) ELISA Kit
RD-COMT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human TPMT(Thiopurine Methyltransferase) ELISA Kit