Human MPST(Mercaptopyruvate Sulfurtransferase) ELISA Kit

Human MPST(Mercaptopyruvate Sulfurtransferase) ELISA Kit

To Order Contact us below: 

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
RDR-MPST-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
RDR-MPST-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
DLR-MPST-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in samples from tissue homogenates or other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
DLR-MPST-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in samples from tissue homogenates or other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
RD-MPST-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
RD-MPST-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
RDR-MPST-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
RDR-MPST-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
20-abx152376	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mercaptopyruvate Sulfurtransferase (MPST)ELISA kit
201-12-2265	SunredBio	96 tests	EUR 440
This Mercaptopyruvate Sulfurtransferase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
SEC625Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates, cell lysates and other biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
SEC625Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates, cell lysates and other biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
SEC625Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates, cell lysates and other biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
SEC625Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates, cell lysates and other biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
4-SEC625Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Mercaptopyruvate Sulfurtransferase elisa. Alternative names of the recognized antigen: MST TST2 Human Liver Rhodanese
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Mercaptopyruvate Sulfurtransferase ELISA Kit (MPST)
RK01878	Abclonal	96 Tests	EUR 521

Human Mercaptopyruvate Sulfurtransferase(MPST)ELISA Kit
QY-E01844	Qayee Biotechnology	96T	EUR 361

Mercaptopyruvate Sulfurtransferase (MPST) Antibody
20-abx126184	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody
20-abx129479	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody
20-abx103635	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody
abx033579-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody
abx033579-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody
20-abx173540	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody
20-abx177532	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody
20-abx333818	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Mercaptopyruvate Sulfurtransferase (MPST)
4-RPC625Hu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P25325 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.2kDa Isoelectric Point: 6.5
Description: Recombinant Human Mercaptopyruvate Sulfurtransferase expressed in: E.coli

Recombinant Mercaptopyruvate Sulfurtransferase (MPST)
4-RPC625Mu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99J99 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Mercaptopyruvate Sulfurtransferase expressed in: E.coli

Human Mercaptopyruvate Sulfurtransferase (MPST) Protein
20-abx067995	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Mercaptopyruvate Sulfurtransferase(MPST)ELISA kit
GA-E0812MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Mercaptopyruvate Sulfurtransferase(MPST)ELISA kit
GA-E0812MS-96T	GenAsia Biotech	96T	EUR 534

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
20-abx154404	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
abx391594-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
SEC625Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates and other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
SEC625Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates and other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
SEC625Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates and other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
SEC625Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates and other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit
4-SEC625Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Mercaptopyruvate Sulfurtransferase elisa. Alternative names of the recognized antigen: MST TST2 Human Liver Rhodanese
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Mercaptopyruvate Sulfurtransferase(MPST)ELISA kit
QY-E10589	Qayee Biotechnology	96T	EUR 361

Mouse Mercaptopyruvate Sulfurtransferase(MPST)ELISA kit
QY-E20991	Qayee Biotechnology	96T	EUR 361

Human Mercaptopyruvate Sulfurtransferase (MPST) CLIA Kit
20-abx493805	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human MPST (Mercaptopyruvate Sulfurtransferase)
ELK4059	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mercaptopyruvate Sulfurtransferase (MPST). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of Mercaptopyruvate Sulfurtransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human 3- mercaptopyruvate sulfurtransferase, MPST ELISA KIT
ELI-29207h	Lifescience Market	96 Tests	EUR 824

Mouse Mercaptopyruvate Sulfurtransferase (MPST) Protein
20-abx167456	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody (HRP)
20-abx334482	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody (FITC)
20-abx334483	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody (Biotin)
20-abx334484	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) CLIA Kit
20-abx493806	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse MPST (Mercaptopyruvate Sulfurtransferase)
ELK6608	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mercaptopyruvate Sulfurtransferase (MPST). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of Mercaptopyruvate Sulfurtransferase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse 3- mercaptopyruvate sulfurtransferase, Mpst ELISA KIT
ELI-29208m	Lifescience Market	96 Tests	EUR 865

MPST Mercaptopyruvate Sulfurtransferase Human Recombinant Protein
PROTP25325	BosterBio	Regular: 20ug	EUR 317
Description: MPST Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 321 amino acids (1-297) and having a molecular mass of 35kDa.;MPST is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human)
4-PAC625Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Arg68~Glu278) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST)

ELISA kit for Human 3-mercaptopyruvate sulfurtransferase (MPST)
KTE61552-48T	Abbkine	48T	EUR 332
3-mercaptopyruvate sulfurtransferase encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in lite Show more
Description: Quantitative sandwich ELISA for measuring Human 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 3-mercaptopyruvate sulfurtransferase (MPST)
KTE61552-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
3-mercaptopyruvate sulfurtransferase encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in lite Show more
Description: Quantitative sandwich ELISA for measuring Human 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 3-mercaptopyruvate sulfurtransferase (MPST)
KTE61552-96T	Abbkine	96T	EUR 539
3-mercaptopyruvate sulfurtransferase encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in lite Show more
Description: Quantitative sandwich ELISA for measuring Human 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mpst ELISA Kit| Rat 3-mercaptopyruvate sulfurtransferase ELISA
EF018952	Lifescience Market	96 Tests	EUR 689

Mpst ELISA Kit| Mouse 3-mercaptopyruvate sulfurtransferase ELIS
EF015485	Lifescience Market	96 Tests	EUR 689

ELISA kit for Rat 3-mercaptopyruvate sulfurtransferase (MPST)
KTE100587-48T	Abbkine	48T	EUR 332
This protein encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this prot Show more
Description: Quantitative sandwich ELISA for measuring Rat 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat 3-mercaptopyruvate sulfurtransferase (MPST)
KTE100587-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
This protein encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this prot Show more
Description: Quantitative sandwich ELISA for measuring Rat 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat 3-mercaptopyruvate sulfurtransferase (MPST)
KTE100587-96T	Abbkine	96T	EUR 539
This protein encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this prot Show more
Description: Quantitative sandwich ELISA for measuring Rat 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse 3-mercaptopyruvate sulfurtransferase (MPST)
KTE70963-48T	Abbkine	48T	EUR 332
Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contribut Show more
Description: Quantitative sandwich ELISA for measuring Mouse 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse 3-mercaptopyruvate sulfurtransferase (MPST)
KTE70963-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contribut Show more
Description: Quantitative sandwich ELISA for measuring Mouse 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse 3-mercaptopyruvate sulfurtransferase (MPST)
KTE70963-96T	Abbkine	96T	EUR 539
Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contribut Show more
Description: Quantitative sandwich ELISA for measuring Mouse 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), APC
4-PAC625Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Arg68~Glu278) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with APC.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), Biotinylated
4-PAC625Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Arg68~Glu278) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with Biotin.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), Cy3
4-PAC625Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Arg68~Glu278) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with Cy3.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), FITC
4-PAC625Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Arg68~Glu278) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with FITC.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), HRP
4-PAC625Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Arg68~Glu278) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with HRP.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), PE
4-PAC625Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Arg68~Glu278) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with PE.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat)
4-PAC625Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Met1~Gln297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST)

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), APC-Cy7
4-PAC625Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Arg68~Glu278) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with APC-Cy7.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), APC
4-PAC625Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Met1~Gln297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with APC.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAC625Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Met1~Gln297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with Biotin.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAC625Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Met1~Gln297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with Cy3.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), FITC
4-PAC625Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Met1~Gln297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with FITC.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), HRP
4-PAC625Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Met1~Gln297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with HRP.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), PE
4-PAC625Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Met1~Gln297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with PE.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAC625Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MPST (Met1~Gln297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with APC-Cy7.

Mpst/ Rat Mpst ELISA Kit
ELI-52043r	Lifescience Market	96 Tests	EUR 886

MPST ELISA KIT|Human
EF005262	Lifescience Market	96 Tests	EUR 689

MPST ELISA Kit (Human) (OKAN06127)
OKAN06127	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL

MPST ELISA Kit (Human) (OKCD08208)
OKCD08208	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: MPST transfer of a sulfur ion to cyanide or to other thiol compounds. MPST also has weak rhodanese activity. MPST may have a role in cyanide degradation or in thiosulfate biosynthesis.This gene encodes a protein which can function as a monomer or as a disulfide-linked homodimer and which catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cyanide degradation and in thiosulfate biosynthesis. The encoded cytoplasmic protein is a member of the rhodanese family but is not rhodanese itself, which is a mitochondrial protein. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

MPST ELISA Kit (Human) (OKDD00402)
OKDD00402	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL

Human Thiosulfate sulfurtransferase(TST) ELISA kit
E01T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thiosulfate sulfurtransferase(TST) ELISA kit
E01T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thiosulfate sulfurtransferase(TST) ELISA kit
E01T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thiosulfate sulfurtransferase, TST ELISA KIT
ELI-41961h	Lifescience Market	96 Tests	EUR 824

Human Thiosulfate Sulfurtransferase (TST) ELISA Kit
abx384004-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Thiosulfate sulfurtransferase(TST) ELISA kit
CSB-EL025197HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thiosulfate sulfurtransferase (TST) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Thiosulfate sulfurtransferase(TST) ELISA kit
1-CSB-EL025197HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thiosulfate sulfurtransferase(TST) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

MPST ELISA Kit (Mouse) (OKCD00343)
OKCD00343	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contributes to the catabolism of cysteine and is an important producer of hydrogen sulfide in the brain, retina and vascular endothelial cells. Hydrogen sulfide H2S is an important synaptic modulator, signaling molecule, smooth muscle contractor and neuroprotectant. Its production by the 3MST/CAT pathway is regulated by calcium ions.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"3-Mercaptopyruvate sulfurtransferase produces hydrogen sulfide and bound sulfane sulfur in the brain."_x005F_x005F_x000D_Shibuya N., Tanaka M., Yoshida M., Ogasawara Y., Togawa T., Ishii K., Kimura H._x005F_x005F_x000D_Antioxid. Redox Signal. 11:703-714(2009) [PubMed] [Europe PMC] [Abstract]Cited for: DEVELOPMENTAL STAGE, FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY, MUTAGENESIS OF ARG-188; ARG-197 AND CYS-248.Ref.6"Hydrogen sulfide protects the retina from light-induced degeneration by the modulation of Ca2+ influx."_x005F_x005F_x000D_Mikami Y., Shibuya N., Kimura Y., Nagahara N., Yamada M., Kimura H._x005F_x005F_x000D_J. Biol. Chem. 286:39379-39386(2011) [PubMed] [Europe PMC] [Abstract]Cited for: TISSUE SPECIFICITY, FUNCTION.Ref.7"A mechanism of retinal protection from light-induced degeneration by hydrogen sulfide."_x005F_x005F_x000D_Mikami Y., Kimura H._x005F_x005F_x000D_Commun. Integr. Biol. 5:169-171(2012) [PubMed] [Europe PMC] [Abstract]Cited for: TISSUE SPECIFICITY, FUNCTION. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

MPST ELISA Kit (Mouse) (OKDD00763)
OKDD00763	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. it may be involved in cysteine degradation and cyanide detoxification. there is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, mpst), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, tst, geneid:7263), which is a mitochondrial protein. deficiency in mpst activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (mcdu). alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

MPST (Recombinant)
20-abx073378	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

MPST siRNA
20-abx924486	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MPST siRNA
20-abx924487	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MPST antibody
70R-2488	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MPST antibody raised against the middle region of MPST

MPST Antibody
1-CSB-PA014770LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPST. Recognizes MPST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-MPST
YF-PA13236	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to MPST

anti-MPST
YF-PA13237	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to MPST

Mouse Thiosulfate sulfurtransferase(TST) ELISA kit
E03T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thiosulfate sulfurtransferase(TST) ELISA kit
E03T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thiosulfate sulfurtransferase(TST) ELISA kit
E03T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thiosulfate sulfurtransferase(TST) ELISA kit
E02T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thiosulfate sulfurtransferase(TST) ELISA kit
E02T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thiosulfate sulfurtransferase(TST) ELISA kit
E02T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thiosulfate sulfurtransferase(TST) ELISA kit
E04T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thiosulfate sulfurtransferase(TST) ELISA kit
E04T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thiosulfate sulfurtransferase(TST) ELISA kit
E04T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thiosulfate sulfurtransferase(TST) ELISA kit
E08T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thiosulfate sulfurtransferase(TST) ELISA kit
E08T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thiosulfate sulfurtransferase(TST) ELISA kit
E08T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thiosulfate sulfurtransferase(TST) ELISA kit
E07T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thiosulfate sulfurtransferase(TST) ELISA kit
E07T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thiosulfate sulfurtransferase(TST) ELISA kit
E07T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thiosulfate sulfurtransferase(TST) ELISA kit
E06T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thiosulfate sulfurtransferase(TST) ELISA kit
E06T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thiosulfate sulfurtransferase(TST) ELISA kit
E06T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thiosulfate sulfurtransferase(TST) ELISA kit
E09T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thiosulfate sulfurtransferase(TST) ELISA kit
E09T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thiosulfate sulfurtransferase(TST) ELISA kit
E09T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Thiosulfate sulfurtransferase, TST ELISA KIT
ELI-16269b	Lifescience Market	96 Tests	EUR 928

Chicken Thiosulfate sulfurtransferase, TST ELISA KIT
ELI-17165c	Lifescience Market	96 Tests	EUR 928

Mouse Thiosulfate sulfurtransferase, Tst ELISA KIT
ELI-37500m	Lifescience Market	96 Tests	EUR 865

Human MPST shRNA Plasmid
20-abx952960	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MPST Recombinant Protein (Human)
RP019792	ABM	100 ug	Ask for price

Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E01A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E01A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E01A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Thiosulfate Sulfurtransferase
7-03541	CHI Scientific	5µg	Ask for price

Recombinant Human Thiosulfate Sulfurtransferase
7-03542	CHI Scientific	20µg	Ask for price

Recombinant Human Thiosulfate Sulfurtransferase
7-03543	CHI Scientific	1mg	Ask for price

Recombinant human Thiosulfate sulfurtransferase
P2776	FN Test	100ug	Ask for price
Uniprot ID: Q16762 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Thiosulfate sulfurtransferase

Guinea pig Thiosulfate sulfurtransferase(TST) ELISA kit
E05T0742-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Thiosulfate sulfurtransferase(TST) ELISA kit
E05T0742-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Thiosulfate sulfurtransferase(TST) ELISA kit
E05T0742-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MPST cloning plasmid
CSB-CL014770HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 471 Sequence: atggcttcgccgcagctctgccgcgcgctggtgtcggcgcaatgggtggcggaggcgctgcgggccccgcgcgctgggcagcctctgcagctgctggacgcctcctggtacctgccgaagctggggcgcgacgcgcgacgcgagttcgaggagcgccacatcccgggcgccgcttt Show more
Description: A cloning plasmid for the MPST gene.

MPST Rabbit pAb
A11587-100ul	Abclonal	100 ul	EUR 308

MPST Rabbit pAb
A11587-200ul	Abclonal	200 ul	EUR 459

MPST Rabbit pAb
A11587-20ul	Abclonal	20 ul	EUR 183

MPST Rabbit pAb
A11587-50ul	Abclonal	50 ul	EUR 223

MPST Blocking Peptide
33R-2094	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MPST antibody, catalog no. 70R-2488

MPST Polyclonal Antibody
27541-100ul	SAB	100ul	EUR 252

MPST Polyclonal Antibody
27541-50ul	SAB	50ul	EUR 187

Anti-MPST antibody
STJ113192	St John's Laboratory	100 µl	EUR 277
Description: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene.

Anti-MPST (1B5)
YF-MA14281	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MPST

Thiosulfate Sulfurtransferase (Recombinant)
20-abx073564	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Thiosulfate sulfurtransferase protein
30R-1423	Fitzgerald	100 ug	EUR 397
Description: Purified recombinant Human Thiosulfate sulfurtransferase protein

MPST ORF Vector (Human) (pORF)
ORF006598	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Thiosulfate Sulfurtransferase (TST) Protein
20-abx650194	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E06A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E06A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E06A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E03A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E03A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E03A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E04A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E04A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E04A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E02A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E02A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E02A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E07A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E07A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E07A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E09A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E09A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E09A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E08A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E08A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E08A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

MPST Polyclonal Conjugated Antibody
C27541	SAB	100ul	EUR 397

Rat MPST shRNA Plasmid
20-abx987830	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MPST protein (His tag)
30R-2924	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human MPST protein (His tag)

MPST Antibody, HRP conjugated
1-CSB-PA014770LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPST. Recognizes MPST from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPST Antibody, FITC conjugated
1-CSB-PA014770LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPST. Recognizes MPST from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPST Antibody, Biotin conjugated
1-CSB-PA014770LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPST. Recognizes MPST from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MPST Recombinant Protein (Rat)
RP212177	ABM	100 ug	Ask for price

MPST Recombinant Protein (Mouse)
RP151319	ABM	100 ug	Ask for price

MPST Recombinant Protein (Mouse)
RP151322	ABM	100 ug	Ask for price

MPST Recombinant Protein (Mouse)
RP151325	ABM	100 ug	Ask for price

MPST sgRNA CRISPR Lentivector set (Human)
K1322101	ABM	3 x 1.0 ug	EUR 339

E.Coli Thiosulfate sulfurtransferase (Recombinant)
20-abx073399	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody
20-abx123638	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody
20-abx126747	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (Rhodanese) Antibody
20-abx116075	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody
20-abx131540	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thiosulfate Sulfurtransferase (TST) Antibody
20-abx338698	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody
abx239073-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thiosulfate Sulfurtransferase (TST) Antibody
abx239074-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thiosulfate Sulfurtransferase (TST) Antibody
20-abx178561	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Recombinant Thiosulfate Sulfurtransferase (TST)
4-RPC817Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q16762 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Thiosulfate Sulfurtransferase expressed in: E.coli

Recombinant Thiosulfate Sulfurtransferase (TST)
4-RPC817Mu01	Cloud-Clone	EUR 454.82 EUR 224.00 EUR 1430.56 EUR 543.52 EUR 987.04 EUR 367.00 EUR 3426.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P52196 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.0kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Thiosulfate Sulfurtransferase expressed in: E.coli

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Rhodanese Thiosulfate Sulfurtransferase Human Recombinant Protein
PROTQ16762	BosterBio	Regular: 20ug	EUR 317
Description: Recombinant Human Rhodanese produced in E.Coli is a single, non-glycosylated polypeptide chain containing 317 amino acids (1-297 a.a) and having a molecular mass of 35.6 kDa. Rhodanese is fused to a 20 amino acid His-Tag at N-terminus and purified by conventional chromatography techniques.

Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E05A1921-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E05A1921-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit
E05A1921-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Polyclonal MPST Antibody (N-term)
APR08509G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MPST (N-term). This antibody is tested and proven to work in the following applications:

Mpst ORF Vector (Mouse) (pORF)
ORF050441	ABM	1.0 ug DNA	EUR 506

Mpst ORF Vector (Mouse) (pORF)
ORF050442	ABM	1.0 ug DNA	EUR 506

Mpst ORF Vector (Mouse) (pORF)
ORF050443	ABM	1.0 ug DNA	EUR 506

Mpst ORF Vector (Rat) (pORF)
ORF070727	ABM	1.0 ug DNA	EUR 506

MPST sgRNA CRISPR Lentivector (Human) (Target 1)
K1322102	ABM	1.0 ug DNA	EUR 154

MPST sgRNA CRISPR Lentivector (Human) (Target 2)
K1322103	ABM	1.0 ug DNA	EUR 154

MPST sgRNA CRISPR Lentivector (Human) (Target 3)
K1322104	ABM	1.0 ug DNA	EUR 154

Recombinant Human MPST Protein, His, E.coli-1mg
QP12724-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human MPST Protein, His, E.coli-20ug
QP12724-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human MPST Protein, His, E.coli-5ug
QP12724-5ug	EnQuireBio	5ug	EUR 155

MPST Protein Vector (Human) (pPB-C-His)
PV026389	ABM	500 ng	EUR 329

MPST Protein Vector (Human) (pPB-N-His)
PV026390	ABM	500 ng	EUR 329

MPST Protein Vector (Human) (pPM-C-HA)
PV026391	ABM	500 ng	EUR 329

MPST Protein Vector (Human) (pPM-C-His)
PV026392	ABM	500 ng	EUR 329

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse)
4-PAC817Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TST (Val2~Ala297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST)

Mouse Thiosulfate Sulfurtransferase (TST) Protein
20-abx650195	Abbexa	EUR 634.00 EUR 272.00 EUR 1929.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thiosulfate Sulfurtransferase (TST) Antibody (HRP)
20-abx337949	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody (FITC)
20-abx337950	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody (Biotin)
20-abx337951	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Mpst sgRNA CRISPR Lentivector set (Mouse)
K4481001	ABM	3 x 1.0 ug	EUR 339

Mpst sgRNA CRISPR Lentivector set (Rat)
K6947901	ABM	3 x 1.0 ug	EUR 339

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Recombinant Human Thiosulfate Sulfurtransferase Like Domain Containing 1
7-03691	CHI Scientific	2µg	Ask for price

Recombinant Human Thiosulfate Sulfurtransferase Like Domain Containing 1
7-03692	CHI Scientific	10µg	Ask for price

Recombinant Human Thiosulfate Sulfurtransferase Like Domain Containing 1
7-03693	CHI Scientific	1mg	Ask for price

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), APC
4-PAC817Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TST (Val2~Ala297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with APC.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC817Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TST (Val2~Ala297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with Biotin.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC817Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TST (Val2~Ala297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with Cy3.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), FITC
4-PAC817Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TST (Val2~Ala297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with FITC.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), HRP
4-PAC817Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TST (Val2~Ala297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with HRP.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), PE
4-PAC817Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TST (Val2~Ala297) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with PE.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3) Antibody
20-abx141400	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3b) Antibody
abx038013-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3) Antibody
20-abx006464	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3) Antibody
20-abx321872	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3) Antibody
20-abx321873	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Escherichia coli Thiosulfate sulfurtransferase GlpE (glpE)
1-CSB-YP533026ENP	Cusabio	EUR 679.00 EUR 335.00 EUR 2172.00 EUR 1051.00 EUR 1442.00 EUR 435.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 14.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Thiosulfate sulfurtransferase GlpE(glpE) expressed in Yeast

Escherichia coli Thiosulfate sulfurtransferase GlpE (glpE)
1-CSB-EP533026ENP	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 16.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Thiosulfate sulfurtransferase GlpE(glpE) expressed in E.coli

glpE Thiosulfate sulfurtransferase E.Coli Recombinant Protein
PROTP0A6V5	BosterBio	Regular: 20ug	EUR 317
Description: glpE Recombinant produced in E. coli is a single polypeptide chain containing 131 amino acids (1-108) and having a molecular mass of 14.5kDa. glpE is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Human MPST(Mercaptopyruvate Sulfurtransferase) ELISA Kit