Evaluation of a stress-induced cDNA encoding the interpretation

Dissecting effectivity of a 5′ quick amplification of cDNA ends (5′-RACE) technique for profiling T-cell receptor beta repertoire

• Deep sequencing of T-cell receptor (TCR) genes is extremely efficient at profiling immune repertoire. To arrange a TCR sequencing library, multiplex polymerase chain response (mPCR) is broadly utilized and is extraordinarily atmosphere pleasant.

 

• That’s, most mPCR merchandise embody the realm important for antigen recognition, which moreover signifies widespread V(D)J recombination. Multiplex PCR, nonetheless, might endure from primer bias. A promising completely different is 5′-RACE, which avoids primer bias by making use of only one primer pair. In 5′-RACE data, nonetheless, non-regular V(D)J recombination (e.g., TCR sequences and never utilizing a V gene part) has been seen and the frequency varies (30-80%) between analysis.

 

• This implies that the rationale for or learn the way to reduce non-regular TCR sequences is not however well-known by the science neighborhood. Though it is doable to take a place the set off by evaluating the 5′-RACE protocols, cautious experimental affirmation is required and such a scientific look at continues to be not obtainable.

 

• Right right here, we examined the 5′-RACE protocol of a industrial tools and demonstrated how a modification elevated the fraction of regular TCR-β sequences to >85%. We moreover found a sturdy linear correlation between the fraction of fast DNA fragments and the proportion of non-regular TCR-β sequences, indicating that the presence of fast DNA fragments throughout the library was the first purpose behind non-regular TCR-β sequences.

 

• Subsequently, thorough elimination of fast DNA fragments from a 5′-RACE library is the essential factor to extreme data effectivity. We extraordinarily advocate conducting a fraction measurement analysis sooner than sequencing, and the fraction of fast DNA fragments could be utilized to estimate the proportion of non-regular TCR sequences. As deep sequencing of TCR genes continues to be comparatively pricey, good top quality administration have to be worthwhile.

NUDCD3 Antibody
1-CSB-PA811605LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

pENTR223- NUDCD3
PVT11465	Lifescience Market	2 ug	EUR 273

anti-NUDCD3
YF-PA17860	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NUDCD3

NUDCD3 Conjugated Antibody
C42980	SAB	100ul	EUR 397

anti- NUDCD3 antibody
FNab05897	FN Test	100µg	EUR 585
Immunogen: NudC domain containing 3 Uniprot ID: Q8IVD9 Gene ID: 23386 Research Area: Cell Division and Proliferation
Description: Antibody raised against NUDCD3

NUDCD3 Polyclonal Antibody
A60090	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NUDCD3 Rabbit pAb
A18436-100ul	Abclonal	100 ul	EUR 308

NUDCD3 Rabbit pAb
A18436-200ul	Abclonal	200 ul	EUR 459

NUDCD3 Rabbit pAb
A18436-20ul	Abclonal	20 ul	EUR 183

NUDCD3 Rabbit pAb
A18436-50ul	Abclonal	50 ul	EUR 223

NUDCD3 Blocking Peptide
33R-4441	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUDCD3 antibody, catalog no. 70R-3285

NUDCD3 cloning plasmid
CSB-CL811605HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 663 Sequence: atggcccatggttcacaggaggcagaagctccaggagcagttgctggtgctgctgaagtccctagggaaccaccaattcttcccaggattcaggagcagttccagaaaaatcccgacagttacaatggtgctgtccgagagaactacacctggtcacaggactatactgacctgga Show more
Description: A cloning plasmid for the NUDCD3 gene.

NUDCD3 cloning plasmid
CSB-CL811605HU2-10ug	Cusabio	10ug	EUR 413
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1086 Sequence: atggagccaggggcggccgagctgtatgaccaggcccttttgggcatcctgcagcacgtgggcaacgtccaggatttcctgcgcgttctctttggcttcctctaccgcaagacagacttctatcgcttgctgcgccacccatcggaccgcatgggcttcccgcccggggccgcgc Show more
Description: A cloning plasmid for the NUDCD3 gene.

Anti-NUDCD3 antibody
PAab05897	Lifescience Market	100 ug	EUR 412

pCMV-SPORT6-NUDCD3
PVT12543	Lifescience Market	2 ug	EUR 391

Anti-NUDCD3 antibody
STJ11100390	St John's Laboratory	100 µl	EUR 277

Mouse NUDCD3 shRNA Plasmid
20-abx980627	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NUDCD3 ELISA KIT|Human
EF001364	Lifescience Market	96 Tests	EUR 689

Human NUDCD3 shRNA Plasmid
20-abx958230	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NUDCD3 Antibody, HRP conjugated
1-CSB-PA811605LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUDCD3 Antibody, FITC conjugated
1-CSB-PA811605LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUDCD3 Antibody, Biotin conjugated
1-CSB-PA811605LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NUDCD3 Recombinant Protein (Human)
RP021817	ABM	100 ug	Ask for price

NUDCD3 Recombinant Protein (Human)
RP021820	ABM	100 ug	Ask for price

NUDCD3 Recombinant Protein (Rat)
RP214763	ABM	100 ug	Ask for price

NUDCD3 Recombinant Protein (Mouse)
RP155360	ABM	100 ug	Ask for price

NUDCD3 Polyclonal Antibody, Biotin Conjugated
A60091	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

NUDCD3 Polyclonal Antibody, FITC Conjugated
A60092	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NUDCD3 Polyclonal Antibody, HRP Conjugated
A60093	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NUDCD3 ORF Vector (Human) (pORF)
ORF007273	ABM	1.0 ug DNA	EUR 95

NUDCD3 ORF Vector (Human) (pORF)
ORF007274	ABM	1.0 ug DNA	EUR 95

Nudcd3 ORF Vector (Rat) (pORF)
ORF071589	ABM	1.0 ug DNA	EUR 506

Nudcd3 ORF Vector (Mouse) (pORF)
ORF051788	ABM	1.0 ug DNA	EUR 506

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294

Evo? cDNA Kit
M1164-25	Biovision		EUR 234

Novo? cDNA Kit
M1165-100	Biovision		EUR 354

Novo? cDNA Kit
M1165-25	Biovision		EUR 267

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289

NudC Domain Containing 3 (NUDCD3) Antibody
abx235897-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

NudC Domain Containing 3 (NUDCD3) Antibody
20-abx302663	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NUDCD3 sgRNA CRISPR Lentivector set (Human)
K1463701	ABM	3 x 1.0 ug	EUR 339

Nudcd3 sgRNA CRISPR Lentivector set (Mouse)
K4846501	ABM	3 x 1.0 ug	EUR 339

Nudcd3 sgRNA CRISPR Lentivector set (Rat)
K7522401	ABM	3 x 1.0 ug	EUR 339

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441

NudC Domain Containing 3 (NUDCD3) Antibody (HRP)
20-abx308546	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NudC Domain Containing 3 (NUDCD3) Antibody (FITC)
20-abx308547	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NudC Domain Containing 3 (NUDCD3) Antibody (Biotin)
20-abx308548	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1463702	ABM	1.0 ug DNA	EUR 154

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1463703	ABM	1.0 ug DNA	EUR 154

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1463704	ABM	1.0 ug DNA	EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4846502	ABM	1.0 ug DNA	EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4846503	ABM	1.0 ug DNA	EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4846504	ABM	1.0 ug DNA	EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7522402	ABM	1.0 ug DNA	EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7522403	ABM	1.0 ug DNA	EUR 154

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7522404	ABM	1.0 ug DNA	EUR 154

NUDCD3 Protein Vector (Human) (pPB-C-His)
PV029089	ABM	500 ng	EUR 329

NUDCD3 Protein Vector (Human) (pPB-N-His)
PV029090	ABM	500 ng	EUR 329

NUDCD3 Protein Vector (Human) (pPM-C-HA)
PV029091	ABM	500 ng	EUR 329

NUDCD3 Protein Vector (Human) (pPM-C-His)
PV029092	ABM	500 ng	EUR 329

NUDCD3 Protein Vector (Human) (pPB-C-His)
PV029093	ABM	500 ng	EUR 329

NUDCD3 Protein Vector (Human) (pPB-N-His)
PV029094	ABM	500 ng	EUR 329

NUDCD3 Protein Vector (Human) (pPM-C-HA)
PV029095	ABM	500 ng	EUR 329

NUDCD3 Protein Vector (Human) (pPM-C-His)
PV029096	ABM	500 ng	EUR 329

NUDCD3 Protein Vector (Mouse) (pPB-C-His)
PV207150	ABM	500 ng	EUR 603

NUDCD3 Protein Vector (Mouse) (pPB-N-His)
PV207151	ABM	500 ng	EUR 603

NUDCD3 Protein Vector (Mouse) (pPM-C-HA)
PV207152	ABM	500 ng	EUR 603

NUDCD3 Protein Vector (Mouse) (pPM-C-His)
PV207153	ABM	500 ng	EUR 603

NUDCD3 Protein Vector (Rat) (pPB-C-His)
PV286354	ABM	500 ng	EUR 603

NUDCD3 Protein Vector (Rat) (pPB-N-His)
PV286355	ABM	500 ng	EUR 603

NUDCD3 Protein Vector (Rat) (pPM-C-HA)
PV286356	ABM	500 ng	EUR 603

NUDCD3 Protein Vector (Rat) (pPM-C-His)
PV286357	ABM	500 ng	EUR 603

Nudcd3 3'UTR GFP Stable Cell Line
TU164400	ABM	1.0 ml	Ask for price

NUDCD3 3'UTR Luciferase Stable Cell Line
TU016058	ABM	1.0 ml	EUR 2333

Nudcd3 3'UTR Luciferase Stable Cell Line
TU114400	ABM	1.0 ml	Ask for price

NUDCD3 3'UTR GFP Stable Cell Line
TU066058	ABM	1.0 ml	EUR 2333

Nudcd3 3'UTR GFP Stable Cell Line
TU264265	ABM	1.0 ml	Ask for price

Nudcd3 3'UTR Luciferase Stable Cell Line
TU214265	ABM	1.0 ml	Ask for price

cDNA from Alzheimer's Disease: Brain
C1236035Alz	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain
C1236035Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain
C1236035Par	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus
C1236052Dem	Biochain	40 reactions	EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus
C1236052Dep	Biochain	40 reactions	EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon
C1236090Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus
C1236106Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

 

Analysis discover: Massive gene family of phosphoenolpyruvate carboxylase throughout the crassulacean acid metabolism plant Kalanchoepinnata (Crassulaceae) characterised by partial cDNA sequence analysis

Clones coding for a 1100-bp cDNA sequence of phosphoenolpyruvate carboxylase (PEPC) of the constitutive crassulacean acid metabolism (CAM) plant Kalanchoepinnata (Lam.) Pers., have been isolated by reverse transcription-polymerase chain response (RT-PCR) and characterised by restriction fragment measurement polymorphism analysis and DNA sequencing.

 

Seven distinct PEPC isogenes have been recovered, four in leaves and three in roots (EMBL accession numbers: AJ344052-AJ344058). Sequence similarity comparisons and distance neighbour-joining calculations separate the seven PEPC isoforms into two clades, one among which includes the three PEPCs current in roots. The second clade includes the four isoforms current in leaves and is cut up into two branches, one among which includes two PEPCs most associated with described beforehand CAM isoforms.

 

Of these two isoforms, nonetheless, only one exhibited appreciable expression in CAM-performing leaves, nevertheless not in very youthful leaves, which do not exhibit CAM, suggesting this isoform encodes a CAM-specific PEPC. Protein sequence calculations counsel that each one isogenes are seemingly derived from an ordinary ancestor gene, presumably by serial gene duplication events. To our knowledge, that’s primarily essentially the most full identification of a PEPC gene family from a CAM plant, and one of the best number of PEPC isogenes reported for any vascular plant thus far.

 

 

Molecular analysis of a stress-induced cDNA encoding the interpretation initiation subject, eIF1, from the salt-tolerant wild relative of rice, Porteresiacoarctata

The analysis of plant response to emphasise is an important path to the invention of genes conferring stress tolerance. Protein synthesis is very delicate to salt stress and proteins involved on this course of is also an important determinant of salt tolerance.

 

The halophytic plant, PorteresiacoarctataTateoka, is an in depth relative of Oryzasativa L., and has the facility to resist sudden changes throughout the soil salinity. The interpretation initiation subject 1 (PceIF1) cDNA was isolated from the leaves of P. coarctata that had been subjected to a high-salt remedy (150 mm NaCl). An expression look at confirmed that the abundance of eIF1 transcripts elevated to a most diploma 5 d after stress induction after which decreased to ranges very like leaves of administration (unsalinised) crops.

 

This gene was moreover up-regulated in exogenous abscisic acid (ABA) and mannitol therapies, suggesting that its induction is expounded to the water deficit influence of extreme salt. Our analysis confirmed that expression ranges of eIF1 transcripts may variety a helpful indicator for monitoring a stress-responsive mechanism that operates throughout the leaves of P. coarctata.

 

WDR78 cloning plasmid
CSB-CL719620HU2-10ug	Cusabio	10ug	EUR 822
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2547 Sequence: atgacgcccggcaaacattccggagcctcggcccgagccgctaacgcaggagcttgggggtacagggacttcagaggcggccaaaaaaaggggtggtggaccactccccagctggtcgccaccatgccagtctctccggcaggcagtcacaagcagcagaacttcgggttgaaca Show more
Description: A cloning plasmid for the WDR78 gene.

Rat WDR78 shRNA Plasmid
20-abx989767	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse WDR78 shRNA Plasmid
20-abx982585	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human WDR78 shRNA Plasmid
20-abx962588	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Wdr78 ORF Vector (Rat) (pORF)
ORF079111	ABM	1.0 ug DNA	EUR 506

WDR78 ORF Vector (Human) (pORF)
ORF011578	ABM	1.0 ug DNA	EUR 95

WDR78 ORF Vector (Human) (pORF)
ORF014948	ABM	1.0 ug DNA	EUR 354

Wdr78 ORF Vector (Mouse) (pORF)
ORF061805	ABM	1.0 ug DNA	EUR 506

WDR78 sgRNA CRISPR Lentivector set (Human)
K2635401	ABM	3 x 1.0 ug	EUR 339

Wdr78 sgRNA CRISPR Lentivector set (Mouse)
K4526301	ABM	3 x 1.0 ug	EUR 339

Wdr78 sgRNA CRISPR Lentivector set (Rat)
K6359901	ABM	3 x 1.0 ug	EUR 339

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294

Evo? cDNA Kit
M1164-25	Biovision		EUR 234

Novo? cDNA Kit
M1165-100	Biovision		EUR 354

Novo? cDNA Kit
M1165-25	Biovision		EUR 267

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

WD Repeat-Containing Protein 78 (WDR78) Antibody
abx037278-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

WDR78 sgRNA CRISPR Lentivector (Human) (Target 1)
K2635402	ABM	1.0 ug DNA	EUR 154

WDR78 sgRNA CRISPR Lentivector (Human) (Target 2)
K2635403	ABM	1.0 ug DNA	EUR 154

WDR78 sgRNA CRISPR Lentivector (Human) (Target 3)
K2635404	ABM	1.0 ug DNA	EUR 154

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4526302	ABM	1.0 ug DNA	EUR 154

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4526303	ABM	1.0 ug DNA	EUR 154

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4526304	ABM	1.0 ug DNA	EUR 154

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6359902	ABM	1.0 ug DNA	EUR 154

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6359903	ABM	1.0 ug DNA	EUR 154

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6359904	ABM	1.0 ug DNA	EUR 154

WDR78 Protein Vector (Human) (pPB-C-His)
PV059789	ABM	500 ng	EUR 481

WDR78 Protein Vector (Human) (pPB-N-His)
PV059790	ABM	500 ng	EUR 481

WDR78 Protein Vector (Human) (pPM-C-HA)
PV059791	ABM	500 ng	EUR 481

WDR78 Protein Vector (Human) (pPM-C-His)
PV059792	ABM	500 ng	EUR 481

WDR78 Protein Vector (Human) (pPB-C-His)
PV046309	ABM	500 ng	EUR 329

WDR78 Protein Vector (Human) (pPB-N-His)
PV046310	ABM	500 ng	EUR 329

WDR78 Protein Vector (Human) (pPM-C-HA)
PV046311	ABM	500 ng	EUR 329

WDR78 Protein Vector (Human) (pPM-C-His)
PV046312	ABM	500 ng	EUR 329

WDR78 Protein Vector (Rat) (pPB-C-His)
PV316442	ABM	500 ng	EUR 1166

WDR78 Protein Vector (Rat) (pPB-N-His)
PV316443	ABM	500 ng	EUR 1166

WDR78 Protein Vector (Rat) (pPM-C-HA)
PV316444	ABM	500 ng	EUR 1166

WDR78 Protein Vector (Rat) (pPM-C-His)
PV316445	ABM	500 ng	EUR 1166

WDR78 Protein Vector (Mouse) (pPB-C-His)
PV247218	ABM	500 ng	EUR 1065

WDR78 Protein Vector (Mouse) (pPB-N-His)
PV247219	ABM	500 ng	EUR 1065

WDR78 Protein Vector (Mouse) (pPM-C-HA)
PV247220	ABM	500 ng	EUR 1065

WDR78 Protein Vector (Mouse) (pPM-C-His)
PV247221	ABM	500 ng	EUR 1065

Wdr78 3'UTR GFP Stable Cell Line
TU172263	ABM	1.0 ml	Ask for price

WDR78 3'UTR GFP Stable Cell Line
TU078449	ABM	1.0 ml	EUR 1394

Wdr78 3'UTR Luciferase Stable Cell Line
TU122263	ABM	1.0 ml	Ask for price

WDR78 3'UTR Luciferase Stable Cell Line
TU028449	ABM	1.0 ml	EUR 1394

Wdr78 3'UTR Luciferase Stable Cell Line
TU223372	ABM	1.0 ml	Ask for price

Wdr78 3'UTR GFP Stable Cell Line
TU273372	ABM	1.0 ml	Ask for price

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441

WDR78 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV664135	ABM	1.0 ug DNA	EUR 1355

WDR78 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV664139	ABM	1.0 ug DNA	EUR 1355

WDR78 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV664140	ABM	1.0 ug DNA	EUR 1355

WDR78 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702027	ABM	1.0 ug DNA	EUR 450

WDR78 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702031	ABM	1.0 ug DNA	EUR 450

WDR78 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702032	ABM	1.0 ug DNA	EUR 450

cDNA from Alzheimer's Disease: Brain
C1236035Alz	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain
C1236035Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain
C1236035Par	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus
C1236052Dem	Biochain	40 reactions	EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus
C1236052Dep	Biochain	40 reactions	EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon
C1236090Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus
C1236106Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart
C1236122Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum
C1236130Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney
C1236142Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver
C1236149Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung
C1236152Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung
C1236152Ld-5	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm
C1236169Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas
C1236188Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin
C1236218Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine
C1236226Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord
C1236234Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen
C1236246Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA
HT05-090	Alpha Diagnostics	10 rxn	EUR 415

Human Adult cDNA Tissue: Lung
HA-152	Alpha Diagnostics	10 rxn	EUR 415

Human Adult cDNA Tissue: Skin
HA-218	Alpha Diagnostics	10 rxn	EUR 415

Human Adult cDNA Tissue: Testis
HA-260	Alpha Diagnostics	10 rxn	EUR 415

Total-Transcriptome cDNA Synthesis Kit
G904	ABM	25 reactions	EUR 224

Total-Transcriptome cDNA Synthesis Kit
G905	ABM	100 reactions	EUR 544

Mouse iNOS (macrophage) cDNA probe
iNOS61-D-2	Alpha Diagnostics	2 ug	EUR 445

cDNA Synthesis SuperMix for qPCR
20-abx09801920ulSystems	Abbexa	EUR 690.00 EUR 565.00	100 rxns ×20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Monkey (Rhesus) cDNA Tissue: Thyroid
MR34-265	Alpha Diagnostics	10 rxn	EUR 415

Accuris qMax cDNA Synthesis Kit
PR2100-C-100	BenchMark	1 PC	EUR 337.75
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-25	BenchMark	1 PC	EUR 142.36
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-250	BenchMark	1 PC	EUR 711.77
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-S	BenchMark	1 PC	EUR 77.76
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Evo? cDNA Kit (gDNA Removal)
M1166-100	Biovision		EUR 381

amfiRivert cDNA Synthesis Master Mix
R5101-050	GenDepot	50 rxns	EUR 415

amfiRivert cDNA Synthesis Master Mix
R5101-100	GenDepot	2X50 rxns	EUR 847

amfiRivert cDNA Synthesis Master Mix
R5101-200	GenDepot	4X50 rxns	EUR 1211

amfiRivet cDNA Synthesis 2X Buffer
R5102-050	GenDepot	500ul	EUR 134

amfiRivet cDNA Synthesis 2X Buffer
R5102-100	GenDepot	2x500ul	EUR 192

Human WD repeat- containing protein 78, WDR78 ELISA KIT
ELI-28748h	Lifescience Market	96 Tests	EUR 824

pCDH-CMV-MCS-EF1-Puro cDNA Vector cDNA Clon/Exp Vector [pre-packaged virus]
CD510VB-1	SBI	>1 x 10^6 IFUs	EUR 786
Category: Lentiviral Technology

All-in-One cDNA Synthesis SuperMix
B24403	Bimake	200 ractions	EUR 456
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

All-in-One cDNA Synthesis SuperMix
B24408	Bimake	1000 ractions	EUR 1453
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

AzuraQuant cDNA Synthesis Kit - 25 Reactions
AZ-1995	Real Time Primers	25 Reactions	EUR 153

AzuraQuant cDNA Synthesis Kit - 100 Reactions
AZ-1996	Real Time Primers	100 Reactions	EUR 372

cDNA from Human Tumor Tissue: Adrenal
C1235004-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bladder
C1235010-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bone
C1235023-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Brain
C1235035-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Breast
C1235086	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Colon
C1235090	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Kidney
C1235142	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Liver
C1235149	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Lung
C1235152	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Lymphoma
C1235161-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Mesenchymoma
C1235164-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Nose
C1235178-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Ovary
C1235183-10	Biochain	10 reactions	EUR 494
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Pancreas
C1235188-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Parathyroid
C1235189-10	Biochain	10 reactions	EUR 494
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Prostate
C1235201-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Rectum
C1235206-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Skin
C1235218-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Melanoma
C1235218A-10	Biochain	10 reactions	EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Stomach
C1235248	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Uterus
C1235274	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Brain
C1236035Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Multiple Sclerosis Disease: Brain
C1236035Msc	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Amygdala
C1236036Alz	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Cerebellum
C1236039Alz	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Hippocampus
C1236052Alz	Biochain	40 reactions	EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain: Hippocampus
C1236052Par	Biochain	40 reactions	EUR 801
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Pons
C1236071Alz	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Thalamus
C1236079Alz	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Colon
C1236090Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Esophagus
C1236106Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Heart
C1236122Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congenital heart disease: Heart
C1236122Hd-3	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Coronary Artery Atherosclerosis: Heart
C1236122Hd-5	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congestive Heart Failure: Heart
C1236122Hd-6	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Atrium, left
C1236126Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Atrium, right
C1236127Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Ventricle, left
C1236138Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Ventricle, right
C1236139Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Kidney
C1236142Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Liver
C1236149Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver: Left Lobe
C1236150Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver: Right Lobe
C1236151Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Lung
C1236152Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lymph Node
C1236161Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Pancreas
C1236188Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Skin
C1236218Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Small Intestine
C1236226Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spinal Cord
C1236234Lcs	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Spleen
C1236246Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Stomach
C1236248Dia	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Adipose
C1434003	Biochain	40 reactions	EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.