Human TPMT(Thiopurine Methyltransferase) ELISA Kit

Human TPMT(Thiopurine Methyltransferase) ELISA Kit

To Order Contact us below: 

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

RD-TPMT-Hu-48Tests 48 Tests
EUR 521

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

RD-TPMT-Hu-96Tests 96 Tests
EUR 723

Human Thiopurine Methyltransferase(TPMT)

QY-E05339 96T
EUR 374

Human Thiopurine Methyltransferase ELISA Kit (TPMT)

RK02435 96 Tests
EUR 521

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

SEC821Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

SEC821Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

SEC821Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

SEC821Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

4-SEC821Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thiopurine Methyltransferase elisa. Alternative names of the recognized antigen: Thiopurine S Methyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thiopurine Methyltransferase (TPMT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Thiopurine Methyltransferase (TPMT) Antibody

20-abx128186
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thiopurine Methyltransferase (TPMT) Antibody

20-abx174750
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Thiopurine Methyltransferase (TPMT)

4-RPC821Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51580
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.9kDa
  • Isoelectric Point: 6.7
Description: Recombinant Human Thiopurine Methyltransferase expressed in: E.coli

Human Thiopurine S-methyltransferase (TPMT)

1-CSB-RP005854h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Thiopurine S-methyltransferase(TPMT),partial expressed in E.coli

Human Thiopurine Methyltransferase (TPMT) Protein

20-abx166738
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Thiopurine Methyltransferase (TPMT) CLIA Kit

20-abx493913
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

20-abx153363
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

abx250428-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human TPMT/ Thiopurine S-methyltransferase ELISA Kit

E2576Hu 1 Kit
EUR 605

Human TPMT(Thiopurine S-methyltransferase) ELISA Kit

EH1175 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P51580
  • Alias: TPMT(Thiopurine S-methyltransferase)/Thiopurine methyltransferase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Thiopurine S- methyltransferase, TPMT ELISA KIT

ELI-03368h 96 Tests
EUR 824

ELISA kit for Human TPMT (Thiopurine Methyltransferase)

ELK4063 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thiopurine Methyltransferase (TPMT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Thiopurine Methyltransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human thiopurine S-methyltransferase (TPMT) ELISA kit

CSB-E17858h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human thiopurine S-methyltransferase (TPMT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human thiopurine S-methyltransferase (TPMT) ELISA kit

1-CSB-E17858h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human thiopurine S-methyltransferase (TPMT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

abx573967-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx110262
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx116062
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx137256
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx141576
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

abx238893-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx000960
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat Tpmt/ Thiopurine S-methyltransferase ELISA Kit

E1001Ra 1 Kit
EUR 646

Mouse Tpmt/ Thiopurine S-methyltransferase ELISA Kit

E1521Mo 1 Kit
EUR 632

Rat Thiopurine S- methyltransferase, Tpmt ELISA KIT

ELI-03369r 96 Tests
EUR 886

Mouse Thiopurine S- methyltransferase, Tpmt ELISA KIT

ELI-03370m 96 Tests
EUR 865

Bovine Thiopurine S- methyltransferase, TPMT ELISA KIT

ELI-03371b 96 Tests
EUR 928

Canine Thiopurine S-methyltransferase, TPMT ELISA KIT

ELI-03372d 96 Tests
EUR 928

Rabbit Thiopurine S- methyltransferase, TPMT ELISA KIT

ELI-03373Ra 96 Tests
EUR 928

Cow Thiopurine S-Methyltransferase (TPMT) ELISA Kit

20-abx514841
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog Thiopurine S-Methyltransferase (TPMT) ELISA Kit

20-abx514842
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Thiopurine S-Methyltransferase (TPMT) ELISA Kit

abx514844-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Thiopurine S-Methyltransferase (TPMT) ELISA Kit

abx514845-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

KTE60148-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

KTE60148-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

KTE60148-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TPMT (Thiopurine S-Methyltransferase)  Kit

E-EL-H5563 1 plate of 96 wells
EUR 534
  • Gentaur's TPMT ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPMT. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPMT (Thiopurine S-Methyltransferase)  Kit in samples from Serum, Plasma, Cell supernatant

Thiopurine S-Methyltransferase (TPMT) Antibody Pair

abx117377-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Tpmt ELISA Kit| Rat Thiopurine S-methyltransferase ELISA Kit

EF019410 96 Tests
EUR 689

Tpmt ELISA Kit| Mouse Thiopurine S-methyltransferase ELISA Kit

EF016373 96 Tests
EUR 689

TPMT ELISA Kit| Bovine Thiopurine S-methyltransferase ELISA Kit

EF011970 96 Tests
EUR 689

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse)

4-PAC821Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT)

TPMT Thiopurine S-methyltransferase Human Recombinant Protein

PROTP51580 Regular: 20ug
EUR 317
Description: TPMT Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 245 amino acids (1-245) and having a molecular mass of 28 kDa. ;Thiopurine S-methyltransferase is purified by proprietary chromatographic techniques.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), APC

4-PAC821Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with APC.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAC821Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with Biotin.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), Cy3

4-PAC821Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with Cy3.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), FITC

4-PAC821Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with FITC.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), HRP

4-PAC821Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with HRP.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), PE

4-PAC821Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with PE.

Monoclonal Anti-Human Thiopurine S-methyltransferase (TPMT) protein IgG

AB-22123 5 ug
EUR 164

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAC821Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with APC-Cy7.

Recombinant (E.Coli) Human Thiopurine S-methyltransferase (TPMT, 1-245 aa) protein

RP-712 5 ug
EUR 164

ELISA kit for Human Thiopurine S-methyltransferase

EK2628 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Thiopurine S-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Thiopurine S-methyltransferase

7-04195 5µg Ask for price

Recombinant Human Thiopurine S-methyltransferase

7-04196 20µg Ask for price

Recombinant Human Thiopurine S-methyltransferase

7-04197 1mg Ask for price

Thiopurine S-methyltransferase Polyclonal Antibody

42134-100ul 100ul
EUR 333

Thiopurine S-methyltransferase Antibody (Biotin)

20-abx105972
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiopurine S-methyltransferase Antibody (FITC)

20-abx107387
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiopurine S-methyltransferase Antibody (HRP)

20-abx108807
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiopurine S-methyltransferase Protein (Recombinant)

20-abx073594
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Thiopurine S-methyltransferase Polyclonal Conjugated Antibody

C42134 100ul
EUR 397

TPMT ELISA KIT|Human

EF002391 96 Tests
EUR 689

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-100ug

QP8325-ec-100ug 100ug
EUR 408

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-10ug

QP8325-ec-10ug 10ug
EUR 200

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-1mg

QP8325-ec-1mg 1mg
EUR 1632

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-200ug

QP8325-ec-200ug 200ug
EUR 634

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-500ug

QP8325-ec-500ug 500ug
EUR 1060

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-50ug

QP8325-ec-50ug 50ug
EUR 263

Human TPMT Antibody

32795-05111 150 ug
EUR 261

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

TPMT protein

30R-1110 100 ug
EUR 397
Description: Purified recombinant Human TPMT protein

TPMT antibody

70R-20939 50 ul
EUR 435
Description: Rabbit polyclonal TPMT antibody

TPMT antibody

70R-15216 100 ug
EUR 327
Description: Rabbit polyclonal TPMT antibody

TPMT Antibody

32120-100ul 100ul
EUR 252

TPMT antibody

10R-3130 100 ul
EUR 322
Description: Mouse monoclonal NANS antibody

TPMT antibody

10R-6122 100 ul
EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT antibody

10R-6123 100 ul
EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT antibody

10R-6124 100 ul
EUR 726
Description: Mouse monoclonal TPMT antibody

TPMT antibody

10R-6125 100 ul
EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT Antibody

1-CSB-PA00585A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

TPMT Antibody

DF6183 200ul
EUR 304
Description: TPMT Antibody detects endogenous levels of total TPMT.

TPMT Antibody

1-CSB-PA024110GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPMT siRNA

20-abx905752
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPMT siRNA

20-abx937849
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPMT siRNA

20-abx937850
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPMT Antibody

ABD6183 100 ug
EUR 438

anti-TPMT

YF-PA24886 50 ul
EUR 334
Description: Mouse polyclonal to TPMT

Human TPMT shRNA Plasmid

20-abx954923
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TPMT Recombinant Protein (Human)

RP032677 100 ug Ask for price

TPMT Recombinant Protein (Human)

RP032680 100 ug Ask for price

TPMT Rabbit pAb

A1017-100ul 100 ul
EUR 308

TPMT Rabbit pAb

A1017-200ul 200 ul
EUR 459

TPMT Rabbit pAb

A1017-20ul 20 ul
EUR 183

TPMT Rabbit pAb

A1017-50ul 50 ul
EUR 223

TPMT Rabbit pAb

A14067-100ul 100 ul
EUR 308

TPMT Rabbit pAb

A14067-200ul 200 ul
EUR 459

TPMT Rabbit pAb

A14067-20ul 20 ul
EUR 183

TPMT Rabbit pAb

A14067-50ul 50 ul
EUR 223

TPMT antibody (HRP)

60R-1492 100 ug
EUR 327
Description: Rabbit polyclonal TPMT antibody (HRP)

TPMT antibody (FITC)

60R-1493 100 ug
EUR 327
Description: Rabbit polyclonal TPMT antibody (FITC)

TPMT antibody (biotin)

60R-1494 100 ug
EUR 327
Description: Rabbit polyclonal TPMT antibody (biotin)

Polyclonal TPMT Antibody

APR10523G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPMT . This antibody is tested and proven to work in the following applications:

TPMT Blocking Peptide

DF6183-BP 1mg
EUR 195

Anti-TPMT Antibody

A00671-1 100ug/vial
EUR 294

TPMT Conjugated Antibody

C32120 100ul
EUR 397

TPMT cloning plasmid

CSB-CL024110HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 738
  • Sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaagg
  • Show more
Description: A cloning plasmid for the TPMT gene.

TPMT cloning plasmid

CSB-CL024110HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 738
  • Sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaagg
  • Show more
Description: A cloning plasmid for the TPMT gene.

TPMT Polyclonal Antibody

A51617 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- TPMT antibody

FNab08893 100µg
EUR 548.75
  • Immunogen: thiopurine S-methyltransferase
  • Uniprot ID: P51580
  • Gene ID: 7172
  • Research Area: Metabolism
Description: Antibody raised against TPMT

Anti-TPMT antibody

PAab08893 100 ug
EUR 386

Anti-TPMT antibody

STJ25944 100 µl
EUR 277
Description: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.

Anti-TPMT antibody

STJ116002 100 µl
EUR 277
Description: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.

Anti-TPMT (1B5)

YF-MA10964 100 ug
EUR 363
Description: Mouse monoclonal to TPMT

Anti-TPMT (1D4)

YF-MA15930 100 ug
EUR 363
Description: Mouse monoclonal to TPMT

Anti-TPMT (2H3)

YF-MA15931 100 ug
EUR 363
Description: Mouse monoclonal to TPMT

Human DNA methyltransferase,DNAM ELISA Kit

201-12-1975 96 tests
EUR 440
  • This DNA methyltransferase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Arsenite methyltransferase(AS3MT) ELISA kit

E01A1694-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arsenite methyltransferase(AS3MT) ELISA kit

E01A1694-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arsenite methyltransferase(AS3MT) ELISA kit

E01A1694-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arsenite methyltransferase(AS3MT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 1 ELISA kit

E01D0320-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 1 ELISA kit

E01D0320-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 1 ELISA kit

E01D0320-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3A ELISA kit

E01D0321-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3A ELISA kit

E01D0321-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3A ELISA kit

E01D0321-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3beta ELISA kit

E01D0322-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3beta ELISA kit

E01D0322-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DNA Methyltransferase 3beta ELISA kit

E01D0322-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human DNA Methyltransferase 3beta in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human echol O-methyltransferase ELISA kit

E01E0200-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human echol O-methyltransferase ELISA kit

E01E0200-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human echol O-methyltransferase ELISA kit

E01E0200-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human echol O-methyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human indolethylamine N- methyltransferase ELISA Kit

ELA-E2223h 96 Tests
EUR 824

Human DNA methyltransferase(DNAM)ELISA Kit

GA-E1991HM-48T 48T
EUR 289

Human DNA methyltransferase(DNAM)ELISA Kit

GA-E1991HM-96T 96T
EUR 466

Human Arsenite methyltransferase, AS3MT ELISA KIT

ELI-34764h 96 Tests
EUR 824

Human RNA Methyltransferase(RNMT)ELISA Kit

QY-E04643 96T
EUR 394

Human DNA methyltransferase(DNAM)ELISA Kit

QY-E04972 96T
EUR 361

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human TPMT Antibody (Biotin Conjugate)

32795-05121 150 ug
EUR 369

TPMT ORF Vector (Human) (pORF)

ORF010893 1.0 ug DNA
EUR 95

TPMT ORF Vector (Human) (pORF)

ORF010894 1.0 ug DNA
EUR 95

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human DNA methyltransferase 1,DNAM1 ELISA Kit

201-12-2171 96 tests
EUR 440
  • This DNA methyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

DLR-ASMT-Hu-48T 48T
EUR 517
  • Should the Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

DLR-ASMT-Hu-96T 96T
EUR 673
  • Should the Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Catechol-O-Methyltransferase (COMT) ELISA Kit

DLR-COMT-Hu-48T 48T
EUR 517
  • Should the Human Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Catechol-O-Methyltransferase (COMT) ELISA Kit

DLR-COMT-Hu-96T 96T
EUR 673
  • Should the Human Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

DLR-TRMT61B-Hu-48T 48T
EUR 517
  • Should the Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TRNA Methyltransferase 61B (TRMT61B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

DLR-TRMT61B-Hu-96T 96T
EUR 673
  • Should the Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TRNA Methyltransferase 61B (TRMT61B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

DLR-NNMT-Hu-48T 48T
EUR 517
  • Should the Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide-N-Methyltransferase (NNMT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

DLR-NNMT-Hu-96T 96T
EUR 673
  • Should the Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide-N-Methyltransferase (NNMT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

DLR-DNMT1-Hu-48T 48T
EUR 517
  • Should the Human DNA Methyltransferase 1 (DNMT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 1 (DNMT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

DLR-DNMT1-Hu-96T 96T
EUR 673
  • Should the Human DNA Methyltransferase 1 (DNMT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 1 (DNMT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

DLR-DNMT3A-Hu-48T 48T
EUR 517
  • Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

DLR-DNMT3A-Hu-96T 96T
EUR 673
  • Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

DLR-DNMT3B-Hu-48T 48T
EUR 517
  • Should the Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3B (DNMT3B) in samples from tissue homogenates or other biological fluids.

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

DLR-DNMT3B-Hu-96T 96T
EUR 673
  • Should the Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3B (DNMT3B) in samples from tissue homogenates or other biological fluids.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

DLR-GNMT-Hu-48T 48T
EUR 517
  • Should the Human Glycine-N-Methyltransferase (GNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycine-N-Methyltransferase (GNMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

DLR-GNMT-Hu-96T 96T
EUR 673
  • Should the Human Glycine-N-Methyltransferase (GNMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycine-N-Methyltransferase (GNMT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nicotinamide N methyltransferase(NNMT) ELISA kit

E01N0553-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide N methyltransferase(NNMT) ELISA kit

E01N0553-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide N methyltransferase(NNMT) ELISA kit

E01N0553-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nicotinamide N methyltransferase(NNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human COMT/ Catechol O-methyltransferase ELISA Kit

E0534Hu 1 Kit
EUR 605

Human Glycine N methyltransferase(GNMT) ELISA kit

E01G0435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycine N methyltransferase(GNMT) ELISA kit

E01G0435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glycine N methyltransferase(GNMT) ELISA kit

E01G0435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glycine N methyltransferase(GNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ASMT/ Acetylserotonin O-methyltransferase ELISA Kit

E0212Hu 1 Kit
EUR 605

Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit

E01P0854-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit

E01P0854-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phenylethanolamine N methyltransferase(PNMT) ELISA kit

E01P0854-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phenylethanolamine N methyltransferase(PNMT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

20-abx150754
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Betaine Homocysteine Methyltransferase (BHMT) ELISA Kit

20-abx150807
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Catechol-O-Methyltransferase (COMT) ELISA Kit

20-abx151145
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

20-abx151332
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

20-abx151333
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

20-abx151334
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

20-abx151700
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

20-abx152532
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Histamine N-Methyltransferase (HNMT) ELISA Kit

abx257686-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.

Human Nicotinamide N-methyltransferase (NNMT) ELISA Kit

abx251040-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Catechol O-Methyltransferase (COMT) ELISA Kit

abx251828-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

ELISA kit for Human Catechol O-methyltransferase

EK4941 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Catechol O-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human COMT(Catechol O-methyltransferase) ELISA Kit

EH2462 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P21964
  • Alias: COMT/catechol O-methyltransferase/catechol-O-methyltransferase/EC 2.1.1.6/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human HNMT(Histamine N-methyltransferase) ELISA Kit

EH4167 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P50135
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

ELISA kit for Human Glycine N-methyltransferase

EK3139 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Glycine N-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Nicotinamide N-methyltransferase

EK3603 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Nicotinamide N-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Hydroxyindole O-methyltransferase

EK3690 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Hydroxyindole O-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GNMT/ Glycine N-methyltransferase ELISA Kit

E1029Hu 1 Kit
EUR 605

Human HNMT/ Histamine N-methyltransferase ELISA Kit

E1151Hu 1 Kit
EUR 605

Human NNMT/ Nicotinamide N-methyltransferase ELISA Kit

E1758Hu 1 Kit
EUR 605

Human GNMT(Glycine N-methyltransferase) ELISA Kit

EH1463 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q14749
  • Alias: GNMT/Glycine N-methyltransferase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human NNMT(Nicotinamide N-methyltransferase) ELISA Kit

EH1737 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P40261
  • Alias: INHBB/Inhibin beta B chain/Activin beta-B chain/Inhibin, Beta B/Inhibin, Beta-2/inhibin, beta B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transmembrane O- methyltransferase, LRTOMT ELISA KIT

ELI-16942h 96 Tests
EUR 824

Human Phenylethanolamine N- methyltransferase, PNMT ELISA KIT

ELI-12577h 96 Tests
EUR 824

Human Nicotinamide N- methyltransferase, NNMT ELISA KIT

ELI-21228h 96 Tests
EUR 824

Human Putative methyltransferase NSUN5, NSUN5 ELISA KIT

ELI-21343h 96 Tests
EUR 824

Human Putative methyltransferase NSUN4, NSUN4 ELISA KIT

ELI-22412h 96 Tests
EUR 824

Human Putative methyltransferase NSUN7, NSUN7 ELISA KIT

ELI-22413h 96 Tests
EUR 824

Human Probable methyltransferase TARBP1, TARBP1 ELISA KIT

ELI-23756h 96 Tests
EUR 824

Human Indolethylamine N- methyltransferase, INMT ELISA KIT

ELI-07112h 96 Tests
EUR 824

Human Guanidinoacetate N- methyltransferase, GAMT ELISA KIT

ELI-26600h 96 Tests
EUR 824

Human Histamine N- methyltransferase, HNMT ELISA KIT

ELI-42704h 96 Tests
EUR 824

Human Putative methyltransferase NSUN3, NSUN3 ELISA KIT

ELI-44215h 96 Tests
EUR 824

Human Putative methyltransferase NSUN5C, NSUN5P2 ELISA KIT

ELI-44450h 96 Tests
EUR 824

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

abx352271-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human DNA Methyltransferase 2 (DNMT2) ELISA Kit

abx352272-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human tRNA Methyltransferase 6 (TRMT6) ELISA Kit

abx383953-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human tRNA Methyltransferase 61B (TRMT61B) ELISA Kit

abx383954-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Coenzyme Q3, Methyltransferase (COQ3) ELISA Kit

abx385005-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphatidylethanolamine N-methyltransferase (PEMT) ELISA Kit

abx385271-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Methyltransferase Like 16 (METT10D) ELISA Kit

abx381416-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Methyltransferase Like 1 (METTL1) ELISA Kit

abx381417-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Lysine Methyltransferase 2E (KMT2E) ELISA Kit

abx381467-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Phenylethanolamine N-methyltransferase (PNMT) ELISA Kit

abx382327-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Lysine Methyltransferase 5A (SETD8) ELISA Kit

abx383128-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Betaine Homocysteine Methyltransferase (BHMT) ELISA Kit

abx556316-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Catechol O-Methyltransferase (COMT) ELISA Kit

abx570775-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Acetylserotonin O-Methyltransferase (ASMT) ELISA Kit

abx571370-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

abx571713-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

abx571840-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

abx572824-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human tRNA Methyltransferase 61A (TRMT61A) ELISA Kit

20-abx585356
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Indolethylamine N-Methyltransferase (INMT) ELISA Kit

abx519772-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Coenzyme Q5, Methyltransferase (COQ5) ELISA Kit

abx386637-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Guanidinoacetate N-Methyltransferase (GAMT) ELISA Kit

abx387492-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Catechol O- methyltransferase, COMT ELISA KIT

ELI-32354h 96 Tests
EUR 824

Human Probable methyltransferase BCDIN3D, BCDIN3D ELISA KIT

ELI-33367h 96 Tests
EUR 824

Human Putative methyltransferase NSUN6, NSUN6 ELISA KIT

ELI-39764h 96 Tests
EUR 824

Human Putative methyltransferase KIAA1456, KIAA1456 ELISA KIT

ELI-47823h 96 Tests
EUR 824

Human Glycine N- methyltransferase, GNMT ELISA KIT

ELI-47245h 96 Tests
EUR 824

Human Indolethylamine-N-Methyltransferase(INMT)ELISA Kit

QY-E00419 96T
EUR 361

Human Phosphatidylethanolamine-N-Methyltransferase(PEMT)ELISA Kit

QY-E02269 96T
EUR 361

Human Phenylethanolamine-N-Methyltransferase(PNMT)ELISA Kit

QY-E04148 96T
EUR 361

Human DNA methyltransferase 1(DNAM1)ELISA Kit

QY-E04971 96T
EUR 361

Human Histamine N-methyltransferase(HNMT) ELISA Kit

QY-E05419 96T
EUR 361

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

RDR-TRMT61B-Hu-48Tests 48 Tests
EUR 544

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

RDR-TRMT61B-Hu-96Tests 96 Tests
EUR 756

Human DNA Methyltransferase 1 ELISA Kit (DNMT1)

RK01276 96 Tests
EUR 521

Human DNA Methyltransferase 3A ELISA Kit (DNMT3A)

RK01277 96 Tests
EUR 521

Human Glycine-N-Methyltransferase ELISA Kit (GNMT)

RK01483 96 Tests
EUR 521

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

RDR-ASMT-Hu-48Tests 48 Tests
EUR 544

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

RDR-ASMT-Hu-96Tests 96 Tests
EUR 756

Human Catechol-O-Methyltransferase (COMT) ELISA Kit

RDR-COMT-Hu-48Tests 48 Tests
EUR 544

Human Catechol-O-Methyltransferase (COMT) ELISA Kit

RDR-COMT-Hu-96Tests 96 Tests
EUR 756

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

RDR-DNMT1-Hu-48Tests 48 Tests
EUR 544

Human DNA Methyltransferase 1 (DNMT1) ELISA Kit

RDR-DNMT1-Hu-96Tests 96 Tests
EUR 756

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

RDR-DNMT3A-Hu-48Tests 48 Tests
EUR 544

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit

RDR-DNMT3A-Hu-96Tests 96 Tests
EUR 756

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

RDR-DNMT3B-Hu-48Tests 48 Tests
EUR 544

Human DNA Methyltransferase 3B (DNMT3B) ELISA Kit

RDR-DNMT3B-Hu-96Tests 96 Tests
EUR 756

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

RD-TRMT61B-Hu-48Tests 48 Tests
EUR 521

Human TRNA Methyltransferase 61B (TRMT61B) ELISA Kit

RD-TRMT61B-Hu-96Tests 96 Tests
EUR 723

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

SED496Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acetylserotonin-O-Methyltransferase (ASMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in tissue homogenates, cell lysates and other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

SED496Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acetylserotonin-O-Methyltransferase (ASMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in tissue homogenates, cell lysates and other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

SED496Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acetylserotonin-O-Methyltransferase (ASMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in tissue homogenates, cell lysates and other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

SED496Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acetylserotonin-O-Methyltransferase (ASMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in tissue homogenates, cell lysates and other biological fluids.

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

4-SED496Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Acetylserotonin-O-Methyltransferase elisa. Alternative names of the recognized antigen: HIOMT
  • ASMTY
  • HIOMTY
  • Hydroxyindole O-methyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acetylserotonin-O-Methyltransferase (ASMT) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

RDR-GNMT-Hu-48Tests 48 Tests
EUR 544

Human Glycine-N-Methyltransferase (GNMT) ELISA Kit

RDR-GNMT-Hu-96Tests 96 Tests
EUR 756

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

RDR-NNMT-Hu-48Tests 48 Tests
EUR 544

Human Nicotinamide-N-Methyltransferase (NNMT) ELISA Kit

RDR-NNMT-Hu-96Tests 96 Tests
EUR 756

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

RD-ASMT-Hu-48Tests 48 Tests
EUR 521

Human Acetylserotonin-O-Methyltransferase (ASMT) ELISA Kit

RD-ASMT-Hu-96Tests 96 Tests
EUR 723

Human Catechol-O-Methyltransferase (COMT) ELISA Kit

RD-COMT-Hu-48Tests 48 Tests
EUR 521

Human TPMT(Thiopurine Methyltransferase) ELISA Kit