Human MPST(Mercaptopyruvate Sulfurtransferase) ELISA Kit

Human MPST(Mercaptopyruvate Sulfurtransferase) ELISA Kit

To Order Contact us below: 

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

RDR-MPST-Hu-48Tests 48 Tests
EUR 544

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

RDR-MPST-Hu-96Tests 96 Tests
EUR 756

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

EUR 527
  • Should the Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in samples from tissue homogenates or other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

EUR 688
  • Should the Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in samples from tissue homogenates or other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

RD-MPST-Mu-48Tests 48 Tests
EUR 533

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

RD-MPST-Mu-96Tests 96 Tests
EUR 740

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

RDR-MPST-Mu-48Tests 48 Tests
EUR 557

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

RDR-MPST-Mu-96Tests 96 Tests
EUR 774

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mercaptopyruvate Sulfurtransferase (MPST)ELISA kit

201-12-2265 96 tests
EUR 440
  • This Mercaptopyruvate Sulfurtransferase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

SEC625Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates, cell lysates and other biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

SEC625Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates, cell lysates and other biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

SEC625Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates, cell lysates and other biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

SEC625Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates, cell lysates and other biological fluids.

Human Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mercaptopyruvate Sulfurtransferase elisa. Alternative names of the recognized antigen: MST
  • TST2
  • Human Liver Rhodanese
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mercaptopyruvate Sulfurtransferase (MPST) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Mercaptopyruvate Sulfurtransferase ELISA Kit (MPST)

RK01878 96 Tests
EUR 521

Human Mercaptopyruvate Sulfurtransferase(MPST)ELISA Kit

QY-E01844 96T
EUR 361

Mercaptopyruvate Sulfurtransferase (MPST) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody

abx033579-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody

abx033579-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Mercaptopyruvate Sulfurtransferase (MPST)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P25325
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Mercaptopyruvate Sulfurtransferase expressed in: E.coli

Recombinant Mercaptopyruvate Sulfurtransferase (MPST)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99J99
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Mercaptopyruvate Sulfurtransferase expressed in: E.coli

Human Mercaptopyruvate Sulfurtransferase (MPST) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Mercaptopyruvate Sulfurtransferase(MPST)ELISA kit

GA-E0812MS-48T 48T
EUR 336

Mouse Mercaptopyruvate Sulfurtransferase(MPST)ELISA kit

GA-E0812MS-96T 96T
EUR 534

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

abx391594-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

SEC625Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates and other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

SEC625Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates and other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

SEC625Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates and other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

SEC625Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Mercaptopyruvate Sulfurtransferase (MPST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in Tissue homogenates and other biological fluids.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mercaptopyruvate Sulfurtransferase elisa. Alternative names of the recognized antigen: MST
  • TST2
  • Human Liver Rhodanese
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Mercaptopyruvate Sulfurtransferase (MPST) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Mercaptopyruvate Sulfurtransferase(MPST)ELISA kit

QY-E10589 96T
EUR 361

Mouse Mercaptopyruvate Sulfurtransferase(MPST)ELISA kit

QY-E20991 96T
EUR 361

Human Mercaptopyruvate Sulfurtransferase (MPST) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human MPST (Mercaptopyruvate Sulfurtransferase)

ELK4059 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mercaptopyruvate Sulfurtransferase (MPST). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of Mercaptopyruvate Sulfurtransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human 3- mercaptopyruvate sulfurtransferase, MPST ELISA KIT

ELI-29207h 96 Tests
EUR 824

Mouse Mercaptopyruvate Sulfurtransferase (MPST) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mercaptopyruvate Sulfurtransferase (MPST) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Mercaptopyruvate Sulfurtransferase (MPST) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse MPST (Mercaptopyruvate Sulfurtransferase)

ELK6608 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mercaptopyruvate Sulfurtransferase (MPST). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of Mercaptopyruvate Sulfurtransferase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse 3- mercaptopyruvate sulfurtransferase, Mpst ELISA KIT

ELI-29208m 96 Tests
EUR 865

MPST Mercaptopyruvate Sulfurtransferase Human Recombinant Protein

PROTP25325 Regular: 20ug
EUR 317
Description: MPST Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 321 amino acids (1-297) and having a molecular mass of 35kDa.;MPST is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Arg68~Glu278)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST)

ELISA kit for Human 3-mercaptopyruvate sulfurtransferase (MPST)

KTE61552-48T 48T
EUR 332
  • 3-mercaptopyruvate sulfurtransferase encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in lite
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 3-mercaptopyruvate sulfurtransferase (MPST)

KTE61552-5platesof96wells 5 plates of 96 wells
EUR 2115
  • 3-mercaptopyruvate sulfurtransferase encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in lite
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 3-mercaptopyruvate sulfurtransferase (MPST)

KTE61552-96T 96T
EUR 539
  • 3-mercaptopyruvate sulfurtransferase encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in lite
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mpst ELISA Kit| Rat 3-mercaptopyruvate sulfurtransferase ELISA

EF018952 96 Tests
EUR 689

Mpst ELISA Kit| Mouse 3-mercaptopyruvate sulfurtransferase ELIS

EF015485 96 Tests
EUR 689

ELISA kit for Rat 3-mercaptopyruvate sulfurtransferase (MPST)

KTE100587-48T 48T
EUR 332
  • This protein encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat 3-mercaptopyruvate sulfurtransferase (MPST)

KTE100587-5platesof96wells 5 plates of 96 wells
EUR 2115
  • This protein encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat 3-mercaptopyruvate sulfurtransferase (MPST)

KTE100587-96T 96T
EUR 539
  • This protein encoded by MPST catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this prot
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse 3-mercaptopyruvate sulfurtransferase (MPST)

KTE70963-48T 48T
EUR 332
  • Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contribut
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse 3-mercaptopyruvate sulfurtransferase (MPST)

KTE70963-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contribut
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse 3-mercaptopyruvate sulfurtransferase (MPST)

KTE70963-96T 96T
EUR 539
  • Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contribut
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse 3-mercaptopyruvate sulfurtransferase (MPST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Arg68~Glu278)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with APC.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Arg68~Glu278)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with Biotin.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Arg68~Glu278)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with Cy3.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Arg68~Glu278)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with FITC.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Arg68~Glu278)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with HRP.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Arg68~Glu278)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with PE.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Met1~Gln297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST)

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Arg68~Glu278)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with APC-Cy7.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Met1~Gln297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with APC.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Met1~Gln297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with Biotin.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Met1~Gln297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with Cy3.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Met1~Gln297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with FITC.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Met1~Gln297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with HRP.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Met1~Gln297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with PE.

Mercaptopyruvate Sulfurtransferase (MPST) Polyclonal Antibody (Mouse, Rat), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MPST (Met1~Gln297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Mercaptopyruvate Sulfurtransferase (MPST). This antibody is labeled with APC-Cy7.

Mpst/ Rat Mpst ELISA Kit

ELI-52043r 96 Tests
EUR 886


EF005262 96 Tests
EUR 689

MPST ELISA Kit (Human) (OKAN06127)

OKAN06127 96 Wells
EUR 792
Description: Description of target: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL

MPST ELISA Kit (Human) (OKCD08208)

OKCD08208 96 Wells
EUR 975
Description: Description of target: MPST transfer of a sulfur ion to cyanide or to other thiol compounds. MPST also has weak rhodanese activity. MPST may have a role in cyanide degradation or in thiosulfate biosynthesis.This gene encodes a protein which can function as a monomer or as a disulfide-linked homodimer and which catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cyanide degradation and in thiosulfate biosynthesis. The encoded cytoplasmic protein is a member of the rhodanese family but is not rhodanese itself, which is a mitochondrial protein. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

MPST ELISA Kit (Human) (OKDD00402)

OKDD00402 96 Wells
EUR 975
Description: Description of target: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL

Human Thiosulfate sulfurtransferase(TST) ELISA kit

E01T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thiosulfate sulfurtransferase(TST) ELISA kit

E01T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thiosulfate sulfurtransferase(TST) ELISA kit

E01T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thiosulfate sulfurtransferase, TST ELISA KIT

ELI-41961h 96 Tests
EUR 824

Human Thiosulfate Sulfurtransferase (TST) ELISA Kit

abx384004-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Thiosulfate sulfurtransferase(TST) ELISA kit

CSB-EL025197HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thiosulfate sulfurtransferase (TST) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Thiosulfate sulfurtransferase(TST) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thiosulfate sulfurtransferase(TST) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

MPST ELISA Kit (Mouse) (OKCD00343)

OKCD00343 96 Wells
EUR 857
Description: Description of target: Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. Detoxifies cyanide and is required for thiosulfate biosynthesis. Acts as an antioxidant. In combination with cysteine aminotransferase (CAT), contributes to the catabolism of cysteine and is an important producer of hydrogen sulfide in the brain, retina and vascular endothelial cells. Hydrogen sulfide H2S is an important synaptic modulator, signaling molecule, smooth muscle contractor and neuroprotectant. Its production by the 3MST/CAT pathway is regulated by calcium ions.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"3-Mercaptopyruvate sulfurtransferase produces hydrogen sulfide and bound sulfane sulfur in the brain."_x005F_x005F_x000D_Shibuya N., Tanaka M., Yoshida M., Ogasawara Y., Togawa T., Ishii K., Kimura H._x005F_x005F_x000D_Antioxid. Redox Signal. 11:703-714(2009) [PubMed] [Europe PMC] [Abstract]Cited for: DEVELOPMENTAL STAGE, FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY, MUTAGENESIS OF ARG-188; ARG-197 AND CYS-248.Ref.6"Hydrogen sulfide protects the retina from light-induced degeneration by the modulation of Ca2+ influx."_x005F_x005F_x000D_Mikami Y., Shibuya N., Kimura Y., Nagahara N., Yamada M., Kimura H._x005F_x005F_x000D_J. Biol. Chem. 286:39379-39386(2011) [PubMed] [Europe PMC] [Abstract]Cited for: TISSUE SPECIFICITY, FUNCTION.Ref.7"A mechanism of retinal protection from light-induced degeneration by hydrogen sulfide."_x005F_x005F_x000D_Mikami Y., Kimura H._x005F_x005F_x000D_Commun. Integr. Biol. 5:169-171(2012) [PubMed] [Europe PMC] [Abstract]Cited for: TISSUE SPECIFICITY, FUNCTION. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

MPST ELISA Kit (Mouse) (OKDD00763)

OKDD00763 96 Wells
EUR 988
Description: Description of target: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. it may be involved in cysteine degradation and cyanide detoxification. there is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, mpst), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, tst, geneid:7263), which is a mitochondrial protein. deficiency in mpst activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (mcdu). alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

MPST (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MPST antibody

70R-2488 50 ug
EUR 467
Description: Rabbit polyclonal MPST antibody raised against the middle region of MPST

MPST Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPST. Recognizes MPST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


YF-PA13236 50 ug
EUR 363
Description: Mouse polyclonal to MPST


YF-PA13237 100 ug
EUR 403
Description: Rabbit polyclonal to MPST

Mouse Thiosulfate sulfurtransferase(TST) ELISA kit

E03T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thiosulfate sulfurtransferase(TST) ELISA kit

E03T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thiosulfate sulfurtransferase(TST) ELISA kit

E03T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thiosulfate sulfurtransferase(TST) ELISA kit

E02T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thiosulfate sulfurtransferase(TST) ELISA kit

E02T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thiosulfate sulfurtransferase(TST) ELISA kit

E02T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thiosulfate sulfurtransferase(TST) ELISA kit

E04T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thiosulfate sulfurtransferase(TST) ELISA kit

E04T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thiosulfate sulfurtransferase(TST) ELISA kit

E04T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thiosulfate sulfurtransferase(TST) ELISA kit

E08T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thiosulfate sulfurtransferase(TST) ELISA kit

E08T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thiosulfate sulfurtransferase(TST) ELISA kit

E08T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thiosulfate sulfurtransferase(TST) ELISA kit

E07T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thiosulfate sulfurtransferase(TST) ELISA kit

E07T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thiosulfate sulfurtransferase(TST) ELISA kit

E07T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thiosulfate sulfurtransferase(TST) ELISA kit

E06T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thiosulfate sulfurtransferase(TST) ELISA kit

E06T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thiosulfate sulfurtransferase(TST) ELISA kit

E06T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thiosulfate sulfurtransferase(TST) ELISA kit

E09T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thiosulfate sulfurtransferase(TST) ELISA kit

E09T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thiosulfate sulfurtransferase(TST) ELISA kit

E09T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Thiosulfate sulfurtransferase, TST ELISA KIT

ELI-16269b 96 Tests
EUR 928

Chicken Thiosulfate sulfurtransferase, TST ELISA KIT

ELI-17165c 96 Tests
EUR 928

Mouse Thiosulfate sulfurtransferase, Tst ELISA KIT

ELI-37500m 96 Tests
EUR 865

Human MPST shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MPST Recombinant Protein (Human)

RP019792 100 ug Ask for price

Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E01A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E01A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E01A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Thiosulfate Sulfurtransferase

7-03541 5µg Ask for price

Recombinant Human Thiosulfate Sulfurtransferase

7-03542 20µg Ask for price

Recombinant Human Thiosulfate Sulfurtransferase

7-03543 1mg Ask for price

Recombinant human Thiosulfate sulfurtransferase

P2776 100ug Ask for price
  • Uniprot ID: Q16762
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Thiosulfate sulfurtransferase

Guinea pig Thiosulfate sulfurtransferase(TST) ELISA kit

E05T0742-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Thiosulfate sulfurtransferase(TST) ELISA kit

E05T0742-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Thiosulfate sulfurtransferase(TST) ELISA kit

E05T0742-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Thiosulfate sulfurtransferase(TST) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MPST cloning plasmid

CSB-CL014770HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 471
  • Sequence: atggcttcgccgcagctctgccgcgcgctggtgtcggcgcaatgggtggcggaggcgctgcgggccccgcgcgctgggcagcctctgcagctgctggacgcctcctggtacctgccgaagctggggcgcgacgcgcgacgcgagttcgaggagcgccacatcccgggcgccgcttt
  • Show more
Description: A cloning plasmid for the MPST gene.

MPST Rabbit pAb

A11587-100ul 100 ul
EUR 308

MPST Rabbit pAb

A11587-200ul 200 ul
EUR 459

MPST Rabbit pAb

A11587-20ul 20 ul
EUR 183

MPST Rabbit pAb

A11587-50ul 50 ul
EUR 223

MPST Blocking Peptide

33R-2094 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MPST antibody, catalog no. 70R-2488

MPST Polyclonal Antibody

27541-100ul 100ul
EUR 252

MPST Polyclonal Antibody

27541-50ul 50ul
EUR 187

Anti-MPST antibody

STJ113192 100 µl
EUR 277
Description: This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene.

Anti-MPST (1B5)

YF-MA14281 100 ug
EUR 363
Description: Mouse monoclonal to MPST

Thiosulfate Sulfurtransferase (Recombinant)

  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Thiosulfate sulfurtransferase protein

30R-1423 100 ug
EUR 397
Description: Purified recombinant Human Thiosulfate sulfurtransferase protein

MPST ORF Vector (Human) (pORF)

ORF006598 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Thiosulfate Sulfurtransferase (TST) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E06A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E06A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E06A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E03A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E03A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E03A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E04A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E04A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E04A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E02A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E02A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E02A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E07A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E07A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E07A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E09A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E09A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E09A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E08A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E08A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E08A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

MPST Polyclonal Conjugated Antibody

C27541 100ul
EUR 397

Rat MPST shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MPST protein (His tag)

30R-2924 100 ug
EUR 322
Description: Purified recombinant Human MPST protein (His tag)

MPST Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPST. Recognizes MPST from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPST Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPST. Recognizes MPST from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPST Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPST. Recognizes MPST from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MPST Recombinant Protein (Rat)

RP212177 100 ug Ask for price

MPST Recombinant Protein (Mouse)

RP151319 100 ug Ask for price

MPST Recombinant Protein (Mouse)

RP151322 100 ug Ask for price

MPST Recombinant Protein (Mouse)

RP151325 100 ug Ask for price

MPST sgRNA CRISPR Lentivector set (Human)

K1322101 3 x 1.0 ug
EUR 339

E.Coli Thiosulfate sulfurtransferase (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (Rhodanese) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thiosulfate Sulfurtransferase (TST) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody

abx239073-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thiosulfate Sulfurtransferase (TST) Antibody

abx239074-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thiosulfate Sulfurtransferase (TST) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Recombinant Thiosulfate Sulfurtransferase (TST)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16762
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thiosulfate Sulfurtransferase expressed in: E.coli

Recombinant Thiosulfate Sulfurtransferase (TST)

  • EUR 454.82
  • EUR 224.00
  • EUR 1430.56
  • EUR 543.52
  • EUR 987.04
  • EUR 367.00
  • EUR 3426.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P52196
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Thiosulfate Sulfurtransferase expressed in: E.coli

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Rhodanese Thiosulfate Sulfurtransferase Human Recombinant Protein

PROTQ16762 Regular: 20ug
EUR 317
Description: Recombinant Human Rhodanese produced in E.Coli is a single, non-glycosylated polypeptide chain containing 317 amino acids (1-297 a.a) and having a molecular mass of 35.6 kDa. Rhodanese is fused to a 20 amino acid His-Tag at N-terminus and purified by conventional chromatography techniques.

Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E05A1921-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E05A1921-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) ELISA kit

E05A1921-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adenylyltransferase and sulfurtransferase MOCS3(MOCS3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Polyclonal MPST Antibody (N-term)

APR08509G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MPST (N-term). This antibody is tested and proven to work in the following applications:

Mpst ORF Vector (Mouse) (pORF)

ORF050441 1.0 ug DNA
EUR 506

Mpst ORF Vector (Mouse) (pORF)

ORF050442 1.0 ug DNA
EUR 506

Mpst ORF Vector (Mouse) (pORF)

ORF050443 1.0 ug DNA
EUR 506

Mpst ORF Vector (Rat) (pORF)

ORF070727 1.0 ug DNA
EUR 506

MPST sgRNA CRISPR Lentivector (Human) (Target 1)

K1322102 1.0 ug DNA
EUR 154

MPST sgRNA CRISPR Lentivector (Human) (Target 2)

K1322103 1.0 ug DNA
EUR 154

MPST sgRNA CRISPR Lentivector (Human) (Target 3)

K1322104 1.0 ug DNA
EUR 154

Recombinant Human MPST Protein, His, E.coli-1mg

QP12724-1mg 1mg
EUR 2757

Recombinant Human MPST Protein, His, E.coli-20ug

QP12724-20ug 20ug
EUR 201

Recombinant Human MPST Protein, His, E.coli-5ug

QP12724-5ug 5ug
EUR 155

MPST Protein Vector (Human) (pPB-C-His)

PV026389 500 ng
EUR 329

MPST Protein Vector (Human) (pPB-N-His)

PV026390 500 ng
EUR 329

MPST Protein Vector (Human) (pPM-C-HA)

PV026391 500 ng
EUR 329

MPST Protein Vector (Human) (pPM-C-His)

PV026392 500 ng
EUR 329

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TST (Val2~Ala297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST)

Mouse Thiosulfate Sulfurtransferase (TST) Protein

  • EUR 634.00
  • EUR 272.00
  • EUR 1929.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thiosulfate Sulfurtransferase (TST) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiosulfate Sulfurtransferase (TST) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Mpst sgRNA CRISPR Lentivector set (Mouse)

K4481001 3 x 1.0 ug
EUR 339

Mpst sgRNA CRISPR Lentivector set (Rat)

K6947901 3 x 1.0 ug
EUR 339

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Recombinant Human Thiosulfate Sulfurtransferase Like Domain Containing 1

7-03691 2µg Ask for price

Recombinant Human Thiosulfate Sulfurtransferase Like Domain Containing 1

7-03692 10µg Ask for price

Recombinant Human Thiosulfate Sulfurtransferase Like Domain Containing 1

7-03693 1mg Ask for price

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TST (Val2~Ala297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with APC.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TST (Val2~Ala297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with Biotin.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TST (Val2~Ala297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with Cy3.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TST (Val2~Ala297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with FITC.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TST (Val2~Ala297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with HRP.

Thiosulfate Sulfurtransferase (TST) Polyclonal Antibody (Human, Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TST (Val2~Ala297)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiosulfate Sulfurtransferase (TST). This antibody is labeled with PE.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3b) Antibody

abx038013-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenylyltransferase And Sulfurtransferase MOCS3 (MOCS3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Escherichia coli Thiosulfate sulfurtransferase GlpE (glpE)

  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Thiosulfate sulfurtransferase GlpE(glpE) expressed in Yeast

Escherichia coli Thiosulfate sulfurtransferase GlpE (glpE)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 16.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Thiosulfate sulfurtransferase GlpE(glpE) expressed in E.coli

glpE Thiosulfate sulfurtransferase E.Coli Recombinant Protein

PROTP0A6V5 Regular: 20ug
EUR 317
Description: glpE Recombinant produced in E. coli is a single polypeptide chain containing 131 amino acids (1-108) and having a molecular mass of 14.5kDa. glpE is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human MPST(Mercaptopyruvate Sulfurtransferase) ELISA Kit