cDNA Infectious Clones of Soybean Mosaic Virus and Purposeful Identification


In-Yeast Meeting of Coronavirus Infectious cDNA Clones Utilizing a Artificial Genomics Pipeline


The Escherichia coli and vaccinia virus-based reverse genetics strategies have been broadly utilized for the manipulation and engineering of coronavirus genomes. These strategies, nonetheless, present various limitations and are usually powerful to find out in a properly timed technique for (re-)rising viruses. On this chapter, we present a model new frequent reverse genetics platform for the assembly and engineering of infectious full-length cDNAs using yeast-based transformation-associated recombination cloning.


This novel assembly approach not solely ends in safe coronavirus infectious full-length cDNAs cloned inside the yeast Saccharomyces cerevisiae however moreover fosters and accelerates the manipulation of their genomes.


Such a platform is broadly related for the scientific neighborhood, as a result of it requires no explicit gear and might be carried out in an strange laboratory setting. The protocol described might be merely tailor-made to only about all acknowledged or rising coronaviruses, paying homage to Center East respiratory syndrome coronavirus (MERS-CoV).




cDNA from Monkey (Rhesus) Normal Tissue: Brain
C1534035 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Cecum
C1534089 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon
C1534090 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Epididymis
C1534105 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Esophagus
C1534106 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Gallbladder
C1534118 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Heart
C1534122 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Kidney
C1534142 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Liver
C1534149 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Lung
C1534152 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Trachea
C1534160 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Diaphragm
C1534169 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Ovary
C1534183 40 reactions
EUR 939
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Pancreas
C1534188 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Parathyroid
C1534189 40 reactions
EUR 1051
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Parotid
C1534190 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Penis
C1534194 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Placenta
C1534200 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Prostate
C1534201 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Rectum
C1534206 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Skin
C1534218 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Spleen
C1534246 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach
C1534248 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Testis
C1534260 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Throat
C1534263 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Thymus
C1534264 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Thyroid
C1534265 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Tongue
C1534267 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Tonsil
C1534268 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Ureter
C1534273 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus
C1534274 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Vagina
C1534283 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon Ascending
C1534091 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon descending
C1534092 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon Sigmoid
C1534095 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Colon Transverse
C1534096 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Ductus Deferens
C1534100 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Fallopian Tube
C1534115 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Heart: Pericardium
C1534133 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Lymph Node
C1534161 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Skeletal Muscle
C1534171 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine
C1534226 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Spinal Cord
C1534234 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Cardia
C1534250 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Corpus
C1534251 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Fundus
C1534252 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Stomach: Pylorus
C1534253 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Cervix
C1534275 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Corpus
C1534276 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Fundus
C1534278 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Blood Vessel: Artery
C1534013 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Blood Vessel: Vein
C1534020 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Duodenum
C1534101 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Liver: Left Lobe
C1534150 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Liver: Right Lobe
C1534151 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Ileum
C1534227 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Monkey (Rhesus) Normal Tissue: Small Intestine: Jejunum
C1534230 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
SAA1, monkey (rhesus macaque)
RC326-12 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Other
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey)
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa)
Immunoglobulin A (IgA) Polyclonal Antibody (Rhesus monkey)
  • EUR 310.00
  • EUR 3500.00
  • EUR 850.00
  • EUR 400.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Immunoglobulin A (IgA)
Cyclophilin A (CYPA) Polyclonal Antibody (Rhesus monkey)
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYPA (Val2~Glu165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Cyclophilin A (CYPA)
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala23~Pro101
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8)
Interleukin 8 (IL8) Monoclonal Antibody (Rhesus monkey)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Interleukin 8 (IL8)
Interleukin 5 (IL5) Polyclonal Antibody (Rhesus monkey)
  • EUR 269.00
  • EUR 2866.00
  • EUR 706.00
  • EUR 342.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL5 (Ile20~Ser134)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 5 (IL5)
Interleukin 6 (IL6) Polyclonal Antibody (Rhesus monkey)
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL6 (Pro27~Met212)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 6 (IL6)
Interleukin 8 (IL8) Polyclonal Antibody (Rhesus monkey)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL8 (Ala23~Pro101)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interleukin 8 (IL8)
Cathepsin K (CTSK) Monoclonal Antibody (Rhesus monkey)
  • EUR 278.00
  • EUR 3011.00
  • EUR 739.00
  • EUR 355.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro116~Met329
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rhesus monkey Cathepsin K (CTSK)
Monoclonal CD4 Antibody (clone 5D9), Clone: 5D9
AMM02279G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human CD4 (clone 5D9). The antibodies are raised in Mouse and are from clone 5D9. This antibody is applicable in WB and IHC-P
Monoclonal CD4 Antibody, Clone: B486A1
APR15351G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human CD4. The antibodies are raised in Mouse and are from clone B486A1. This antibody is applicable in FC, E
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Hu-48T 48T
EUR 498
  • Should the Human Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Hu-96T 96T
EUR 647
  • Should the Human Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Mu-48T 48T
EUR 508
  • Should the Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Mu-96T 96T
EUR 661
  • Should the Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Ra-48T 48T
EUR 528
  • Should the Rat Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation 4 (CD4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Ra-96T 96T
EUR 690
  • Should the Rat Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation 4 (CD4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Hu-48Tests 48 Tests
EUR 522
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Hu-96Tests 96 Tests
EUR 724
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Mu-48Tests 48 Tests
EUR 534
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Mu-96Tests 96 Tests
EUR 742
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Ra-48Tests 48 Tests
EUR 558
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RDR-CD4-Ra-96Tests 96 Tests
EUR 776
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Hu-48Tests 48 Tests
EUR 500
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Hu-96Tests 96 Tests
EUR 692
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Mu-48Tests 48 Tests
EUR 511
Mouse Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Mu-96Tests 96 Tests
EUR 709
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Ra-48Tests 48 Tests
EUR 534
Rat Cluster Of Differentiation 4 (CD4) ELISA Kit
RD-CD4-Ra-96Tests 96 Tests
EUR 742
Rhesus macaque CD4 Protein (Lys 26-Trp 390) [His]
VAng-1300Lsx-100g 100 µg
EUR 738
Description: Rhesus macaque CD4, His tag, is expressed in HEK 293 cells. (Uniprot ID: G7N5T8)
Rhesus macaque CD4 Protein (Lys 26-Trp 390) [His]
VAng-1300Lsx-1mg 1 mg
EUR 4449
Description: Rhesus macaque CD4, His tag, is expressed in HEK 293 cells. (Uniprot ID: G7N5T8)
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), APC
  • EUR 380.00
  • EUR 3779.00
  • EUR 1038.00
  • EUR 490.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with APC.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), Biotinylated
  • EUR 337.00
  • EUR 2829.00
  • EUR 819.00
  • EUR 417.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with Biotin.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), Cy3
  • EUR 465.00
  • EUR 4997.00
  • EUR 1343.00
  • EUR 612.00
  • EUR 271.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with Cy3.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), FITC
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with FITC.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), HRP
  • EUR 346.00
  • EUR 3291.00
  • EUR 916.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with HRP.
Interferon Alpha (IFNa) Polyclonal Antibody (Rhesus monkey), PE
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rhesus monkey Interferon Alpha (IFNa). This antibody is labeled with PE.


Synthesis of Full-Size cDNA Infectious Clones of Soybean Mosaic Virus and Purposeful Identification of a Key Amino Acid inside the Silencing Suppressor Hc-Professional


  • Soybean mosaic virus (SMV), which belongs to the Potyviridae, causes important reductions in soybean yield and seed top quality. On this study, every tag-free and reporter gene inexperienced fluorescent protein (GFP)-containing infectious clones for the SMV N1 strain have been constructed by Gibson assembly and with the yeast homologous recombination system, respectively.


  • Each infectious clones are applicable for agroinfiltration on the model host benthamiana and current sturdy infectivity for the pure host soybean and several other different totally different legume species. Each infectious clones have been seed transmitted and prompted typical virus indicators on seeds and progeny crops. We used the SMV-GFP infectious clone to further study the perform of key amino acids inside the silencing suppressor helper component-proteinase (Hc-Professional).


  • Amongst twelve amino acid substitution mutants, the co-expression of mutant 2-with an Asparagine→Leucine substitution at place 182 of the FRNK (Phe-Arg-Asn-Lys) motif-attenuated viral indicators and alleviated the host progress retardation introduced on by SMV.


  • Furthermore, the Hc-Prom2 mutant confirmed stronger oligomerization than wild-type Hc-Professional. Taken collectively, the SMV infectious clones could be useful for analysis of host-SMV interactions and helpful gene characterization in soybeans and related legume species, notably by the use of seed transmission properties. Moreover, the SMV-GFP infectious clone will even facilitate helpful analysis of every virus and host genes in an benthamiana transient expression system.


Profiling of rice Cd-tolerant genes by the use of yeast-based cDNA library survival screening

The bioaccumulation of cadmium (Cd) in crop and the subsequent meals chain has aroused intensive issues. Nevertheless, the underlying molecular mechanisms of plant Cd tolerance keep to be clarified from the viewpoint of novel candidate genes.


Right right here we described a extraordinarily surroundings pleasant technique for preliminary determining rice Cd-tolerant genes by the use of the yeast-based cDNA library survival screening combined with high-throughput sequencing approach. About 690 gene isoforms have been acknowledged as being Cd-tolerant candidates using this shotgun technique.


Among the various Cd-tolerant genes acknowledged, various lessons of genes paying homage to BAX inhibitor (BI), NAC transcription components and Fast ALkalinization Elements (RALFs) have been of particular curiosity, and their carry out of Cd tolerance was further validated by heterologous expression, which urged that SNAC1, RALF12, OsBI-1 can confer Cd tolerance in yeast and tobacco leaves.


Relating to the genes involved in ion transport, the validated Cd-tolerant heavy metal-associated space (HMAD) isoprenylated protein HIPP42 was considerably noteworthy. Additional elucidation of these genes associated to Cd tolerance in rice will revenue agricultural actions.


Single-Cell Transcriptomics of Immune Cells: Cell Isolation and cDNA Library Era for scRNA-Seq


Single-cell RNA-sequencing (scRNA-seq) permits an entire analysis of the transcriptome of explicit particular person cells by next-generation sequencing. ScRNA-seq offers an unbiased technique to investigate the cell heterogeneity and dynamics of assorted natural strategies, along with the immune system. Optimization of the technical procedures carried out earlier to RNA-seq analysis is essential to the success of a scRNA-seq experiment.


Right right here, three major experimental procedures are described: (1) the isolation of immune CD8a+ T cells from major murine tissue, (2) the expertise of single-cell cDNA libraries using the 10× Genomics Chromium Controller and the Chromium Single Cell 3′ Answer, and (3) cDNA library top quality administration. On this protocol, CD8a+ T cells are isolated from murine spleen tissue, nonetheless any cell sort of curiosity might be enriched and used for single-cell cDNA library expertise and subsequent RNA-seq experiments.


Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

RD-CCR6-Hu-96Tests 96 Tests
EUR 723

Anti-CCR6/CCR6 Antibody

PA1201 100ug/vial
EUR 294


MO15087 100 ug
EUR 409

CCR6 antibody

70R-13797 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CCR6 antibody

CCR6 Antibody

37466-100ul 100ul
EUR 252

CCR6 antibody

10R-1071 100 ul
EUR 316
Description: Mouse monoclonal CCR6 antibody

CCR6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CCR6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

CCR6 Antibody

DF10207 200ul
EUR 304
Description: CCR6 Antibody detects endogenous levels of total CCR6.

CCR6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCR6 Antibody

ABD10207 100 ug
EUR 438

CCR6 Rabbit pAb

A16206-100ul 100 ul
EUR 308

CCR6 Rabbit pAb

A16206-200ul 200 ul
EUR 459

CCR6 Rabbit pAb

A16206-20ul 20 ul
EUR 183

CCR6 Rabbit pAb

A16206-50ul 50 ul
EUR 223

CCR6 Blocking Peptide

DF10207-BP 1mg
EUR 195

Anti-CCR6 Antibody

A00957 100ug/vial
EUR 334

Anti-CCR6 Antibody

A00061-1 200ug
EUR 397
Description: Goat Polyclonal CCR6 Antibody. Validated in ELISA, IHC and tested in Human, Mouse.

CCR6 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CCR6 Conjugated Antibody

C37466 100ul
EUR 397

CCR6 cloning plasmid

CSB-CL004845HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atgagcggggaatcaatgaatttcagcgatgttttcgactccagtgaagattattttgtgtcagtcaatacttcatattactcagttgattctgagatgttactgtgctccttgcaggaggtcaggcagttctccaggctatttgtaccgattgcctactccttgatctgtgtct
  • Show more
Description: A cloning plasmid for the CCR6 gene.

CCR6 Polyclonal Antibody

A50105 100 µg
EUR 570.55
Description: kits suitable for this type of research

CCR6 inhibitor 1

HY-112701 10mg
EUR 911

Anti-CCR6 antibody

STJ118659 100 µl
EUR 277

Anti-CCR6 Antibody

STJ500414 100 µg
EUR 476

CCR6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCR6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCR6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCR6. Recognizes CCR6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human CCR6 ELISA Kit

ELA-E2014h 96 Tests
EUR 824


EF006138 96 Tests
EUR 689

Mouse CCR6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCR6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-CCR6 Antibody (Biotin)

STJ500416 100 µg
EUR 586

Anti-CCR6 Antibody (FITC)

STJ500417 100 µg
EUR 586

CCR6 Recombinant Protein (Human)

RP006232 100 ug Ask for price

CCR6 Recombinant Protein (Rat)

RP193790 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122255 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122258 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122261 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122264 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122267 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122270 100 ug Ask for price

CCR6 Recombinant Protein (Mouse)

RP122273 100 ug Ask for price

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

EUR 294

Evo? cDNA Kit

EUR 234

Novo? cDNA Kit

EUR 354

Novo? cDNA Kit

EUR 267

Evo? cDNA Supermix

EUR 381

Evo? cDNA Supermix

EUR 267

Novo? cDNA Supermix

EUR 441

Novo? cDNA Supermix

EUR 289

Polyclonal CCR6 Antibody (C-Terminus)

APR15281G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCR6 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal CCR6 Antibody (Cytoplasmic Domain)

APR15282G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCR6 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal CCR6 Antibody (Extracellular Domain)

APR15283G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCR6 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal CCR6 Antibody (aa18-46)

APR15308G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CCR6 (aa18-46). This antibody is tested and proven to work in the following applications:

CCR6 Polyclonal Antibody, HRP Conjugated

A50106 100 µg
EUR 570.55
Description: fast delivery possible

CCR6 Polyclonal Antibody, FITC Conjugated

A50107 100 µg
EUR 570.55
Description: reagents widely cited

CCR6 Polyclonal Antibody, Biotin Conjugated

A50108 100 µg
EUR 570.55
Description: Ask the seller for details

Ccr6 ORF Vector (Rat) (pORF)

ORF064598 1.0 ug DNA
EUR 506

h CCR6 inducible lentiviral particles

LVP513 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made optional inducible lentiviral particles for expressing human target: h CCR6 inducible lentiviral particles (alternative name: BN-1, C-C CKR-6, CC-CKR-6, CCR-6, CD196, CKR-L3, CKRL3, CMKBR6, DCR2, DRY6, GPR29, GPRCY4, STRL22). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_004367.5. Particles also contains a RFP-Blasticidin dual selection marker.

CCR6 ORF Vector (Human) (pORF)

ORF002078 1.0 ug DNA
EUR 95

Ccr6 ORF Vector (Mouse) (pORF)

ORF040753 1.0 ug DNA
EUR 506

Ccr6 ORF Vector (Mouse) (pORF)

ORF040754 1.0 ug DNA
EUR 506

Ccr6 ORF Vector (Mouse) (pORF)

ORF040755 1.0 ug DNA
EUR 506

Ccr6 ORF Vector (Mouse) (pORF)

ORF040756 1.0 ug DNA
EUR 506

Ccr6 ORF Vector (Mouse) (pORF)

ORF040757 1.0 ug DNA
EUR 506

Ccr6 ORF Vector (Mouse) (pORF)

ORF040758 1.0 ug DNA
EUR 506

Ccr6 ORF Vector (Mouse) (pORF)

ORF040759 1.0 ug DNA
EUR 506

CCR6 ELISA Kit (Human) (OKCD07908)

OKCD07908 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

CCR6 ELISA Kit (Mouse) (OKCD07909)

OKCD07909 96 Wells
EUR 1001
Description: Description of target: Receptor for the C-C type chemokine CCL20. Binds to CCL20 and subsequently transduces a signal by increasing the intracellular calcium ion levels (PubMed:20068036). Although CCL20 is its major ligand it can also act as a receptor for non-chemokine ligands such as beta-defensins (PubMed:25122636). Binds to defensin DEFB1 leading to increase in intracellular calcium ions and cAMP levels. Its binding to DEFB1 is essential for the function of DEFB1 in regulating sperm motility and bactericidal activity. Binds to defensins DEFB4 and DEFB4A/B and mediates their chemotactic effects (PubMed:20068036). The ligand-receptor pair CCL20-CCR6 is responsible for the chemotaxis of dendritic cells (DC), effector/memory T-cells and B-cells and plays an important role at skin and mucosal surfaces under homeostatic and inflammatory conditions, as well as in pathology, including cancer and various autoimmune diseases. CCR6-mediated signals are essential for immune responses to microbes in the intestinal mucosa and in the modulation of inflammatory responses initiated by tissue insult and trauma (PubMed:21376174). CCR6 is essential for the recruitment of both the proinflammatory IL17 producing helper T-cells (Th17) and the regulatory T-cells (Treg) to sites of inflammation (PubMed:19050256). Required for the normal migration of Th17 cells in Peyers patches and other related tissue sites of the intestine and plays a role in regulating effector T-cell balance and distribution in inflamed intestine (PubMed:19129757). Plays an important role in the coordination of early thymocyte precursor migration events important for normal subsequent thymocyte precursor development, but is not required for the formation of normal thymic natural regulatory T-cells (nTregs). Required for optimal differentiation of DN2 and DN3 thymocyte precursors (PubMed:24638065). Essential for B-cell localization in the subepithelial dome of Peyers-patches and for efficient B-cell isotype switching to IgA in the Peyers-patches (PubMed:27174992). Essential for appropriate anatomical distribution of memory B-cells in the spleen and for the secondary recall response of memory B-cells (PubMed:25505290). Positively regulates sperm motility and chemotaxis via its binding to CCL20 (PubMed:23765988).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL

CCR6 ELISA Kit (Mouse) (OKEH03436)

OKEH03436 96 Wells
EUR 662
Description: Description of target: Receptor for the C-C type chemokine CCL20. Binds to CCL20 and subsequently transduces a signal by increasing the intracellular calcium ion levels (PubMed:20068036). Although CCL20 is its major ligand it can also act as a receptor for non-chemokine ligands such as beta-defensins (PubMed:25122636). Binds to defensin DEFB1 leading to increase in intracellular calcium ions and cAMP levels. Its binding to DEFB1 is essential for the function of DEFB1 in regulating sperm motility and bactericidal activity. Binds to defensins DEFB4 and DEFB4A/B and mediates their chemotactic effects (PubMed:20068036). The ligand-receptor pair CCL20-CCR6 is responsible for the chemotaxis of dendritic cells (DC), effector/memory T-cells and B-cells and plays an important role at skin and mucosal surfaces under homeostatic and inflammatory conditions, as well as in pathology, including cancer and various autoimmune diseases. CCR6-mediated signals are essential for immune responses to microbes in the intestinal mucosa and in the modulation of inflammatory responses initiated by tissue insult and trauma (PubMed:21376174). CCR6 is essential for the recruitment of both the proinflammatory IL17 producing helper T-cells (Th17) and the regulatory T-cells (Treg) to sites of inflammation (PubMed:19050256). Required for the normal migration of Th17 cells in Peyers patches and other related tissue sites of the intestine and plays a role in regulating effector T-cell balance and distribution in inflamed intestine (PubMed:19129757). Plays an important role in the coordination of early thymocyte precursor migration events important for normal subsequent thymocyte precursor development, but is not required for the formation of normal thymic natural regulatory T-cells (nTregs). Required for optimal differentiation of DN2 and DN3 thymocyte precursors (PubMed:24638065). Essential for B-cell localization in the subepithelial dome of Peyers-patches and for efficient B-cell isotype switching to IgA in the Peyers-patches (PubMed:27174992). Essential for appropriate anatomical distribution of memory B-cells in the spleen and for the secondary recall response of memory B-cells (PubMed:25505290). Positively regulates sperm motility and chemotaxis via its binding to CCL20 (PubMed:23765988).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL

CCR6 ELISA Kit (Human) (OKAN05540)

OKAN05540 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

pECMV-Ccr6-m-FLAG Plasmid

PVT14903 2 ug
EUR 325

pECMV-Ccr6-m-FLAG Plasmid

PVT15327 2 ug
EUR 325

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

SEC014Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in tissue homogenates, cell lysates and other biological fluids.

Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

SEC014Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in tissue homogenates, cell lysates and other biological fluids.

Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

SEC014Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in tissue homogenates, cell lysates and other biological fluids.

Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

SEC014Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in tissue homogenates, cell lysates and other biological fluids.

Human Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chemokine C-C-Motif Receptor 6 elisa. Alternative names of the recognized antigen: CD196
  • BN-1
  • CKR-L3
  • CKR6
  • CKRL3
  • CMKBR6
  • DCR2
  • DRY-6
  • GPR-CY4
  • GPR29
  • GPRCY4
  • STRL22
  • Chemokine receptor-like 3
  • LARC receptor
  • G-protein coupled recept
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chemokine C-C-Motif Receptor 6 (CCR6) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

SEC014Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

SEC014Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

SEC014Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

SEC014Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Chemokine C-C-Motif Receptor 6 (CCR6) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chemokine C-C-Motif Receptor 6 elisa. Alternative names of the recognized antigen: CD196
  • BN-1
  • CKR-L3
  • CKR6
  • CKRL3
  • CMKBR6
  • DCR2
  • DRY-6
  • GPR-CY4
  • GPR29
  • GPRCY4
  • STRL22
  • Chemokine receptor-like 3
  • LARC receptor
  • G-protein coupled recept
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Chemokine C-C-Motif Receptor 6 (CCR6) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Leave a Reply

Your email address will not be published. Required fields are marked *